ID: 1144674691

View in Genome Browser
Species Human (GRCh38)
Location 17:17154237-17154259
Sequence CTTTGGAGATGGAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 389}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144674681_1144674691 9 Left 1144674681 17:17154205-17154227 CCCTGTGGGACTTTACCCAGTGC 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 389
1144674685_1144674691 -6 Left 1144674685 17:17154220-17154242 CCCAGTGCAGGGAGCTTCTTTGG 0: 1
1: 0
2: 2
3: 30
4: 175
Right 1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 389
1144674676_1144674691 27 Left 1144674676 17:17154187-17154209 CCCAGTCACAGCCTTTCTCCCTG 0: 1
1: 0
2: 1
3: 33
4: 384
Right 1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 389
1144674680_1144674691 16 Left 1144674680 17:17154198-17154220 CCTTTCTCCCTGTGGGACTTTAC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 389
1144674677_1144674691 26 Left 1144674677 17:17154188-17154210 CCAGTCACAGCCTTTCTCCCTGT 0: 1
1: 0
2: 2
3: 33
4: 362
Right 1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 389
1144674682_1144674691 8 Left 1144674682 17:17154206-17154228 CCTGTGGGACTTTACCCAGTGCA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 389
1144674687_1144674691 -7 Left 1144674687 17:17154221-17154243 CCAGTGCAGGGAGCTTCTTTGGA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144674691 Original CRISPR CTTTGGAGATGGAGGGCAGC AGG Intronic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900670031 1:3846359-3846381 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900670373 1:3849637-3849659 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900877150 1:5350941-5350963 CATTGAACATGGATGGCAGCAGG - Intergenic
900938181 1:5780275-5780297 CTTTGGAGAGGGCAGGAAGCAGG + Intergenic
902258725 1:15207717-15207739 CTTTGCAGGTGGAAGTCAGCAGG - Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
903280233 1:22245964-22245986 CTTAGGAGAGGGAGGGAGGCAGG + Intergenic
904461529 1:30683605-30683627 CTCTGGAAATGGAGAGCATCTGG - Intergenic
905252900 1:36661071-36661093 GCTTGGTGAAGGAGGGCAGCAGG + Intergenic
905281726 1:36853583-36853605 CTCAGGAGAGGGAGGGCAGGCGG - Intronic
906007381 1:42487664-42487686 CTTTGAAGATGGAGGAGACCAGG + Intronic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907510712 1:54956240-54956262 CTTTGGAAATTGAGGGCAATTGG + Intergenic
907943417 1:59110392-59110414 CTTTGGAGATTGACTCCAGCTGG - Intergenic
910253723 1:85225219-85225241 CCTTGGAGCTGGAGGCCAGGCGG - Intergenic
910655472 1:89614125-89614147 CTCAGGAGTTGGAGAGCAGCTGG - Intergenic
910902933 1:92142180-92142202 CTTGGAAGAAGGAGGGCAGCTGG + Intronic
911488177 1:98528338-98528360 CTTTGGAGTTGGTTGGAAGCTGG - Intergenic
911574767 1:99562330-99562352 GTGGGGAGAGGGAGGGCAGCAGG + Intergenic
912507371 1:110165496-110165518 CCTTGGAAGAGGAGGGCAGCAGG + Intronic
913232402 1:116751344-116751366 CACTGGAGTTGGATGGCAGCTGG + Intergenic
913527948 1:119712088-119712110 CTTGCAAGATGGAGGGCTGCAGG + Exonic
913689135 1:121261680-121261702 CCTTGGAGCTGGAGACCAGCTGG - Intronic
914148463 1:145018601-145018623 CCTTGGAGCTGGAGACCAGCTGG + Intronic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
914718850 1:150272729-150272751 CTTTGGAGGAGGAGGGGAGGCGG + Intronic
914846986 1:151288869-151288891 CCATGGAGATGGGGGGAAGCAGG + Intronic
915405819 1:155658969-155658991 CTTTGGTAATTGAGGGCAACTGG - Intergenic
915940389 1:160115137-160115159 GTTTGGAGATGGAGGCAAGAGGG - Intergenic
916299337 1:163256432-163256454 GTTTGGAGGTAGAGGGGAGCAGG + Intronic
916757755 1:167789766-167789788 CTATGAACATGGAAGGCAGCAGG - Exonic
917788852 1:178486901-178486923 CCTTGGGGCTGGAGGGCCGCTGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919754085 1:201055820-201055842 CTTTGGTGGTGGAGGCCAGGAGG - Intronic
919802073 1:201360027-201360049 CTTCCGGGATGGTGGGCAGCTGG - Intronic
919907023 1:202085261-202085283 CCTTGGAGAGGGAAGGGAGCTGG - Intergenic
920476458 1:206280155-206280177 CCTTGGAGCTGGAGACCAGCTGG - Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921081156 1:211739193-211739215 CCTTGGAGAGGAAGGACAGCAGG - Intergenic
921573295 1:216803990-216804012 ATTTGGAAAGGGAGGGCAGATGG - Intronic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
922773845 1:228206112-228206134 GTTTGGAGATGCAGCGGAGCAGG + Intronic
1065780222 10:29160381-29160403 GTTGGGAGATGGTGGGCAGAGGG + Intergenic
1066116794 10:32247772-32247794 CCTTTTAGATGGATGGCAGCAGG - Intergenic
1067061929 10:43082082-43082104 CTTGGGGAATGGAGGGGAGCGGG - Intronic
1068349209 10:55821630-55821652 CTTTGGAGATGAAGGAAAACTGG - Intergenic
1068731142 10:60359258-60359280 ATTGGGAGAGTGAGGGCAGCAGG - Intronic
1068911434 10:62382299-62382321 CATTGGATATAGAGGTCAGCGGG + Intronic
1068988696 10:63130048-63130070 CTTTGAAGATGCAGTGCTGCTGG + Intergenic
1069734639 10:70645788-70645810 CTTTGGAGATGCAGGGGTGCAGG + Intergenic
1069955178 10:72045925-72045947 CTCTGGAGAGGCAGGGCAACTGG + Intergenic
1070000766 10:72375375-72375397 CTATGGAGATGGAATGCAACTGG + Intronic
1070576202 10:77680941-77680963 CTTTGAACATGGATGCCAGCAGG + Intergenic
1070797682 10:79226344-79226366 CTCTGGAGATGCAGGGCCACAGG + Intronic
1071188726 10:83076445-83076467 ATTTCTAGAGGGAGGGCAGCTGG - Intergenic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1073812196 10:107164112-107164134 GCTAAGAGATGGAGGGCAGCAGG - Exonic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1075715082 10:124551198-124551220 CTGCGCAGAAGGAGGGCAGCTGG + Intronic
1076019919 10:127064380-127064402 CATTGAAGAGGGAGGGCAGGAGG + Intronic
1076880226 10:133236314-133236336 CTCCGGAGATGAAGTGCAGCGGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077160208 11:1109243-1109265 CTCTGGTGAGGGAGGGCAGCAGG - Intergenic
1077473591 11:2776201-2776223 CCCTGCAGAGGGAGGGCAGCTGG + Intronic
1077491909 11:2864874-2864896 GTTTGGAGGCGGAGGGCAGCTGG - Intergenic
1078196835 11:9143577-9143599 CATAGGAGAGGCAGGGCAGCTGG + Intronic
1078337108 11:10473365-10473387 CTTTAGGGAGGAAGGGCAGCTGG + Intronic
1078399275 11:11009988-11010010 GTTTGGAGAGGGAGGGGAGAAGG + Intergenic
1078528921 11:12121385-12121407 CTTTGGAGGAGGTGGTCAGCTGG - Intronic
1078672886 11:13380633-13380655 CTTAGGACATGGACGGCACCAGG - Intronic
1079392273 11:20032873-20032895 CTTTGGAGATGGAAGGCACGTGG + Intronic
1080700503 11:34640210-34640232 CTTTGGAGCTGGAGAGATGCAGG - Intronic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1082180173 11:49107254-49107276 TTTTGGAGAGGTAGGACAGCTGG - Intergenic
1083148538 11:60775812-60775834 ATGTGGTGAGGGAGGGCAGCTGG - Exonic
1083457825 11:62790835-62790857 GCTTCGAGCTGGAGGGCAGCAGG - Exonic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084697125 11:70762450-70762472 TTCTGGAGTTGGTGGGCAGCTGG + Intronic
1085313297 11:75528720-75528742 CTTGGGAGAAGTAGGGCATCAGG - Intergenic
1085386861 11:76162607-76162629 CCCTGGAGAAGGAGGGCAGGTGG - Intergenic
1085460296 11:76689364-76689386 TTTAGGAAAAGGAGGGCAGCAGG + Intergenic
1085816198 11:79739736-79739758 CTTTGGACATGGAGAGATGCAGG - Intergenic
1086009522 11:82083307-82083329 CTTTGTTGGTGTAGGGCAGCTGG + Intergenic
1086685314 11:89727611-89727633 TTTTGGAGAGGTAGGACAGCTGG + Intergenic
1086743390 11:90395765-90395787 CTTTAGGGATGGAGAACAGCTGG + Intergenic
1087266067 11:96062683-96062705 CTTTGGATAAGGAGAGCTGCTGG - Intronic
