ID: 1144672988

View in Genome Browser
Species Human (GRCh38)
Location 17:17143442-17143464
Sequence CCTCGCCAGGAGCAAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144672977_1144672988 24 Left 1144672977 17:17143395-17143417 CCTGGCCCTGCTGCAGACTTGCT 0: 1
1: 0
2: 8
3: 57
4: 578
Right 1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 239
1144672976_1144672988 29 Left 1144672976 17:17143390-17143412 CCTGTCCTGGCCCTGCTGCAGAC 0: 1
1: 0
2: 4
3: 54
4: 449
Right 1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 239
1144672980_1144672988 18 Left 1144672980 17:17143401-17143423 CCTGCTGCAGACTTGCTATGGTG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 239
1144672979_1144672988 19 Left 1144672979 17:17143400-17143422 CCCTGCTGCAGACTTGCTATGGT 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144672988 Original CRISPR CCTCGCCAGGAGCAAGGCCC TGG Intronic
900125645 1:1067940-1067962 CCTCGGCAAGGGCCAGGCCCAGG + Intergenic
900295593 1:1947542-1947564 GCTGGTCAGCAGCAAGGCCCCGG + Intronic
900575020 1:3378795-3378817 CCTGGCCAGAACCACGGCCCAGG + Intronic
901409445 1:9072091-9072113 CCTGGCCAGAAGCAGGACCCGGG - Intronic
901624061 1:10613592-10613614 CCTCACCAGTACCAAAGCCCTGG - Intronic
902286625 1:15411582-15411604 CCTCTCCAGGAGCCAGGGGCAGG - Intronic
902619840 1:17644419-17644441 CCTCTCCAGGAGTAGGGCCGAGG + Intronic
903017716 1:20372067-20372089 CCTCCCCAGGCACAGGGCCCAGG - Intergenic
903943244 1:26945993-26946015 GCTGGGCAGGAGCAGGGCCCAGG - Intronic
905232530 1:36523209-36523231 CCTCTCAAGCAGCAAGCCCCAGG + Intergenic
906076508 1:43055932-43055954 GCTCCCCAAGAGCAAGGGCCAGG - Intergenic
906283052 1:44566947-44566969 CCTTGGCAGGGGCAAGGGCCTGG - Intronic
907338186 1:53714440-53714462 CCTCACCAGGAGCAGGGACATGG + Intronic
907393924 1:54176753-54176775 TCTCACCAGCAGCCAGGCCCAGG - Intronic
915262700 1:154689560-154689582 CCTGGCCAGAAGCAATGCTCAGG + Intergenic
915277934 1:154802462-154802484 GCTGGCCAGGGGCAGGGCCCAGG + Intronic
915517764 1:156423005-156423027 CATCCCCTGGAGCACGGCCCTGG - Intronic
916070539 1:161167218-161167240 TCTCACCAGGAGCAAGGTCCGGG - Exonic
919849536 1:201663379-201663401 TCTCAACAGGAGCCAGGCCCAGG - Intronic
921708137 1:218346922-218346944 CTTCTCCTGGAGCAAGTCCCTGG - Exonic
922724896 1:227918209-227918231 CCTCGGGAGGAGGAGGGCCCTGG - Intergenic
922724960 1:227918381-227918403 CCTGGACAGGAGGAGGGCCCTGG - Intergenic
922824992 1:228511753-228511775 CGTGGCCAGGGGCAAGGCCATGG - Intergenic
923465164 1:234241812-234241834 GCTCGCCTGGAACATGGCCCTGG + Intronic
924559291 1:245144102-245144124 CGTGGCCAGGAGTAAGGCACGGG - Intergenic
1062932983 10:1364474-1364496 CTTCTCCAGGAGAAAGGCCAGGG - Intronic
1063382077 10:5591759-5591781 CCTCCCCAGGAACAAGGAGCCGG + Intergenic
1064329434 10:14379803-14379825 CTGCCCCAGGAGCAAGGGCCAGG + Intronic
1065261995 10:23933360-23933382 CCTAGCCAGGAGCACGTCCTGGG - Intronic
1065599069 10:27350156-27350178 CCTGGGCAGGAGCAGGGCCAGGG + Intergenic
1067729388 10:48799080-48799102 CCTGGCCACCAGCATGGCCCAGG + Intronic
1069551658 10:69368454-69368476 CCTGTCCTGGAGCAATGCCCAGG + Intronic
1070833374 10:79433585-79433607 CCTTTCCTGGAGCAAGGCCAAGG + Intronic
1074426305 10:113354536-113354558 CCTCCCCAGGAGTAATCCCCAGG - Intergenic
1075840072 10:125493998-125494020 TCCCTCCAGGAGCATGGCCCAGG - Intergenic
1076180304 10:128401907-128401929 CCTGGCCATGAGCAAGCCTCTGG - Intergenic
1077281488 11:1748106-1748128 CCTCTCCAGGCCCAGGGCCCCGG - Exonic
1077601941 11:3580565-3580587 CCTCGCCAGGTGAGAGGCACCGG + Intergenic
1081503622 11:43691829-43691851 CCTCTGCACAAGCAAGGCCCTGG - Intronic
1081866845 11:46364927-46364949 TCTCCCCAGGACCAGGGCCCAGG + Intronic
1083204092 11:61137598-61137620 GCTGGGCAGGAGCAACGCCCTGG + Intronic
1083474913 11:62909455-62909477 CTTCACCAGGAAGAAGGCCCGGG - Exonic
1083584638 11:63847822-63847844 CCTAGCCAGGAGGAAGGGACTGG + Intronic
1084041543 11:66545833-66545855 CAGCGCCAGCTGCAAGGCCCGGG + Exonic
1084543443 11:69801466-69801488 CCTCCCCAGGCACAAGGGCCAGG - Intergenic
1084589903 11:70084564-70084586 CCTCTCCAGCTGCAAGGCCTGGG - Intronic
1084814910 11:71640126-71640148 CCTCGCCAGGTGAGAGGCACCGG - Intergenic
1086661163 11:89420363-89420385 CCTCTTCAGGAGCATAGCCCTGG + Intronic
1087024789 11:93638965-93638987 CCTGGGCTGGAGTAAGGCCCAGG - Intergenic
1089574608 11:119432510-119432532 TCTCACCAGGAGGCAGGCCCCGG - Intergenic
1091299366 11:134497771-134497793 CCTCTCCAGGAGCCCTGCCCTGG - Intergenic
1091696300 12:2630452-2630474 CCTGCCCAGAAACAAGGCCCAGG - Intronic
1092428087 12:8389908-8389930 CCTCGCCAGGTGAGAGGCACCGG + Intergenic
1094839800 12:34338105-34338127 CCTCACCAGGAGCACGAACCCGG - Intergenic
1100813099 12:98359917-98359939 CTTCTCCAGGAACAAAGCCCTGG - Intergenic
1102670350 12:114613371-114613393 CATCGCCTGGATCAAGGCCAAGG + Intergenic
1105827728 13:24137297-24137319 CCCAGCCAGGAGCAGGCCCCTGG - Intronic
1108227520 13:48304140-48304162 CCTCGCCAGGGGCCGGGTCCCGG + Intronic
1108663511 13:52606955-52606977 ACTCACCAGGGGCAGGGCCCTGG - Intergenic
1112407061 13:99130516-99130538 GCTGGCCAGCAGCAAAGCCCTGG + Intergenic
1112567851 13:100566545-100566567 CCTCGGCAGCCGCAAGGCCAGGG - Intronic
1113200777 13:107866270-107866292 GCTCGCCAGGAGCGCGGGCCAGG + Exonic
1114080601 14:19199418-19199440 CCAGGTCAGGAACAAGGCCCGGG + Intergenic
1117954388 14:61111388-61111410 CCGCGGCAGGAGCGAGGCCCCGG - Intergenic
1118356877 14:65021502-65021524 CCTGGCCAGGAAAAATGCCCAGG - Intronic
1119807868 14:77494144-77494166 CCTAGCCAGGAGCCAGGTCTGGG - Intronic
1122151971 14:99730446-99730468 CCTCGCCGGGAGCCGGGCCTGGG + Intergenic
1123038369 14:105480441-105480463 CCTGGCCAGGACCCTGGCCCCGG - Intergenic
1125608446 15:40955561-40955583 CCTCTTCAGGCGCAGGGCCCAGG - Exonic
1128496587 15:68201665-68201687 CCTTGCCAGCAGCAGGGCCAGGG + Intronic
1129239340 15:74242386-74242408 CCCAGACAGGAGCAAGGACCTGG - Intronic
1130438415 15:83925888-83925910 CCTGTACAGGAGCAAGGCACAGG + Intronic
1130991590 15:88879036-88879058 GCACGCCAGGTGCCAGGCCCGGG + Exonic
1131094899 15:89648840-89648862 CCGCGCCAGGAGCCGGTCCCAGG - Intronic
1132568665 16:634722-634744 CCTCTCCAGGAGCAGGCCACTGG + Exonic
1132587777 16:713752-713774 CCTCGCCCAGAGCAAGGGGCTGG + Intronic
1132614146 16:832017-832039 CCTCAGCAGAAGCAAGGACCAGG + Intergenic
1132739406 16:1403945-1403967 ACTCCCCAGGAGCATGGCTCTGG - Intronic
1133286368 16:4692676-4692698 CCTCACCAGCAGCAGGGCCCAGG - Intergenic
1136105181 16:28025282-28025304 CCTGGCCAGCAGCTAGGGCCAGG + Intronic
1136222326 16:28836360-28836382 CAGAGCCAGGAGCAAGCCCCTGG - Exonic
1137674729 16:50298702-50298724 CCTCCCCAGGAGGAACCCCCAGG - Intronic
1137825328 16:51489749-51489771 CCCTCCCAGGAGCAAGGCCTGGG - Intergenic
1139422572 16:66857601-66857623 TCTAGCCAGAAGCAAGGCCTGGG + Intronic
1140124037 16:72105693-72105715 CAGGGCCAGGAGCGAGGCCCTGG - Intronic
1141083790 16:81077091-81077113 CCACCCCTGGGGCAAGGCCCGGG - Intronic
1141110914 16:81270054-81270076 CCCCGCCAGGAGCTAGGCTCAGG - Intronic
1141563369 16:84884965-84884987 CAGTACCAGGAGCAAGGCCCAGG - Intronic
1141953427 16:87353792-87353814 CTTCGGCGGGAGCAGGGCCCCGG + Intronic
1141997698 16:87645751-87645773 CCTCCACAGGAGCCAGACCCTGG - Intronic
1142235590 16:88921066-88921088 CCTTGCCTGGGGGAAGGCCCAGG - Intronic
1142467816 17:146153-146175 CCTCCCCAGAGACAAGGCCCTGG + Intergenic
1142535720 17:616565-616587 CCAGGCCAGGAGCTTGGCCCTGG + Intronic
1142740526 17:1929320-1929342 CCTGGCCATGTGCAAGGCCCCGG - Intergenic
1143431850 17:6893810-6893832 GCCCGCCAGGAGCAAATCCCCGG - Intronic
1143432407 17:6896612-6896634 CTTGGCCAGGAGCCAGGCCATGG - Intronic
1143972216 17:10803949-10803971 ACTCCCCAGGAGCATTGCCCAGG + Intergenic
1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG + Intronic
1146647866 17:34587262-34587284 CCTCCCCAGGAACACAGCCCTGG + Intronic
1147261584 17:39212231-39212253 CCTGGCCAGAAGCAAGGTCCAGG + Exonic
1147338505 17:39740585-39740607 CCTGGCCTGGAGCTAGGCCGAGG + Intronic
1147645039 17:42028233-42028255 CCTCTCCAGGAGCCAAGCACCGG - Exonic
1147989463 17:44324268-44324290 CCACTCCAGCACCAAGGCCCCGG + Intronic
1148109731 17:45137600-45137622 GGGCGCCAGAAGCAAGGCCCTGG - Intronic
1148202450 17:45758274-45758296 CCCAGCCAGGAGCAGGGCTCTGG + Intergenic
1148700489 17:49583857-49583879 CCACACCAGGAGCAAGGCCAAGG - Intergenic
1148864817 17:50623011-50623033 CCTCCCAAGGAGCAGGGACCAGG - Intronic
1149665963 17:58364913-58364935 CCCAGACAGCAGCAAGGCCCAGG + Intronic
1149850928 17:60033126-60033148 CCTCCCCAGAGACAAGGCCCTGG - Intergenic
1149859238 17:60113398-60113420 CCTCCCCAGAGACAAGGCCCTGG + Intergenic
1150224391 17:63515603-63515625 CCTCCCTAGGAGCAAAGCCCAGG - Intronic
1150479542 17:65498857-65498879 CCTCGCCTGGAGAGAGGCTCTGG - Intergenic
1150653696 17:67025780-67025802 CCTCTCCAGGAGAAAGGGCGAGG - Intronic
1150791670 17:68204908-68204930 CCTTGCCAGGAGCCACGCCCCGG - Intergenic
1151183929 17:72349858-72349880 CTTCTCCAGGAGGGAGGCCCAGG + Intergenic
1154049033 18:10935806-10935828 CCTCGCCAGCAGCAACGCTCCGG + Intronic
1154491530 18:14925778-14925800 CAGCGCCTGGAGCCAGGCCCCGG + Intergenic
1159793131 18:72808919-72808941 CCTTGCCAGGAGCCTGGCACGGG + Intronic
1160579317 18:79874741-79874763 CCTCTCCAGGAGGCCGGCCCAGG + Intronic
1160915237 19:1493226-1493248 CCTCCCCACGAGCCAGGCCCGGG + Intronic
1161168541 19:2801711-2801733 CCCCACCAGGAAGAAGGCCCTGG - Intronic
1162567620 19:11453050-11453072 CCTCCCCGGCAGCAAGACCCCGG - Exonic
1164773852 19:30835059-30835081 CCTCGCCAAGGGCAGGGCCTGGG + Intergenic
1164777184 19:30862071-30862093 CCTCCCCAGCAGCCAGGCCTGGG - Intergenic
1165012632 19:32859811-32859833 CCCCGCCAGCAGCGATGCCCGGG + Intronic
1165420047 19:35718049-35718071 CCCCGCGCGGAGCCAGGCCCGGG - Exonic
1166538738 19:43592277-43592299 GCTCTCCAGAAGCCAGGCCCAGG + Exonic
1167446811 19:49542767-49542789 CCTCGGCAGGAGCGAGGAGCGGG + Intronic
925610887 2:5701522-5701544 CCTCGGCAGGAGGAAGACCACGG + Intergenic
927476989 2:23420971-23420993 CCTGGCCAGGCGCCAGGCCAGGG + Intronic
927902344 2:26829566-26829588 ACTCGCTAGTAGCCAGGCCCTGG - Intergenic
931739863 2:65232177-65232199 CCTCTTCACGAGCTAGGCCCAGG + Intronic
932003315 2:67904787-67904809 GCCAGCCAGGGGCAAGGCCCAGG + Intergenic
933768494 2:85728046-85728068 CCACCCCAGGCGCAAAGCCCTGG - Intergenic
934717567 2:96552415-96552437 CCCAGCCAGGGGCATGGCCCGGG - Exonic
934843308 2:97645461-97645483 CCCTACCAGGACCAAGGCCCTGG - Intergenic
934931602 2:98430117-98430139 CCTGGCCGGGAGCAAGGCAGGGG - Intergenic
937733387 2:125261014-125261036 CCTTGCCAGGTGAAAAGCCCTGG - Intergenic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
948047542 2:234955239-234955261 CCTGGCCAGGAGCGAGCCTCAGG + Intronic
948773764 2:240269410-240269432 CCTGACCAGGAGCAAGGAGCTGG - Intergenic
948819922 2:240537184-240537206 CCTCACCTGCAGCCAGGCCCAGG + Intronic
