ID: 1144677884

View in Genome Browser
Species Human (GRCh38)
Location 17:17173469-17173491
Sequence CTGGTTCACCTGCAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144677874_1144677884 -2 Left 1144677874 17:17173448-17173470 CCACCTGGAAGCCCCTCATCCCT 0: 1
1: 0
2: 3
3: 48
4: 358
Right 1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG 0: 1
1: 0
2: 4
3: 34
4: 262
1144677873_1144677884 -1 Left 1144677873 17:17173447-17173469 CCCACCTGGAAGCCCCTCATCCC 0: 1
1: 0
2: 1
3: 31
4: 302
Right 1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG 0: 1
1: 0
2: 4
3: 34
4: 262
1144677871_1144677884 19 Left 1144677871 17:17173427-17173449 CCTTGGTCAGAGCAGGGTGGCCC 0: 1
1: 0
2: 4
3: 21
4: 249
Right 1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG 0: 1
1: 0
2: 4
3: 34
4: 262
1144677876_1144677884 -5 Left 1144677876 17:17173451-17173473 CCTGGAAGCCCCTCATCCCTGGT 0: 1
1: 0
2: 4
3: 37
4: 305
Right 1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG 0: 1
1: 0
2: 4
3: 34
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144677884 Original CRISPR CTGGTTCACCTGCAGGAGGA CGG Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900473981 1:2867894-2867916 GTTGGTCACCTGCAGGGGGAAGG + Intergenic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
902359987 1:15937165-15937187 GGGGCTCACCTTCAGGAGGAGGG - Exonic
902782700 1:18714994-18715016 TGGGGTCCCCTGCAGGAGGAAGG + Intronic
903703408 1:25267520-25267542 CGGGTTCAGCTCCAGGAGGCGGG - Intronic
903712675 1:25337849-25337871 CGGGTTCAGCTCCAGGAGGCGGG - Intronic
904004591 1:27357106-27357128 CTGCTTCACCTGCAGGGGGAGGG + Exonic
905106437 1:35565971-35565993 CTGGCTCCCCTGCAGGAGGGAGG + Exonic
905523203 1:38615945-38615967 CTGCTTCACCTAAAGGAGGATGG + Intergenic
906615153 1:47228847-47228869 CTGGAGCTCCCGCAGGAGGAAGG - Intronic
907273232 1:53302922-53302944 CTGGATCACCTGCTGTAGTACGG - Intronic
907309098 1:53529240-53529262 CTGGGTCACCTGCAGGAGCCTGG + Intronic
908662207 1:66448985-66449007 TTGGTGCACAAGCAGGAGGAGGG + Intergenic
911099030 1:94079334-94079356 CTGATTCACCTGCAGCACGAAGG - Exonic
912852229 1:113136997-113137019 CTGGTGCACGTGCAGGAGTGGGG - Intergenic
913371849 1:118108192-118108214 CTGGTTCAACTTCAGTATGAAGG - Intronic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
915632550 1:157163491-157163513 CAGGATCACCTGCAGGGGGCAGG - Intergenic
915970342 1:160350517-160350539 CTGGTACACCTGCTGAAAGACGG + Intronic
916830013 1:168481271-168481293 CTGGCTCACCTGCAGAAGGGTGG + Intergenic
919781774 1:201225845-201225867 CACGTTCTCCTGCAGGTGGATGG - Exonic
919865801 1:201782162-201782184 CAGGTTTGCCTGCAAGAGGACGG - Exonic
919989862 1:202702262-202702284 CTGCTGCAGCTGCAGGAGGCAGG - Intronic
920560447 1:206934738-206934760 TTGGTTCTCCTGGAGGAGGGAGG + Exonic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
922322880 1:224503467-224503489 GTGGCTCCCCTGCAGGAGGAGGG + Intronic
924597607 1:245461128-245461150 CTGCTTCACCTCCAGAGGGAAGG - Intronic
1063125498 10:3133297-3133319 CTGGGTCACATGCAGCAGGTAGG + Exonic
1063384584 10:5608058-5608080 CTTGTTCACATGCAGGAGGAGGG - Intergenic
1066043672 10:31578385-31578407 TTGGCTCACCTGCTGGAGGCTGG - Intergenic
1067427214 10:46219482-46219504 CTGGTTCCCCTGGATGAGGACGG + Intergenic
1067582643 10:47455365-47455387 CTGGTTTCCCTGGATGAGGACGG + Intergenic
1069618398 10:69820800-69820822 CCGCTCCACCTGCTGGAGGAAGG - Intronic
1069833854 10:71296564-71296586 GGGGATCTCCTGCAGGAGGAGGG - Exonic
1069837799 10:71319917-71319939 CTGGGTCACCTGCGGGAGCCCGG - Intronic
1069872552 10:71542097-71542119 CTTGGTCCCATGCAGGAGGAAGG + Intronic
1074186600 10:111103680-111103702 CCCTTTCACCTGCAGGAGAAGGG - Intergenic
1075314152 10:121438694-121438716 AGGGTTCACCTGCAGCAGAAAGG + Intergenic
1076056127 10:127374675-127374697 CTGGATTACCTGCAAGGGGAGGG + Intronic
1076514460 10:131036040-131036062 CTGGTTCCCCAGCAAGAGAAAGG - Intergenic
1076858552 10:133129020-133129042 CACGTGCACCTGCAGGAGGAGGG + Exonic
1077343168 11:2035040-2035062 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1079882444 11:25944307-25944329 CTGGTGCAGCTGCAGCTGGAGGG - Intergenic
1081386947 11:42483023-42483045 CTGATTCACCTGCCCCAGGAGGG - Intergenic
1081620282 11:44615258-44615280 CTGCTTCAGCTGCAGGGGGGAGG - Exonic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1082822093 11:57551038-57551060 CTGGCTCACCTGCAGGGGTGTGG + Intergenic
1083349010 11:62013825-62013847 CTGGTTCATCTCCAGGAGCAGGG - Intergenic
1083431228 11:62614491-62614513 CTGACTCACCTGCAGTAGGAAGG - Exonic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084025102 11:66443144-66443166 CTGTTTCCCTTGCAGGAGAAGGG + Intronic
1084173188 11:67410301-67410323 CTTTTGCACCTGCAGGAGGAGGG + Intronic
1085179524 11:74521791-74521813 CTGTTTCATCTGCAGAATGAGGG + Intronic
1085228074 11:74940784-74940806 CTGCTTCGCGTGCCGGAGGAAGG - Exonic
1085439379 11:76544485-76544507 CTGGTCTGCCTGCAGGTGGATGG - Exonic
1085517611 11:77120699-77120721 CTCCTCCACCTGCAGGAGGCGGG - Exonic
1087988820 11:104721367-104721389 TTGTTACAACTGCAGGAGGAGGG - Intergenic
1088921677 11:114263881-114263903 CTGGTTCACAGGCAGCAGCATGG + Intronic
1089324054 11:117645054-117645076 CGGCTTCACCTGCAGGAACACGG + Intronic
1202826154 11_KI270721v1_random:90229-90251 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1096841155 12:54379784-54379806 CTGGTTCTCCGGCAGGTGGCGGG - Intronic
1097775780 12:63643636-63643658 TTGGTTCAGCAGCAGAAGGATGG + Intronic
1099612274 12:84889035-84889057 CTGTTTCATATCCAGGAGGAAGG + Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101807139 12:108073854-108073876 CTGGTTTACCTTGGGGAGGAAGG + Intergenic
1102153464 12:110704915-110704937 CATGTTCACCTCCAGGAGGCAGG + Intronic
1102350813 12:112190793-112190815 CTCCACCACCTGCAGGAGGACGG + Exonic
1103207763 12:119143715-119143737 ATGGTCTACCTGCAGGAGAATGG + Intronic
1104202683 12:126606843-126606865 TTGGTTCACCTGAAAGAGAATGG - Intergenic
1104727051 12:131084635-131084657 CGGGACCACCTGCATGAGGATGG - Exonic
1104800739 12:131553981-131554003 TAGGTTCAGCTGCAGGTGGACGG - Intergenic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1105874247 13:24539564-24539586 CTGGGGCTGCTGCAGGAGGAGGG - Intergenic
1108466805 13:50724974-50724996 CTGGAACACCTGCGGTAGGAAGG - Intronic
1112760991 13:102692946-102692968 CTGGTTTAGAGGCAGGAGGAAGG + Intronic
1113481434 13:110624916-110624938 CTGGTCACCCTCCAGGAGGAAGG - Intronic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1115819957 14:37203526-37203548 CTAGTTCACCCTCAAGAGGAAGG - Intronic
1117149529 14:52871531-52871553 CTGGTTCTTCTGCAGGTAGATGG - Intronic
1119124785 14:72115598-72115620 CTGGCTCACCAGCAGGCTGAGGG - Intronic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1119910373 14:78344519-78344541 GTGCCTCACGTGCAGGAGGAAGG - Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1121708902 14:96022256-96022278 CTGGTTTAACTGAAGGAGGTGGG - Intergenic
1121712244 14:96047336-96047358 CTGGGACATCTGCAGGTGGATGG + Intronic
1122852828 14:104546175-104546197 CTGCTTCAGCTGCAGGAAGACGG - Intronic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124588068 15:31028349-31028371 CAGGTTCACCAGCAGGATGTTGG + Exonic
1124666294 15:31595765-31595787 CTGGCACACCTGAAGGAGGCTGG - