ID: 1144677225

View in Genome Browser
Species Human (GRCh38)
Location 17:17169404-17169426
Sequence TAGGTTAGCCAACCAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144677222_1144677225 -6 Left 1144677222 17:17169387-17169409 CCACACCGAGGCTGCTTTAGGTT 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1144677220_1144677225 -3 Left 1144677220 17:17169384-17169406 CCTCCACACCGAGGCTGCTTTAG 0: 1
1: 0
2: 2
3: 30
4: 345
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1144677218_1144677225 -1 Left 1144677218 17:17169382-17169404 CCCCTCCACACCGAGGCTGCTTT 0: 1
1: 0
2: 2
3: 17
4: 225
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1144677219_1144677225 -2 Left 1144677219 17:17169383-17169405 CCCTCCACACCGAGGCTGCTTTA 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1144677213_1144677225 27 Left 1144677213 17:17169354-17169376 CCTGCTTCCTGTCTGCATCCATA 0: 1
1: 0
2: 2
3: 33
4: 299
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1144677212_1144677225 28 Left 1144677212 17:17169353-17169375 CCCTGCTTCCTGTCTGCATCCAT 0: 1
1: 0
2: 3
3: 64
4: 623
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1144677215_1144677225 20 Left 1144677215 17:17169361-17169383 CCTGTCTGCATCCATAAGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1144677216_1144677225 9 Left 1144677216 17:17169372-17169394 CCATAAGAGGCCCCTCCACACCG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144677225 Original CRISPR TAGGTTAGCCAACCAGGTGC AGG Intronic
902950986 1:19882675-19882697 CAGCTTCGCCAACCAGCTGCAGG + Exonic
905413424 1:37788179-37788201 TAGGTCAGCCTTCCAGGAGCTGG - Intergenic
909666789 1:78143132-78143154 TAGGTCAGCCTCCCAAGTGCAGG - Intergenic
910332133 1:86086323-86086345 TAGGTCAGCCAACTTGGAGCTGG - Intronic
1065527912 10:26641129-26641151 TAGGATAGCAAACTAGGGGCAGG - Intergenic
1067432949 10:46255904-46255926 TAGGTTGGCCAGGCAGTTGCTGG - Intergenic
1083386262 11:62312546-62312568 CAGGTTAGCCCACCAGGTCCTGG - Intergenic
1089896621 11:121936483-121936505 CAGGTTAGCCAACCATTAGCAGG + Intergenic
1097015282 12:55981717-55981739 TGGGTTAGCCCACTAGATGCAGG - Intronic
1118812588 14:69286054-69286076 AAGGCAAGCCAGCCAGGTGCTGG - Intronic
1122913773 14:104846541-104846563 TAGGGAAGCCAGCCAGGTTCAGG + Intergenic
1124443220 15:29705140-29705162 TAGGTTCTCCAATCAGGTGAAGG + Intronic
1131551014 15:93357132-93357154 TTACTTAGCCAACCAGGTGAAGG + Intergenic
1139443279 16:66979716-66979738 TAGGGTGGCCTTCCAGGTGCTGG + Intergenic
1141544073 16:84751637-84751659 TTGGTTATCTAACCAGGTGGAGG - Intronic
1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG + Intronic
1149000811 17:51755748-51755770 TAGATTAGAAAACCAGGTACAGG + Intronic
1163905325 19:20147361-20147383 TTGGTGAGCCAATCAGATGCTGG - Intergenic
1164399967 19:27895691-27895713 TAGGTTAGTGACCCAGGAGCTGG - Intergenic
926459123 2:13106546-13106568 AAGGTTAGGCAAGCAGTTGCCGG - Intergenic
926737185 2:16082573-16082595 AAGGTGAGCCATCCAAGTGCAGG - Intergenic
946295982 2:218783780-218783802 TGGGGTAGCCAACCATCTGCTGG + Intronic
946464652 2:219901294-219901316 CAGGTCAGCCACCCAGGTGATGG - Intergenic
