ID: 1144675577

View in Genome Browser
Species Human (GRCh38)
Location 17:17159315-17159337
Sequence GCTCGCGCCCCTCCTGCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144675577_1144675582 13 Left 1144675577 17:17159315-17159337 CCGATGGCAGGAGGGGCGCGAGC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1144675582 17:17159351-17159373 TGCATTACGCAGCCCTGGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 115
1144675577_1144675581 8 Left 1144675577 17:17159315-17159337 CCGATGGCAGGAGGGGCGCGAGC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1144675581 17:17159346-17159368 GCTTTTGCATTACGCAGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 100
1144675577_1144675583 18 Left 1144675577 17:17159315-17159337 CCGATGGCAGGAGGGGCGCGAGC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1144675583 17:17159356-17159378 TACGCAGCCCTGGCTTGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144675577 Original CRISPR GCTCGCGCCCCTCCTGCCAT CGG (reversed) Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900538694 1:3191961-3191983 GCCATTGCCCCTCCTGCCATCGG - Intronic
902608405 1:17582230-17582252 CATCCCGCCCCTGCTGCCATGGG + Intronic
906688873 1:47779699-47779721 CCATGGGCCCCTCCTGCCATGGG + Intronic
912764385 1:112395954-112395976 GCTCGCGCCCCTCCCGGCTCGGG - Intergenic
913090200 1:115471562-115471584 GCCAGTGCCTCTCCTGCCATAGG - Intergenic
914226201 1:145721256-145721278 GCCCGCGTCACTCCAGCCATGGG - Intronic
917926754 1:179795518-179795540 GCTCACTCACCTTCTGCCATCGG + Intronic
922757198 1:228103002-228103024 GGTCGCGGCCCTTCTGCCAGCGG + Exonic
923686100 1:236154833-236154855 GCCCGGGACCCTCCTGCCATAGG + Intronic
1063663506 10:8049014-8049036 GCTCGCGGCTCTCCTGGCCTGGG + Intergenic
1063785733 10:9380713-9380735 GCTTCCTCCCCTCCTGCCCTTGG + Intergenic
1064613073 10:17124147-17124169 GCTGCTGCCCCTCCTCCCATGGG + Intronic
1067346168 10:45440643-45440665 GCTACCGCCCCACCTGCTATGGG + Intronic
1069899277 10:71697687-71697709 GCTCCCGCCCTGCCTGCCTTTGG + Intronic
1070920566 10:80183036-80183058 CCTGGTGCCCCTCCTGGCATGGG + Intronic
1073105950 10:101032173-101032195 GCTCCAGCCCCTCCTCCCTTTGG + Intronic
1075945273 10:126427645-126427667 CCTCCCGCCCCTCCTGCCGTTGG + Intronic
1077201618 11:1310159-1310181 GCTCGAGCCCGCCCTGCCCTCGG + Intergenic
1080642643 11:34166674-34166696 GCTGGAGCCCCTGCTGGCATGGG + Intronic
1081251246 11:40837394-40837416 GCTGGAGCCCCTTCTTCCATAGG + Intronic
1083777903 11:64903135-64903157 GTTAGCGCCCCTCCTGCAAAGGG - Intronic
1083901379 11:65645137-65645159 GCTCCCACCCCTCCTGCCCCTGG - Intronic
1085085102 11:73661513-73661535 GCCGGCGCCCCTCTGGCCATGGG + Exonic
1085656049 11:78316064-78316086 CCTCCCGCTCCTCCTGCCCTTGG + Intronic
1089384382 11:118058407-118058429 GCCTGCGCCCCTCCCGCCTTGGG - Intergenic
1092538545 12:9406198-9406220 GATGCCTCCCCTCCTGCCATGGG - Intergenic
1094057742 12:26283936-26283958 GCTTCCTCCCCTCCTGCCCTTGG + Intronic
1097187276 12:57202591-57202613 TCTCGCGGCCCTCCTGCCACAGG + Intronic
1100398287 12:94203994-94204016 GCTCTTCCACCTCCTGCCATGGG + Intronic
1103433103 12:120904349-120904371 GCCCCCGCCCCTCCTCCCCTCGG - Exonic
1105583354 13:21721402-21721424 CCTAGCGCCCCTCCAGCCTTTGG - Intergenic
1110322811 13:74179137-74179159 GCTCAGGCTCCTCCTGCCAAAGG + Intergenic
1114668799 14:24398375-24398397 TCTCCCGCCCCTCCAGCCCTGGG + Intergenic
1123739937 15:23226431-23226453 GCGCGCACCCCTCCCGCCAGCGG + Intergenic
1124291161 15:28455399-28455421 GCGCGCACCCCTCCCGCCAGCGG + Intergenic