1088103015 11:106175694-106175716 GTTTGGAAATTGAGGGCAGTTGG + Intergenic
1088828932 11:113518809-113518831 CTTGGAGAATGGAGGGCAGCTGG - Intergenic
1089256941 11:117199136-117199158 CTTTGGAGATGGAGCGGGCCGGG - Intergenic
1091446791 12:548318-548340 CCCTGGAGATGGAGGCCAGGTGG + Intronic
1091577364 12:1750457-1750479 CTTGGCAGGTGGAGGGCAGGAGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092032107 12:5294854-5294876 ATTTGGAGATGAAGGACAGATGG - Intergenic
1092150003 12:6241477-6241499 CTTGGGAGCTGGGGGGCAGCCGG - Intergenic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092515429 12:9206953-9206975 CTTTCTGGATGGAGAGCAGCTGG + Intronic
1092523221 12:9294077-9294099 CTTTTGAGCTGGAGGTCAGCAGG + Intergenic
1092544071 12:9437822-9437844 CTTTTGAGCTGGAGGTCAGCAGG - Intergenic
1093111983 12:15163659-15163681 ATTAGGAGATGGAAGGCAACAGG + Intronic
1093895447 12:24569936-24569958 CTTTGAAGTTGGAGAACAGCTGG - Intergenic
1094202788 12:27810347-27810369 CTTTGGTGAGGGAGTGCAGGCGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094508873 12:31084228-31084250 TTTTTGAGCTGGAGGTCAGCAGG + Intronic
1095738730 12:45585700-45585722 CTTCCGAGACGGTGGGCAGCCGG + Intergenic
1095876377 12:47083367-47083389 CTTTGGAGATGGAGCTCACTGGG + Intronic
1096135746 12:49198964-49198986 CTTTGGAGAAGGAAGGGGGCAGG - Intronic
1096189411 12:49605550-49605572 CTTTGGAGGTTAAGGGCACCAGG + Exonic
1096820052 12:54226932-54226954 CTTTGGAAATGTGGGGAAGCGGG - Intergenic
1097155336 12:57007885-57007907 CTCTGGAGACAGAGGGCTGCTGG + Intergenic
1102206958 12:111097384-111097406 CTCTGGAGATGGAGGGCTTGGGG - Intronic
1102657204 12:114492050-114492072 CTTTGGAGAGGAAGGGGAGTGGG + Intergenic
1103207268 12:119139734-119139756 CTTAGTAAATGGAGGGCAGGGGG - Intronic
1104910474 12:132237925-132237947 CCCTGAAGCTGGAGGGCAGCAGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105805495 13:23949693-23949715 CTTTGGACATGGGGGCCAGCTGG + Intergenic
1106513328 13:30430528-30430550 TTTTGGAGAGTGAGGGCTGCTGG + Intergenic
1108497146 13:51036186-51036208 CTTGGGAGAAGGGGGGCCGCTGG - Intergenic
1108758480 13:53532774-53532796 CTTTGAAGATGGGGGGAAGGGGG + Intergenic
1109378380 13:61525821-61525843 GTTTGGAGATGGGGGGCCGTGGG + Intergenic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1112143505 13:96672468-96672490 GGTTGGAGATGGAGGGCTGCTGG - Intronic
1113125578 13:106975213-106975235 CCTTACAGATGGATGGCAGCTGG + Intergenic
1113928274 13:113952986-113953008 CTTTGGAGACTGTGGGGAGCAGG - Intergenic
1114412136 14:22510990-22511012 GTTTGGAGATGGAACTCAGCTGG + Intergenic
1116577115 14:46588385-46588407 CCTTGGAAATTGAGGGCAGTCGG - Intergenic
1118480831 14:66163658-66163680 CTTTGGGGATGGGGGGCTGGAGG - Intergenic
1118576336 14:67245009-67245031 CTTTGAAGATGGAGGAGAGCAGG + Intronic
1119182605 14:72614815-72614837 CTAAGGAGCTGGAGGGCAGCAGG - Intergenic
1119394325 14:74315042-74315064 CTTGGGAGAGGAAGGGAAGCAGG + Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119681974 14:76599308-76599330 CTTTGGAGAAGGCTGGAAGCTGG + Intergenic
1119975840 14:79023040-79023062 TTTGGTTGATGGAGGGCAGCGGG + Intronic
1120823394 14:88933479-88933501 CTTCTGAGATGGAGGGGACCTGG - Intergenic
1121489469 14:94347649-94347671 CATTGCAGCTGGAGGGCAGCTGG + Intergenic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1121937963 14:98037776-98037798 CTGCCGAGATGGAGGGCAGTGGG - Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1126463815 15:48942057-48942079 CTATGAAGATGGACAGCAGCAGG + Intronic
1127378304 15:58405475-58405497 CTTTGAAGATGGAGGGTGCCAGG - Intronic
1128913283 15:71536296-71536318 CTTTGAAGATGAAGGGGACCTGG - Intronic
1129257584 15:74342831-74342853 CTTTGGAAATGGAGGCAAGGAGG + Intronic
