ID: 1144673448

View in Genome Browser
Species Human (GRCh38)
Location 17:17146066-17146088
Sequence CTGACTAAGCAGTATGAGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144673440_1144673448 18 Left 1144673440 17:17146025-17146047 CCCTTTCTCAGCCCGACCTGCTG 0: 1
1: 0
2: 2
3: 18
4: 172
Right 1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG 0: 1
1: 0
2: 0
3: 10
4: 157
1144673445_1144673448 2 Left 1144673445 17:17146041-17146063 CCTGCTGAATTTCAAGAAAGGCT 0: 2
1: 0
2: 7
3: 107
4: 644
Right 1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG 0: 1
1: 0
2: 0
3: 10
4: 157
1144673443_1144673448 6 Left 1144673443 17:17146037-17146059 CCGACCTGCTGAATTTCAAGAAA 0: 2
1: 2
2: 59
3: 802
4: 7204
Right 1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG 0: 1
1: 0
2: 0
3: 10
4: 157
1144673442_1144673448 7 Left 1144673442 17:17146036-17146058 CCCGACCTGCTGAATTTCAAGAA 0: 2
1: 0
2: 1
3: 15
4: 222
Right 1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG 0: 1
1: 0
2: 0
3: 10
4: 157
1144673441_1144673448 17 Left 1144673441 17:17146026-17146048 CCTTTCTCAGCCCGACCTGCTGA 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG 0: 1
1: 0
2: 0
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144673448 Original CRISPR CTGACTAAGCAGTATGAGGA CGG Exonic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901751728 1:11414211-11414233 CAGACAAAGCAGGGTGAGGAGGG - Intergenic
902646572 1:17803643-17803665 CTTATTTAGCAGCATGAGGACGG + Intronic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904021719 1:27471711-27471733 CTGACAAAGGAGGATCAGGAAGG + Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905295703 1:36953201-36953223 CTGACTAAGTGCTATGAGGCAGG - Intronic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
908219396 1:61989085-61989107 CTGACAAATCAGTGTGAGGATGG - Intronic
908393624 1:63705457-63705479 CTGAGGAAGCAGTATGAACAAGG - Intergenic
908556300 1:65259888-65259910 CTGACTTAGTAGGATGAGCAAGG + Intronic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
921402611 1:214742897-214742919 ATGACTAAGCTTAATGAGGAAGG - Intergenic
923788234 1:237088769-237088791 CTGTCTAAGTACTATGAGAAAGG - Intronic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1072903323 10:99429028-99429050 TTCACTAAGGAGTATGGGGAGGG - Intronic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1081291630 11:41333298-41333320 CTGAGTATGCAGTATGATTAAGG - Intronic
1081320787 11:41689473-41689495 CAGACTTGGCTGTATGAGGAGGG + Intergenic
1083961587 11:66017587-66017609 CTGACTACACAGCATGATGAAGG - Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088807935 11:113368789-113368811 ATGACTAAGAAGTATTAGGTTGG + Intronic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1090721901 11:129482966-129482988 TTGGCTTAGCAGTAAGAGGATGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1094713843 12:32991774-32991796 CAGTCTGAGCAGTATGGGGAGGG + Intergenic
1095985456 12:47996328-47996350 GTGACTAAGAAGAATGAAGATGG - Intronic
1098288881 12:68935726-68935748 TTGACTAAGAGGTCTGAGGAGGG + Intronic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1103443656 12:120980462-120980484 CTGACTTGGCAGGAAGAGGAGGG + Intronic
1108293501 13:48987517-48987539 CTGACTAAGAAGGGTGAGGATGG + Intronic
1108839372 13:54593333-54593355 CTGGCTAAGCAATGTGCGGAGGG - Intergenic
1108946665 13:56034647-56034669 TTAACTAAGCAGTAAGAAGAAGG - Intergenic
1109594910 13:64538523-64538545 CTGACTCAGAAGGCTGAGGAGGG + Intergenic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1114574167 14:23697326-23697348 CTGACCAAGTAGTATGTGTACGG - Intergenic