1124645256 15:31433860-31433882 GCTCTTGCCCCTCCTGCAAAAGG + Intronic
1125292144 15:38161786-38161808 GCTCCCTCCATTCCTGCCATGGG + Intergenic
1128944441 15:71811406-71811428 GCACGCTCCCCTCCTTCCCTCGG - Intronic
1129150434 15:73684658-73684680 GCGGGCGCCCCTCCTGCCCTGGG + Intronic
1133054350 16:3138138-3138160 GCTGGGGACCCTCCTGCCAAAGG - Intronic
1136707608 16:32202266-32202288 GCGCGCACCCCTCCTGCCAGCGG - Intergenic
1136760302 16:32727144-32727166 GCGCGCACCCCTCCTGCCAGCGG + Intergenic
1136807802 16:33143242-33143264 GCGCGCACCCCTCCTGCCAGCGG - Intergenic
1203062456 16_KI270728v1_random:987466-987488 GCGCGCACCCCTCCTGCCAGCGG + Intergenic
1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG + Exonic
1142978364 17:3658202-3658224 GCTCTCACCTCTCCTGCCACCGG - Intronic
1142979115 17:3661406-3661428 ACCCCCACCCCTCCTGCCATAGG - Exonic
1144675577 17:17159315-17159337 GCTCGCGCCCCTCCTGCCATCGG - Intronic
1146843452 17:36169551-36169573 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146864860 17:36330886-36330908 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1146871667 17:36381400-36381422 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146879026 17:36432482-36432504 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146882967 17:36453628-36453650 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1147067719 17:37931480-37931502 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147074553 17:37982024-37982046 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147079250 17:38011035-38011057 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147086076 17:38061563-38061585 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147095189 17:38134977-38134999 GCCCGGGCTCCTGCTGCCATCGG + Intergenic
1147102021 17:38185528-38185550 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1149846612 17:60012038-60012060 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1151732097 17:75917689-75917711 CCTCCTGCCCCTCCTGCCACGGG - Intronic
1152408608 17:80111030-80111052 GCTCGCCCCCCACCTACCCTGGG + Intergenic
1152748677 17:82052571-82052593 GCTCCCTCCCCTCCTGCGCTTGG - Intronic
1162208685 19:9074950-9074972 GCTTCCGCCCTTCCTGCCATAGG + Intergenic
1163138678 19:15332034-15332056 GCTCGCGGCTGTCCTGCCTTTGG - Intronic
1164051520 19:21588229-21588251 GCACGTGCCCTGCCTGCCATGGG + Intergenic
1166338319 19:42122248-42122270 GCTCCCTGCCCTCCTACCATAGG + Intronic
925599330 2:5591634-5591656 CATCGCGCCCCTCCTGACAGAGG + Intergenic
925644100 2:6018398-6018420 GCTTTTGCCCCTCCTGCCCTTGG + Intergenic
927514025 2:23661533-23661555 GCCCGAACCCCTCCTGGCATGGG + Intronic
929045247 2:37782912-37782934 GCTCGCCCCGCTCCTGGGATGGG - Intergenic
929390834 2:41466646-41466668 GCTGGCTCCCCTCCTGTCAGAGG - Intergenic
932880108 2:75493310-75493332 GCTCGCGCTCCTCCAGCCGCTGG + Exonic
942085284 2:172437825-172437847 CCTCCCTCTCCTCCTGCCATGGG - Intronic
948709233 2:239815195-239815217 GCTGGCCTCCCTCCTGGCATGGG + Intergenic
948858113 2:240740067-240740089 GCTCGCGCACTTCCTTCCAGCGG + Exonic
948884018 2:240874123-240874145 GCTCCCGCCCCTCCCGCCTCGGG - Intronic
948895617 2:240925561-240925583 GCTCTGCCCCCACCTGCCATGGG - Intronic
1168901806 20:1371147-1371169 ATTTGCTCCCCTCCTGCCATAGG - Intronic
1169136980 20:3203464-3203486 GCTGCCGCTCCTCCTGCCATGGG - Intronic
1173288905 20:41697143-41697165 GCTCCCTCACCTACTGCCATTGG + Intergenic
1174173624 20:48631831-48631853 GCTCTCACCCCTCCTCCCCTGGG + Intronic
1174272186 20:49377716-49377738 TCTCTGGCCACTCCTGCCATCGG + Intronic