1129350026 15:74950611-74950633 CTTGGGAGATGAAGGGCAAGGGG + Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130060028 15:80563055-80563077 ATTTGGAGAAGGAAGTCAGCAGG - Intronic
1130707597 15:86247900-86247922 CTCTGCAGCTGGAGGCCAGCTGG + Intronic
1130897466 15:88182431-88182453 ATTTGGTAACGGAGGGCAGCTGG - Intronic
1133047548 16:3097359-3097381 GTTGGGAGATGCAGGGGAGCCGG - Intronic
1133777713 16:8910555-8910577 GTTGGGAGATGGAGTGCAGCTGG - Intronic
1134675147 16:16085189-16085211 CCTGGGAGATGGAGCACAGCAGG - Intronic
1136003784 16:27314708-27314730 ATTGAGAGATGGAGAGCAGCTGG - Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1136987731 16:35126524-35126546 GGTTGGAGATGGAGGACAGATGG + Intergenic
1137765400 16:50973927-50973949 ACTTGGAGATGGAGGGCAGCAGG - Intergenic
1137875271 16:51990708-51990730 CTCAGGAGATGGAGGGTAGGAGG - Intergenic
1138120881 16:54400277-54400299 CTTTGGAGCGGGAGTGCAGCAGG + Intergenic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140783673 16:78319157-78319179 CTTTGAAAATGGAGGGAGGCGGG + Intronic
1141150450 16:81561295-81561317 CTTTAGAGAAAGAGGGCAGAGGG + Intronic
1141531726 16:84650863-84650885 CTTTAATGATGGAGGGAAGCAGG + Exonic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144837086 17:18162186-18162208 CCTGGGTGAGGGAGGGCAGCTGG + Intronic
1145266209 17:21380732-21380754 CCTTGGACATGTAGGGAAGCAGG + Intronic
1145832571 17:27928744-27928766 ATTTGGAGATGGAGGGCTTGAGG + Intergenic
1145969767 17:28950068-28950090 CACTGGAGGTGGAAGGCAGCCGG + Exonic
1146307473 17:31741633-31741655 CTTTGGATATGGAGGGCTCTGGG + Intergenic
1146771173 17:35569887-35569909 CTTTCTAGATGGAGGGCATAAGG + Intergenic
1147447612 17:40484313-40484335 CCTTGGGGCTGGAGGGCATCGGG + Intronic
1148645307 17:49216787-49216809 ATTTGGACATGGAGGAAAGCAGG - Intronic
1148758906 17:49989378-49989400 CTTTGGAGACGGAGAGCTGGAGG - Intergenic
1149029942 17:52071314-52071336 CTTTGCAGTTGGAGGAAAGCAGG - Intronic
1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG + Intergenic
1151277457 17:73046382-73046404 CCTGGGAGATGGAAGGCAGGAGG + Intronic
1151281118 17:73074635-73074657 CTTTGGAAATAGAGAACAGCTGG + Intronic
1151376820 17:73694837-73694859 ATGTGGAGAGAGAGGGCAGCTGG - Intergenic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153168840 18:2292542-2292564 CTTTGGAAATTGAGGGCAATTGG + Intergenic
1153503594 18:5772553-5772575 ATTTCCAGATGGAGTGCAGCAGG + Intergenic
1155803939 18:30142597-30142619 CCTTGGAAATTGAGGGCAGTTGG - Intergenic
1158452758 18:57581521-57581543 CTTAGGAGGAGGAGGGCAGAAGG - Intronic
1158973203 18:62687379-62687401 CTTTGGGGATGGAAGGGAACAGG - Intergenic
1159909080 18:74126792-74126814 CTTTGAAGCTGGACTGCAGCTGG - Intronic
1160070847 18:75626490-75626512 CCTTAGCTATGGAGGGCAGCTGG - Intergenic
1160734861 19:657883-657905 CCTTGGAGGAGGAGGGCGGCTGG - Intronic
1161198485 19:3000723-3000745 CCTTGGGGAAGGAGAGCAGCAGG + Exonic
1161839718 19:6672201-6672223 CTTTGGAGATCTAGGGAAGATGG - Intergenic
1162086520 19:8252816-8252838 TTTTGGAGGTGGAGGGCGGGAGG - Intronic
1162495632 19:11021889-11021911 TCTTGAAGATGGTGGGCAGCAGG - Exonic
1162679929 19:12333200-12333222 CTGGGGAGATGGGGGGCTGCGGG + Intronic
1164016592 19:21260252-21260274 CTTCGCAGATGATGGGCAGCCGG + Intronic
1164223623 19:23221594-23221616 TCTTTGAGATGGAGTGCAGCTGG + Exonic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165383962 19:35499765-35499787 GTTTGGAAGTGGAGGGCAGGAGG - Intronic
1166428175 19:42698148-42698170 ATGTGGAGCCGGAGGGCAGCCGG - Intronic
1166763944 19:45241515-45241537 CTTAGGAGATGGAGAAGAGCAGG - Intronic
1167236607 19:48319448-48319470 CTTTGGAGATGGGGAGCATACGG - Exonic