947689752 2:232123763-232123785 TAGGTTTGACCACCAGTTGCTGG + Intronic
1170530008 20:17281710-17281732 TATGTTAGCCAAGCAATTGCAGG + Intronic
1174303653 20:49600212-49600234 TAGGTGAGGCCAGCAGGTGCCGG + Intergenic
1177434621 21:21034954-21034976 TAGGTTAGGAAACCAGGAGGAGG + Intronic
1178473643 21:32917630-32917652 CAGGTTAGCCAAGGAGCTGCAGG - Intergenic
1179375724 21:40848354-40848376 TAGGTCAACCAGCCAGATGCAGG - Intergenic
950703353 3:14765665-14765687 TAGGTGAGCAGAGCAGGTGCAGG + Intronic
957217729 3:77343526-77343548 TAGGTTGCCCAACCATATGCAGG + Intronic
973980142 4:56301677-56301699 TCGGTGAGCCCACCATGTGCAGG - Intronic
975106710 4:70575455-70575477 TAAGTAAGCCAGCCAGGTGTGGG + Intergenic
979503323 4:121465033-121465055 TAGGTTAATCAACTTGGTGCAGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
993581609 5:89668826-89668848 TAGGTCAGTCATCGAGGTGCTGG + Intergenic
994083019 5:95729345-95729367 TAGGTGAGCCAAGCCTGTGCTGG - Intronic
994121880 5:96123609-96123631 TAGATTAGCAAAACAGTTGCTGG + Intergenic
1001949348 5:175805557-175805579 GAGGCTGGCCAACCAGGTGAGGG - Intronic
1003491156 6:6623151-6623173 TTGGTTAGAGAACCAGTTGCTGG + Intronic
1005668244 6:28079431-28079453 GAGGTTAGACAAACAGTTGCTGG - Intergenic
1006637321 6:35469744-35469766 TAAGTTGACCAGCCAGGTGCTGG + Intronic
1012257191 6:97047734-97047756 GAGGTCAGCCACCCAGGAGCAGG + Intronic
1016495302 6:144654850-144654872 TGAATTAGCCAACCAGGTGCAGG - Intronic
1024101152 7:46033921-46033943 GAGGTAAGTCAACCAGGGGCTGG + Intergenic
1025636553 7:63325020-63325042 GTGGTCAGCCAATCAGGTGCTGG + Intergenic
1025646143 7:63423082-63423104 GTGGTCAGCCAATCAGGTGCTGG - Intergenic
1027915303 7:84310314-84310336 TATGTGAGCCAAGCAGGTACCGG + Intronic
1029440752 7:100585575-100585597 TAAATAAGCCAACCAGGTGAGGG + Intronic
1031132892 7:117853516-117853538 TAGCTTAGCCACCCATGAGCTGG + Intronic
1032696323 7:134339702-134339724 AAGGTTACACAAGCAGGTGCCGG + Intergenic
1035703496 8:1655734-1655756 TGGGTTAGCCAACCTCGTGGAGG - Intronic
1039877998 8:41603776-41603798 TAAGGAAGCCAACCAGGTGTAGG + Intronic
1040913169 8:52541860-52541882 TATGTTCCCCAACCAGGTGGGGG - Intronic
1041641315 8:60205605-60205627 TATGTAAGTCATCCAGGTGCTGG - Intronic
1044548898 8:93489891-93489913 TACGTTAGCCAACTGGCTGCTGG + Intergenic
1048213792 8:132478813-132478835 TAGGTTCGGCCACCAGGTGGGGG - Intronic
1054781507 9:69170135-69170157 TAGGTTGGTCAGCTAGGTGCAGG - Intronic
1057915907 9:99054977-99054999 TCTGTTAGCCAACCCAGTGCAGG + Intronic
1185741379 X:2535494-2535516 TATGCTAGCAAAACAGGTGCTGG + Intergenic
1186721186 X:12305901-12305923 TAGAGTAGCCAACCCTGTGCAGG - Intronic
1188765983 X:34091322-34091344 AAGGTTAGACAAACAGGTGATGG + Intergenic
1192548135 X:72030235-72030257 AAGGTGAGCCAAACAGCTGCTGG - Intergenic
1192619439 X:72662574-72662596 CTGGTTTGCCAACCAGGGGCAGG - Intronic
1201355359 Y:13091850-13091872 CAAGTTAGCCAACCAGGTTCAGG + Intergenic
1202260862 Y:22968886-22968908 TAGGCTAGGCAAACAGGTGATGG + Intergenic
1202413850 Y:24602627-24602649 TAGGCTAGGCAAACAGGTGATGG + Intergenic
1202456934 Y:25067459-25067481 TAGGCTAGGCAAACAGGTGATGG - Intergenic