1174366838 20:50061603-50061625 TTTCACGCCCCTCCTGCCCTGGG - Intergenic
1174997081 20:55582419-55582441 GTTCGCCCCCCTCCTGACATAGG + Intergenic
1176102449 20:63370624-63370646 GCTCAGGCCCCACCTGCCTTGGG + Intronic
1176197607 20:63844603-63844625 GCTCTGGCCCCTCCTCCCTTGGG + Intergenic
1176954018 21:15079468-15079490 GCCCGTGCTCCTCCTGTCATGGG - Intergenic
1178421714 21:32448505-32448527 GCTAGCTCCTCTCCTCCCATAGG + Intronic
1178699287 21:34819762-34819784 CCTCCCGCCCCTCCTGGCCTCGG + Intronic
1180993296 22:19951684-19951706 GCTCTCTCCCCTCCTGTCACTGG - Intronic
1184340653 22:43884136-43884158 CCAGCCGCCCCTCCTGCCATGGG + Intronic
953771989 3:45784852-45784874 GCCCTCCCACCTCCTGCCATGGG - Intronic
960242719 3:115364668-115364690 GCTCCCTCACCTCCTGGCATAGG - Intergenic
961832013 3:129627691-129627713 TCTCACGCCCCTCCAGCCACTGG - Intergenic
968126412 3:196163728-196163750 GCTCACCCTCCTCCTGCCCTGGG - Intergenic
968729775 4:2264234-2264256 GCACGCCCCCTTCCTGCCATGGG + Intergenic
968939921 4:3632434-3632456 GCCCACTGCCCTCCTGCCATGGG + Intergenic
969413456 4:7043895-7043917 GCCCGCGCCTCTCCTGTAATCGG + Intronic
969516701 4:7652174-7652196 GCTGGCTTCCCTCCTGCCAGAGG + Intronic
969787896 4:9473601-9473623 GCACCCGGCCCCCCTGCCATGGG - Intergenic
969788102 4:9474194-9474216 GGTCGCCACCCCCCTGCCATGGG - Intergenic
977354983 4:95934078-95934100 GCCCTCTGCCCTCCTGCCATAGG - Intergenic
983786657 4:171740466-171740488 GCTCACCCCATTCCTGCCATGGG - Intergenic
987577755 5:19752634-19752656 TCTAGGGCCCCACCTGCCATGGG + Intronic
988736452 5:34026641-34026663 GCTCCCTCCCCTGCTGCCAGGGG - Intronic
996909156 5:128635614-128635636 CCTCTCGCTCCTCCTGCCCTTGG - Intronic
1000242416 5:159420784-159420806 GCTCTCTGCCCTCCTGCCATAGG - Intergenic
1002931858 6:1640434-1640456 GCTCGCTCTCCTCCTGCCTCAGG + Intronic
1005016035 6:21376204-21376226 GCCCGCGGCCCTCCTGCTGTGGG - Intergenic
1006421253 6:33935533-33935555 GCTCCCGCCCCTGCAGCCACTGG - Intergenic
1006434629 6:34019841-34019863 CCAGGCGTCCCTCCTGCCATGGG + Intronic
1019573684 7:1725752-1725774 TCTCTGGCCCCTCCAGCCATGGG - Intronic
1019646042 7:2129451-2129473 GGCAGCGCCCCTCCTGCCGTGGG + Intronic
1022881712 7:34594896-34594918 GTTTGGGCCCCTCCTGCCAAGGG + Intergenic
1024323137 7:48089168-48089190 GCTCGGGCCCCGCCTGCCCTGGG - Intronic
1034593208 7:152162268-152162290 GCTGGGGCCCCTGCTGCCAAAGG - Exonic
1039414034 8:37378575-37378597 GCTTCCTCCCCTCCTGCCCTTGG - Intergenic
1047745245 8:127840071-127840093 GCTCACTCCTCTCCAGCCATTGG - Intergenic
1049268417 8:141681665-141681687 ACTCCAGCCCCACCTGCCATGGG + Intergenic
1049424376 8:142531583-142531605 GCACCCGCCCCTCCTGCTCTTGG - Intronic
1049532134 8:143160036-143160058 GCACGCGCCCCTCCCCCCAGTGG - Intronic
1049661950 8:143823501-143823523 GCTGGCGCCCAGCCGGCCATTGG - Intronic
1054450830 9:65402841-65402863 GCCCACTGCCCTCCTGCCATGGG - Intergenic
1057803786 9:98206488-98206510 TCAAGTGCCCCTCCTGCCATAGG + Intronic
1057950571 9:99366279-99366301 GCTGGCGGCCCTCCTGACCTGGG + Intergenic
1062423262 9:136494174-136494196 GCACGAGCCCCACCTCCCATAGG + Intergenic
1062572473 9:137191952-137191974 GCTAGGGTGCCTCCTGCCATCGG - Exonic
1189476851 X:41362740-41362762 GCTCCTGCCCCACCTCCCATAGG - Intronic
1192218083 X:69177801-69177823 GCTGGCCTCCCTCCTCCCATAGG + Intergenic
1196176473 X:112644219-112644241 TCTCTGGCCCCTCCTTCCATGGG + Intronic
1202372117 Y:24205672-24205694 CTTCGCGCCCCACCTGCCAGAGG - Intergenic
1202498668 Y:25464444-25464466 CTTCGCGCCCCACCTGCCAGAGG + Intergenic
1202601641 Y:26600045-26600067 GGTCATGCCCCTCTTGCCATGGG + Intergenic