1167253550 19:48414362-48414384 CTTTGGCCAAGGTGGGCAGCTGG + Exonic
1167440927 19:49508386-49508408 CTTTGGAGAGGGAGGCAGGCGGG + Intronic
926007974 2:9387539-9387561 TGTTGGAGATTGAGTGCAGCGGG + Intronic
926063964 2:9822423-9822445 CTTCGGAGCTGGAAGGCGGCTGG + Intergenic
926105800 2:10150015-10150037 CATTGGAAATGGAGTGTAGCTGG + Intronic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
928166500 2:28976464-28976486 CTCGAGAGATGGAGGGCAGGGGG - Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
929368372 2:41190227-41190249 CTTTCCAGATGAATGGCAGCTGG + Intergenic
929671391 2:43878628-43878650 CTTTGGAGTTAGAGGGCAGAAGG + Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931994553 2:67827602-67827624 CGTCTTAGATGGAGGGCAGCAGG + Intergenic
933648478 2:84830837-84830859 CTGAGGAGAAAGAGGGCAGCTGG + Intronic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936692369 2:114905788-114905810 TTTGGGAGATTGAGGCCAGCAGG - Intronic
936906210 2:117537746-117537768 CTTTAGAGATGGAGGGTATTTGG + Intergenic
936997724 2:118432984-118433006 TTTTGGAGATGGATTGCAGGGGG - Intergenic
937097026 2:119242156-119242178 CTCAGGAGATGGCAGGCAGCGGG + Intronic
937364208 2:121249086-121249108 CTCTGGGGAGGGAGGCCAGCAGG + Exonic
937909980 2:127070802-127070824 CTTTGCAGACGGAGGGCACCCGG - Exonic
938055022 2:128208332-128208354 CTTGCCAGATGGTGGGCAGCCGG - Intergenic
938055088 2:128208646-128208668 CTTTGCAGACTGTGGGCAGCTGG - Intergenic
938055215 2:128209236-128209258 CTTTGCAGACTGTGGGCAGCTGG - Intergenic
938055270 2:128209473-128209495 CTTCCCAGATGGTGGGCAGCCGG - Intergenic
938083851 2:128385394-128385416 CTTTGGAAATGTAGGGCATGCGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938801777 2:134770529-134770551 CTTATGAGAGGGAGGGCAGAAGG - Intergenic
939275516 2:139992501-139992523 CTTTCGAGGTCGAGGGCAGCAGG + Intergenic
940207107 2:151215165-151215187 CCTTGGAGATGCAAAGCAGCTGG + Intergenic
940472601 2:154117426-154117448 CTTTGGAGATGCAGGGTAAAGGG - Intronic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
941008282 2:160269914-160269936 CTTTGAAGGTTCAGGGCAGCTGG - Intronic
941335804 2:164241837-164241859 CATTTGACATGGATGGCAGCAGG + Intergenic
941790576 2:169547978-169548000 TTTTTGAGACGGAGGGCATCAGG - Intronic
942155454 2:173122864-173122886 CTTTGGAGATGGTGGGATACAGG - Intronic
943720939 2:191202970-191202992 GTTTGGGGGTGGAGAGCAGCTGG + Intergenic
944229852 2:197381553-197381575 CTTCCCAGATGGTGGGCAGCCGG - Intergenic
945643117 2:212455592-212455614 CTTTGGTGATGGAAAGCAGCAGG - Intronic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946141921 2:217698665-217698687 TTCTGGAGAGGGAGGGAAGCGGG + Intronic
946180711 2:217947282-217947304 CTTGGGGGAGGGAGGGCAGGAGG + Intronic
946247874 2:218397693-218397715 CTGTAGAGACAGAGGGCAGCTGG + Intergenic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
947909661 2:233792701-233792723 GGTTGGAGGTGGAGGGCAGCAGG + Intronic
948945227 2:241215973-241215995 CTTTGCAATTGAAGGGCAGCAGG - Intronic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169421842 20:5466676-5466698 CTTTGCATCTGGAGGCCAGCTGG - Intergenic
1169716712 20:8627641-8627663 CTTTGGAGATGTAGTCCTGCTGG - Intronic
1170794195 20:19532305-19532327 GTCTGGACATGGAGGGCTGCGGG - Intronic
1170794418 20:19533869-19533891 CTTTTGAGATGTGGGACAGCTGG - Intronic
1170842971 20:19939009-19939031 ATTTGGAGATGGATGGGAGGAGG - Intronic
1171344370 20:24454693-24454715 CTTTGTAGATGGAGCACAGGTGG - Intergenic
1171400967 20:24872820-24872842 CTTTAGAGCTGGTGAGCAGCTGG + Intergenic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172528971 20:35617623-35617645 CTTTGGAGGGGGTGGGGAGCAGG + Intronic