948845308 2:240680238-240680260 CCTCCCCAGGAGCACTGACCAGG + Intronic
948848553 2:240694641-240694663 CCTCCCCAGGAGCACTGACCAGG - Intronic
1168859702 20:1037123-1037145 CATTGGCAGGAGCAAGCCCCTGG + Intergenic
1169303649 20:4469493-4469515 CCTCCCCAGGCTCCAGGCCCAGG + Intergenic
1169316052 20:4592126-4592148 CCATCCCAGGAGCAACGCCCTGG - Intergenic
1172359650 20:34303176-34303198 CCCCGCCACGAACAAGCCCCGGG + Intronic
1172637863 20:36422121-36422143 CCCAGGCAGCAGCAAGGCCCTGG + Intronic
1175218791 20:57405348-57405370 CCTCGCGCGGAGCCAGGCCTGGG - Intronic
1175870534 20:62207518-62207540 CCTCGGCAGCGGCAAAGCCCAGG - Intergenic
1176059561 20:63166517-63166539 CCTCACCCAGAGCAAGACCCAGG + Intergenic
1177371928 21:20215755-20215777 GCTGGGCAGGAACAAGGCCCAGG + Intergenic
1178922584 21:36748105-36748127 CCGCGCCAGGAGCCTGGACCCGG + Exonic
1180500175 22:15923267-15923289 CCAGGTCAGGAACAAGGCCCGGG - Intergenic
1182218841 22:28742112-28742134 CCACACCCGGAGCAAAGCCCCGG - Exonic
1182370281 22:29805748-29805770 CCAAGCCAGGAGCAAGGACAAGG - Intronic
1183784182 22:40019813-40019835 CCTCTGCAGAAGCAAGGACCTGG + Intronic
1184119643 22:42441454-42441476 CCTCGCCATGAGGGAGGCCCAGG - Intergenic
1184361929 22:44024202-44024224 CCTGGCCTGGAGCGCGGCCCCGG - Intronic
1184455856 22:44609118-44609140 CCTCCCCAGGACGCAGGCCCAGG - Intergenic
1184455882 22:44609197-44609219 CCTCCCCAGGATGCAGGCCCAGG - Intergenic
1184718774 22:46297022-46297044 CCCCGCCAGGAGCCGGGCCTGGG + Intronic
1184734376 22:46389437-46389459 CCTCACCAGCTGCAGGGCCCTGG + Exonic
1185051296 22:48555683-48555705 CCCCGTCATCAGCAAGGCCCAGG + Intronic
952342824 3:32459772-32459794 CCTCCCCAAGAGCAAGGCCAGGG - Intronic
953069658 3:39506509-39506531 CCTCGGCAGGACTAAGTCCCAGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954256936 3:49413559-49413581 GCTCCCCATGAGCAGGGCCCGGG - Intronic
955996869 3:64687473-64687495 CCTGCCCAGGAGCGAGGACCGGG + Intronic
959849805 3:111072325-111072347 CCGCGCCCGGGGCGAGGCCCTGG + Intronic
961485281 3:127211715-127211737 CCAGGCCAGGAGCACAGCCCAGG + Intergenic
961814134 3:129539767-129539789 GCTCTCCAGGAGCAAGGCTGGGG + Intergenic
961873083 3:130002427-130002449 CCTCGCCAGGTGAGAGGCACTGG + Intergenic
962200430 3:133396744-133396766 CCTCTCCAAGAGAAAGGCACGGG - Exonic
965866964 3:173216431-173216453 GCCCGCCAGGAGCCAGGGCCTGG + Intergenic
968125958 3:196160463-196160485 ACTCACCAAGAGCAAGGCCTGGG + Intergenic
968630075 4:1645738-1645760 TCTCTCCAGGAGCCATGCCCAGG - Intronic
968646722 4:1744730-1744752 CCAGGTCCGGAGCAAGGCCCAGG + Exonic
968762210 4:2448642-2448664 CCTGGGCAGGAGCAAGGTGCAGG + Intronic
968917197 4:3501745-3501767 CATCTCCAGGAGCAAGGCAGGGG - Intergenic
968927590 4:3557905-3557927 CCTCCCCAGGGGCAGGGGCCAGG - Intergenic
969610948 4:8227574-8227596 CGTCCCCAGGAGCAGGGCCATGG - Exonic
969737567 4:9001415-9001437 CCTCGCCAGGTGAAAGGCACCGG - Intergenic
978373826 4:108054413-108054435 ACTCGCCAGCTGCATGGCCCTGG + Intronic
979213323 4:118132852-118132874 TCTCTCCAGGAGCTAGGGCCTGG + Intronic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
985780166 5:1866330-1866352 CCTCTCCAGGATCCAGGGCCGGG + Intergenic
987121233 5:14769161-14769183 CCTTGACAGCAGCAATGCCCCGG + Exonic
997266253 5:132496894-132496916 CACCGCCAGCTGCAAGGCCCAGG - Intergenic
997365909 5:133325061-133325083 CCTCTCCAGAAGCAATTCCCAGG - Intronic
997694743 5:135852138-135852160 ACTGGCCAGGGGCCAGGCCCTGG - Intronic
999152532 5:149435798-149435820 TCTGGCCAGGAAGAAGGCCCTGG + Intergenic
999205234 5:149842859-149842881 CCTCTGCAGCAGCAAGTCCCAGG + Intronic
1000705116 5:164501473-164501495 GCTCCACAAGAGCAAGGCCCAGG + Intergenic
1001309653 5:170601882-170601904 CATTGCCAGGGCCAAGGCCCAGG - Intronic
1003778064 6:9391427-9391449 CCTTTCCAGGAGCAAGGTCACGG + Intergenic
1005090154 6:22047844-22047866 CTGGGCCAGGAGCAAGGCCTAGG - Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1008030575 6:46688962-46688984 CCTCTCCGAGAGCATGGCCCAGG + Exonic
1008155479 6:48008826-48008848 CCTGGCCAGAAGCAAGGTCCTGG - Exonic
1011516984 6:88166042-88166064 CCTCGCCAGCAGCCCGGCGCCGG - Exonic
1011649049 6:89489115-89489137 CCCCTTCAGGAGCAATGCCCTGG - Intronic
1013457227 6:110341282-110341304 CCTGTCCAGGAATAAGGCCCAGG + Intronic
1017077503 6:150632473-150632495 CTTGCCCAGGACCAAGGCCCAGG - Intronic
1018388068 6:163322546-163322568 CCTCGCCAGGAAGCACGCCCTGG + Intergenic
1018895801 6:168016169-168016191 ACCCGCCAGGACCAAGCCCCTGG - Intronic
1021115699 7:16744512-16744534 CCTGGGCCTGAGCAAGGCCCAGG - Intergenic
1021961466 7:25877335-25877357 CCTGGCAAGGAACAAGACCCTGG + Intergenic
1022692530 7:32670878-32670900 TCTCCCCAGCAGCGAGGCCCTGG - Intergenic
1022920204 7:35005423-35005445 TCTCCCCAGCAGCGAGGCCCTGG - Intronic
1023170605 7:37386942-37386964 ATTGGCCTGGAGCAAGGCCCAGG + Intronic
1023549689 7:41356688-41356710 CCAAGCCAGGAGGAAGACCCTGG + Intergenic
1024541209 7:50476379-50476401 CCTCCCCAGGAGCAAAGTCCAGG + Intronic
1024563104 7:50660836-50660858 TCCCGCCAGGGCCAAGGCCCTGG + Intronic
1025781890 7:64609219-64609241 GCTCCCTGGGAGCAAGGCCCAGG - Intergenic
1029528319 7:101108956-101108978 CCTGTCCAGGAGCAAGGCCGTGG + Intergenic
1029653760 7:101911262-101911284 CCACGGCAGGACCAAGGCCAAGG - Intronic
1033864870 7:145677356-145677378 CCTTGCCAGAAGCAGTGCCCTGG + Intergenic
1034529622 7:151687741-151687763 CCTGGAATGGAGCAAGGCCCTGG - Intronic
1034965331 7:155387270-155387292 ATTCCCCAGGAGCAAGGCCTTGG - Intronic
1035560705 8:601727-601749 CCTGGCCAGGAGCAGGGGGCAGG + Intergenic
1040392561 8:46962162-46962184 CCCCTCCAGCAGCAAAGCCCTGG - Intergenic
1042980325 8:74519199-74519221 GCTCCCCAGGAGCCAGGACCTGG - Intergenic
1047283305 8:123464534-123464556 CCTCCCCAGGGGTAAGGGCCAGG + Intronic
1048927741 8:139286001-139286023 CCAGGCATGGAGCAAGGCCCTGG - Intergenic
1049401866 8:142431550-142431572 CCTCAACTGGAGCTAGGCCCAGG - Intergenic
1049672782 8:143877245-143877267 GCTTGGCAGGAGGAAGGCCCGGG + Intronic
1051372611 9:16371285-16371307 CATCTCCAGGAGTAAGCCCCTGG + Intergenic
1052355660 9:27502599-27502621 CCTCCCCAGGAACACGGCCAGGG + Intronic
1053174602 9:35912863-35912885 CTTCACCAGGAGCCAGGCCCAGG + Intergenic
1053411719 9:37920128-37920150 CCAAGCCAGGACCGAGGCCCAGG + Intronic
1056655365 9:88504283-88504305 ACACACCAGGAGCAGGGCCCAGG - Intergenic
1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG + Intergenic
1057931802 9:99200165-99200187 CCTGGCCAAGAGAAAGGCCAAGG - Intergenic
1058752619 9:108053753-108053775 CCTGGCCAGGAGAAAGGAACTGG - Intergenic
1059587433 9:115620936-115620958 CTTCCCCAGGGGCAAGGGCCAGG - Intergenic
1060547138 9:124468299-124468321 CCTGGGGAGGAGCAGGGCCCGGG + Intronic
1060716359 9:125933560-125933582 GGTGCCCAGGAGCAAGGCCCAGG - Intronic
1061237319 9:129350676-129350698 CCTCGCCTTGACCAAGGACCAGG - Intergenic
1061244582 9:129394872-129394894 ACTCGCCAGGAGCCAGACACTGG + Intergenic
1061314182 9:129783972-129783994 CCTCGCCAGGGGCTTGGCCGAGG - Intergenic
1061431869 9:130536369-130536391 CCTCCCCAGGAGCCAGGCTCTGG - Intergenic
1061514662 9:131082004-131082026 GCTCCACAGGAGCAGGGCCCAGG - Intronic
1061814948 9:133188961-133188983 CCTAGCCAGCAGCCAGACCCTGG + Intergenic
1061926097 9:133806758-133806780 CCAGGCCAGGAGGAAGGGCCAGG + Intronic
1062041116 9:134404779-134404801 CTGCGCCAGGAGCAGGCCCCTGG - Intronic
1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG + Intergenic
1062573367 9:137195514-137195536 CCTGGCCAGCACCAAGCCCCAGG - Intronic
1062591497 9:137276712-137276734 CCCCTCCAGGAGCCAGGCCTAGG - Intergenic
1062633881 9:137479743-137479765 CCTCGCCTGCAGCAATGGCCAGG + Intronic
1186471029 X:9822340-9822362 ACTGCCCTGGAGCAAGGCCCTGG - Intronic
1190213738 X:48467080-48467102 GCACGCAAGGAGCAAAGCCCGGG + Intronic
1192397356 X:70795353-70795375 GCTGGCCAGGAACAAGGGCCTGG - Intronic
1199890320 X:152072550-152072572 CCTCGCCAGTAGAATTGCCCAGG + Intergenic
1200114914 X:153765766-153765788 CAGCGCCTGGAGGAAGGCCCAGG - Intronic
1201321350 Y:12701176-12701198 CCTAGACAGGGGCAAGTCCCTGG - Intergenic
1201684293 Y:16683575-16683597 CCTAGCAATGAGCAAGGCTCTGG - Intergenic
1202190219 Y:22234788-22234810 CCTTGTCAGGAACAAAGCCCAGG - Intergenic