1115692068 14:35854974-35854996 CTGCCTAGGCAGTAAGAGGGGGG - Intronic
1117815338 14:59592384-59592406 CTGATTAAGGAGCTTGAGGAGGG + Intergenic
1119564911 14:75620234-75620256 CTGACAAACCAGTATGACCAAGG + Intronic
1120913677 14:89690771-89690793 CGGACTTAGCAGACTGAGGAAGG + Intergenic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1125493028 15:40162613-40162635 CTGACTGAGGGGTATGAGAAGGG + Intronic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1129893170 15:79085328-79085350 TGGCCTAAGCAGGATGAGGAAGG + Intronic
1130636021 15:85620808-85620830 GTGTCTAAGCAGGATGAGGGCGG + Intronic
1132957969 16:2606407-2606429 CTGACTGAGGAATCTGAGGAGGG + Intergenic
1132970445 16:2685655-2685677 CTGACTGAGGAATCTGAGGAGGG + Intronic
1133280597 16:4662938-4662960 CTGACTAAGACCCATGAGGAAGG - Intronic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1137710665 16:50564442-50564464 CTGACAAAGCCCTGTGAGGAAGG - Intronic
1137899441 16:52250020-52250042 CTGACAAAGCAGTACAATGAAGG - Intergenic
1138144385 16:54595645-54595667 CTGACTAAGCATTAAGGGGAGGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141584279 16:85022983-85023005 CTGACTAGGCAGACAGAGGAAGG + Intergenic
1141824307 16:86468330-86468352 CTGACTCTGCAGGATGGGGAGGG - Intergenic
1143125067 17:4636685-4636707 CAGGCTAAGGAGTATGAGGTGGG - Intronic
1144535544 17:16086197-16086219 CTGACAAATCAGTGCGAGGAGGG + Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1145046294 17:19619512-19619534 CTGACTAAGCTACATAAGGAAGG - Intergenic
1147506667 17:41024820-41024842 CTGACTCAGAATTCTGAGGATGG + Intergenic
1148056981 17:44805016-44805038 CTCACTAAACAGTAAAAGGAGGG - Exonic
1151979314 17:77499299-77499321 CTGGCCAAGCAGTCTGCGGATGG - Exonic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155509962 18:26566607-26566629 CTGAATTTGCAGTTTGAGGAGGG + Intronic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1156194661 18:34760552-34760574 CTAATGAAGCAGTCTGAGGAGGG + Intronic
1157173973 18:45433955-45433977 CTGAGTAAGTATTATGAGCATGG - Intronic
1159298197 18:66523759-66523781 CTGACCATGCAGTATGACAAAGG + Intronic
1165536215 19:36448020-36448042 CTCACAAAGCATTATGAGGTAGG + Exonic
1166068122 19:40371990-40372012 CTGACCAAGCAGAATGAGCTGGG - Intronic
1167340584 19:48913547-48913569 CTTACCATGCAGTATGAAGAAGG - Exonic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
925834862 2:7934721-7934743 CTGTCTAAGCAGTGTATGGAGGG + Intergenic
927765305 2:25801933-25801955 CTGACTGAGCAGTTTGTGTATGG - Intronic
930927466 2:56836350-56836372 CTGCCTAAGCATTTTGAAGAAGG - Intergenic
937460334 2:122079836-122079858 CTGACCAGGCAGTTTGAGGCTGG - Intergenic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943501149 2:188691133-188691155 CAGACAAAGCAGTATTAAGAGGG - Intergenic
947612539 2:231532857-231532879 GGGACTCAGCAGGATGAGGAGGG - Intergenic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
1174910411 20:54602001-54602023 ATGACTAAGAAGTATGGGAATGG - Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1183652589 22:39166843-39166865 CTACCAAAGAAGTATGAGGAGGG + Intergenic
1183922058 22:41177438-41177460 GTGGCTGAGCAGTCTGAGGAGGG - Exonic
1184302598 22:43570993-43571015 TTAACAAAGCAGTATGAGGAAGG + Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952006710 3:28849640-28849662 CTGAATCAGCAGTCTGAAGATGG + Intergenic
952599898 3:35067462-35067484 CTCACTCAGGAGTATGAGGCAGG - Intergenic
952678385 3:36061065-36061087 CTGACTAAACAGTGTGATGACGG - Intergenic
953391192 3:42534851-42534873 ATGACCAGGAAGTATGAGGATGG - Intronic