1173646089 20:44634018-44634040 CCTTGGAGATGGCGTGCGGCAGG - Intronic
1175892530 20:62321894-62321916 CTCGGGAAATGGAAGGCAGCTGG + Intronic
1177860300 21:26444758-26444780 CTTTGAAGATGGAGGGGGCCAGG + Intergenic
1179787366 21:43737502-43737524 CTGCGGAGCTGGAGGTCAGCGGG + Intronic
1179893462 21:44349412-44349434 CCCTGGACATGGAGGCCAGCAGG + Intergenic
1181881339 22:25982688-25982710 CTTTGAAGATGGAGGCAAGGGGG - Intronic
1181910737 22:26236205-26236227 CTTTGGAGTTTGAGGGCAGATGG + Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183309334 22:37101015-37101037 CATTGGAGTTGGGGGGCAGAGGG + Intronic
1184459501 22:44628975-44628997 CTTCCCAGATGGTGGGCAGCTGG - Intergenic
1184607870 22:45584695-45584717 GTTTGGAAATGGAGGGCTGGTGG + Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950256446 3:11510523-11510545 CTTTGGAGATGGGGGGTTGAGGG - Intronic
951173584 3:19572606-19572628 GTTTGGGGCTGGAGAGCAGCAGG + Intergenic
951751804 3:26044242-26044264 CTTTGGTGATGGAGGCTGGCTGG + Intergenic
953666430 3:44929314-44929336 CTGTGCAGATGGAGTGCACCTGG + Exonic
954295052 3:49669831-49669853 CTTTGGAGAAGGGGGTGAGCAGG - Exonic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
954684820 3:52364773-52364795 CTGGGCAGCTGGAGGGCAGCTGG + Intronic
955621105 3:60864928-60864950 CTTTGTAGATAGAAGACAGCTGG - Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956594786 3:70955160-70955182 CTTTGGAAACGGAGTTCAGCTGG + Intronic
957611737 3:82475396-82475418 TTTTGGAGGTGGAGGTTAGCAGG + Intergenic
959234271 3:103698316-103698338 CTTTGCAGAGAGAGGGCAGATGG + Intergenic
961787856 3:129358249-129358271 CCTAGGAGATGGAAGGCAGCTGG + Intergenic
962908803 3:139829129-139829151 CTCAGGAGAAGGAGAGCAGCAGG + Intergenic
963576489 3:147066815-147066837 ATTTGGGGGTGGAGGGCAGGGGG + Intergenic
966255671 3:177914308-177914330 CTTCCCAGATGGTGGGCAGCTGG + Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967130889 3:186469738-186469760 ATTTAGCGATGGAGGGAAGCTGG - Intergenic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968347179 3:198019076-198019098 CTTTGTAGCTGCAGGGCAGAGGG + Intronic
968515055 4:1012247-1012269 GTTTGGAGAGGGGGGGCGGCGGG + Intronic
968688366 4:1976585-1976607 CTGCGGTGATGGCGGGCAGCTGG + Exonic
969599987 4:8170602-8170624 CTGCAGAGATGGTGGGCAGCTGG + Intergenic
970143019 4:13003215-13003237 CTTTGGAGATGGAGGAATGAAGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
971794464 4:31208999-31209021 CTTTGGAGATACAGGGCTGTGGG - Intergenic
972410070 4:38784673-38784695 GTTTGGAGATGGAGGAGAGATGG - Intergenic
973236800 4:47914393-47914415 CTTTGGAGATGGACCGAAGAGGG + Exonic
974025972 4:56733462-56733484 CTTTGAAGAGGGAGGGCATGGGG + Intergenic
975102720 4:70532755-70532777 CTTTGGAGATGGAAGAAAGTTGG + Intergenic
975520026 4:75290527-75290549 CTATGGAGATGTAAGGCAGAGGG - Intergenic
976190548 4:82482561-82482583 CTTTGGGGAGAGAGGGCATCTGG + Intergenic
976844828 4:89475613-89475635 ACTTTGAAATGGAGGGCAGCTGG + Intergenic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
978173267 4:105699850-105699872 CTTTTGAGATGGACGGTAACTGG + Exonic
978445471 4:108776149-108776171 CTCTGGAGATGGAGGGCTCAAGG + Intergenic
978633314 4:110773205-110773227 CTTTGAAGAGGGAGGGCAAAAGG - Intergenic
978924895 4:114231460-114231482 CTTTTGGGCTGGAGGGCTGCAGG + Intergenic
979234212 4:118381350-118381372 GTTTGGAGATAGAGGAAAGCAGG - Intergenic
981342484 4:143637853-143637875 CTTTGGACATGTGGGGCAGGTGG + Intronic
985348892 4:189036636-189036658 CTTGGGAGATGGAGGGCTTCTGG - Intergenic
985635155 5:1032225-1032247 GTTTGGGGAGGGAGGGCTGCGGG - Intronic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986283536 5:6343450-6343472 ATTTGGAGAGGGAGATCAGCCGG - Intergenic
986331563 5:6720091-6720113 CTTTGCAGATGGAATGCAGGTGG - Intronic
986649788 5:9951675-9951697 CTTTGCAGATAGAGAACAGCAGG + Intergenic
986740866 5:10704051-10704073 CTGTGGAGATGAAGGTCACCAGG - Intronic
988388598 5:30598447-30598469 CTTTTTACATGGATGGCAGCAGG + Intergenic
990008648 5:50969665-50969687 CTTCGGAGCTGGAGTGCCGCGGG - Intergenic
990073722 5:51816845-51816867 GCTTGGAGATGGTGGGTAGCGGG - Intergenic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
991288990 5:65012756-65012778 CTTCAGAGATGGAGAACAGCTGG - Intronic
993752747 5:91691307-91691329 GTTTGGAGATGGGGGGCAACTGG - Intergenic
994497043 5:100526035-100526057 CTTTGGAGATGTAGGGGAAAGGG + Intergenic
997444127 5:133928912-133928934 ATTTGGAGATAGGGAGCAGCTGG - Intergenic
997475328 5:134139255-134139277 CTTTGGAGAGGCAGGAGAGCTGG + Intronic
997505196 5:134411647-134411669 CCATGGAGAGGGAGAGCAGCTGG + Exonic
1000336782 5:160247170-160247192 CTTTGAACCTGGAGGGCAGAAGG + Intergenic
1001663050 5:173411025-173411047 CTCTGGAGCTGGAGGGCGGCTGG - Intergenic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1003857837 6:10293929-10293951 CTTTGTAGATGGAGGCCGGGCGG + Intergenic
1005283873 6:24303390-24303412 TTTTGGGAATGGAGGGGAGCAGG - Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1011068728 6:83359033-83359055 CTTCCCAGATGGTGGGCAGCTGG + Intronic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1015696603 6:135987386-135987408 CTTGGGAGATGAAGGGCTCCTGG + Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1018763764 6:166913077-166913099 AATTGAAGATGGAGGTCAGCAGG - Intronic
1019131915 6:169883163-169883185 CTTTGCAGATGGAGGAAGGCAGG + Intergenic
1019165464 6:170095197-170095219 CTTCGAACATGGAAGGCAGCAGG - Intergenic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019931519 7:4226392-4226414 CTTTGCAGAGGGTGGCCAGCGGG + Intronic
1020153180 7:5699713-5699735 CACTGGACATGAAGGGCAGCAGG + Intronic
1020263894 7:6547644-6547666 CTTTGGTGATGTAGGGAAGCTGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022598978 7:31738694-31738716 TCTTGGAGATGGTGGCCAGCTGG + Intergenic
1023203075 7:37719935-37719957 CTTTGGAAATGGGGAGCAGCAGG + Intronic
1024213730 7:47228814-47228836 GTTTGGAGGTGGAGGGAGGCGGG - Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026566874 7:71496554-71496576 CTTCGGGGAAGGAGGGCAGGTGG - Intronic
1026586859 7:71662556-71662578 CTTGGGAGGTGGTGGGCAGGGGG - Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1027260723 7:76462467-76462489 GCTTGGAGGAGGAGGGCAGCTGG - Intronic
1027312102 7:76960580-76960602 GCTTGGAGGAGGAGGGCAGCTGG - Intergenic
1027345770 7:77258024-77258046 TATAGGAGATGGAGGGAAGCAGG + Intronic
1028364213 7:90008371-90008393 AATTGGAGTTGGAGAGCAGCTGG - Intergenic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029263861 7:99323780-99323802 CTTGGGAAAGGGAGGACAGCAGG - Intergenic
1032549133 7:132768025-132768047 CTTTGGAGACCGAGGGGAGAGGG - Intergenic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1034308678 7:150068380-150068402 CGTTGCAGGTGGAGGTCAGCTGG - Intergenic
1034798173 7:154032264-154032286 CGTTGCAGGTGGAGGTCAGCTGG + Intronic
1035444689 7:158932282-158932304 CTTGGGGGATGGAGTGCAGTGGG + Intronic
1035918170 8:3648051-3648073 GGTTGGAGATGGAGGACAGATGG + Intronic
1037541557 8:19876735-19876757 CTTTGGAAATGGAGGGAGACAGG - Intergenic
1037588541 8:20294683-20294705 CTTTGGGGGTGGCGGGGAGCAGG + Intronic
1037883253 8:22583063-22583085 CTCTAGAGATGTAGGGCAACAGG - Intronic
1038024237 8:23574664-23574686 CTTTGGAGATAAAGGCCAGATGG - Exonic
1039135373 8:34316762-34316784 CTTTGAAGATGGAGGGAATGTGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1040517788 8:48148538-48148560 CTTCCCAGATGGTGGGCAGCTGG - Intergenic
1040535841 8:48309143-48309165 AATTGGTGAAGGAGGGCAGCTGG + Intergenic
1041919488 8:63166513-63166535 CTTCTTACATGGAGGGCAGCAGG - Intergenic
1042302461 8:67299758-67299780 CTTAGGAGTTCGAGGCCAGCTGG + Intronic
1042362812 8:67901971-67901993 TTTTGGAGGTGGAGGGCAGGGGG - Intergenic
1042874097 8:73424947-73424969 CTTTGGACCTGGAGTGCTGCAGG + Intronic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1043676576 8:82963464-82963486 AATTGGGGATGCAGGGCAGCAGG + Intergenic
1044445118 8:92266248-92266270 CGTTGGACATGGAGGACAGTGGG + Intergenic
1044502110 8:92969927-92969949 ATTTGGAGAGGGAGAGCATCAGG - Intronic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1045343208 8:101272531-101272553 GTTTGGAGATGGGAGGCAGGAGG + Intergenic
1046518167 8:115289747-115289769 CCTGAGAGATGGAGGGCAGAAGG + Intergenic
1049015741 8:139918805-139918827 GTTTGGAGAGGGAGGGCAGCTGG - Intronic
1049086232 8:140480569-140480591 CTTTTGCCATGGAAGGCAGCAGG + Intergenic
1049202401 8:141346734-141346756 CCTTGCAGATGGAGTGCAGATGG - Intergenic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1052659414 9:31408952-31408974 TTTTGAAGAAGGAAGGCAGCAGG - Intergenic
1053383186 9:37666003-37666025 CTTTGGAGATGTATGGCAAAAGG - Intronic
1055237839 9:74145618-74145640 GATTGGAGTTGGAGGGCTGCTGG - Intergenic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055480644 9:76706084-76706106 CTTTCAAGAGGGTGGGCAGCTGG - Exonic
1056764390 9:89435983-89436005 ATTTGGGGGTGGGGGGCAGCGGG - Intronic
1057376475 9:94528594-94528616 CTTTGTAGCTGCAGGGCAGAGGG + Intergenic
1058753934 9:108066650-108066672 CTTTGGAAGTCCAGGGCAGCTGG - Intergenic
1060670775 9:125467564-125467586 CCTGTGAGATGGAGGGAAGCTGG - Intronic
1060733237 9:126050786-126050808 GTGTGGAGATGGAGGACGGCGGG + Intergenic
1062016938 9:134295780-134295802 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016946 9:134295807-134295829 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016954 9:134295834-134295856 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062021127 9:134319890-134319912 CCCTGGAGCTGGAGGGCTGCAGG + Intronic
1062147383 9:134997182-134997204 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062147392 9:134997219-134997241 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1186447340 X:9642935-9642957 CTTTTGAGTTGGAGGCCACCTGG + Intronic
1186932067 X:14404843-14404865 TTTTGGAGAGAGAGGGCAGTGGG + Intergenic
1187470087 X:19561956-19561978 GGTTGGAGTTGGAGGTCAGCAGG - Intronic
1187590046 X:20707580-20707602 CATTGTACATGGATGGCAGCAGG - Intergenic
1188029610 X:25249656-25249678 TTTTGGAGTTAGAGGGTAGCGGG + Intergenic
1189184198 X:39038113-39038135 GTTTGGAGGTGGATGGAAGCAGG - Intergenic
1190314301 X:49139924-49139946 CTTTGGAGATAGGGGACAGTAGG + Intergenic
1190595808 X:52052011-52052033 CATGGGAAATGGAGGGCAGCTGG + Exonic
1190613016 X:52202062-52202084 CATGGGAAATGGAGGGCAGCTGG - Exonic
1192340527 X:70259812-70259834 CTTGGGAAGTGGTGGGCAGCAGG + Intergenic
1192455160 X:71270040-71270062 CTTTCCAGATGGGTGGCAGCTGG + Intergenic
1192455182 X:71270130-71270152 CTTCCCAGATGGTGGGCAGCCGG + Intergenic
1192455199 X:71270209-71270231 CTTCCCAGATGGCGGGCAGCTGG + Intergenic
1192788049 X:74354063-74354085 CTGTGGCCATGGAGGCCAGCTGG - Intergenic
1194351720 X:92829693-92829715 CCTTGGAAATTGAGGGCAACTGG - Intergenic
1197095935 X:122595200-122595222 TTTTGGAGGTGGAGGGTAGGAGG - Intergenic
1200660035 Y:5946384-5946406 CCTTGGAAATTGAGGGCAACTGG - Intergenic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic
1201687438 Y:16722518-16722540 CTTTGTAGATGAAAGGCATCTGG + Intergenic