954892471 3:53943795-53943817 CTCTCTGAGCAGTATAAGGATGG - Intergenic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
960314060 3:116154707-116154729 ATGACTAAGCAAAATGAGTAGGG - Intronic
960866684 3:122208803-122208825 CTTTCTAATCAGTATGAGGAAGG - Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
969107239 4:4816896-4816918 CTTTCTTAGCAGTATGAGAATGG + Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
972945456 4:44248869-44248891 CTCACTAAACAGTTTGAGGCAGG - Intronic
975909234 4:79248294-79248316 CTGACAAAGCAGTATGGGGGAGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
988655539 5:33207453-33207475 ATGATTAAGCTTTATGAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991544439 5:67765879-67765901 CTGACACAGCAGGATGAGGTGGG - Intergenic
992160854 5:73999941-73999963 CTCAGTAGGCAGTATGAGGAGGG + Intergenic
992672095 5:79070510-79070532 GTGACTAAGCAAAATTAGGAAGG + Intronic
993224732 5:85153304-85153326 CTGCCTGAGCAGGATGGGGAAGG - Intergenic
993727295 5:91382699-91382721 ATAACTAAGCAGTTTGAGAAAGG - Intronic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1001990808 5:176114142-176114164 CTCACTAAGCAGCCTGTGGAGGG - Exonic
1002226066 5:177723998-177724020 CTCACTAAGCAGCCTGTGGAGGG + Exonic
1002267779 5:178047212-178047234 CTCACTAAGCAGCCTGTGGAGGG - Exonic
1002871580 6:1171160-1171182 CTCACTGAGGAGTATGTGGAAGG - Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1008583376 6:52926402-52926424 CTGACTAAGTAGTATGTGTACGG - Intergenic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1010376863 6:75180980-75181002 GTGACTGCGGAGTATGAGGATGG - Exonic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018924661 6:168197858-168197880 TGGACTCAGCAGGATGAGGAAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020665921 7:11043928-11043950 CAGGCTGAGCAGTATCAGGAGGG - Intronic
1021612408 7:22471078-22471100 CTGACTTAGAAGTTTGAAGAAGG - Intronic
1023326714 7:39068920-39068942 CTTATTTAGCAGTTTGAGGAAGG + Intronic
1028955149 7:96681000-96681022 CTGACTTAAGAGGATGAGGAGGG + Intronic
1030176064 7:106655761-106655783 CTGACTATGCAGTAGGAGATTGG - Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1032768657 7:135025148-135025170 CTGACTATGTACCATGAGGATGG - Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1036464851 8:8987312-8987334 CAAACTTAGCTGTATGAGGAGGG + Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1042456449 8:69010359-69010381 GTGGCTGAGTAGTATGAGGATGG - Intergenic
1042765062 8:72312425-72312447 CTGGCTAAGAATTGTGAGGAGGG - Intergenic
1045318291 8:101062026-101062048 CTGACTATGCATCCTGAGGAGGG - Intergenic
1048984148 8:139723237-139723259 CTGACGAAGCAACATGAGAAAGG - Intergenic
1049126950 8:140799239-140799261 TTTACAAAGCAGTTTGAGGAAGG - Intronic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1054829840 9:69611337-69611359 CTGACTAGTCAGTGTGAGCAGGG - Intronic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1062035972 9:134382684-134382706 CTGAGTGGGCAGTATGAGGGTGG + Intronic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1189591884 X:42521624-42521646 CTGATTAAGGGGTATGAGCAAGG + Intergenic
1189863585 X:45299695-45299717 CTGACTAATCAGTAAGAAAAAGG + Intergenic
1191013200 X:55782830-55782852 CTGATTCAGCTGTATGAAGAAGG + Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1195245966 X:102995604-102995626 TTGACTAAGCAGGATAAGGCAGG - Intergenic
1195963883 X:110413093-110413115 AGCACTGAGCAGTATGAGGATGG - Intronic
1199169154 X:144716300-144716322 CTGACAAATCAGGATGAGGTGGG - Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic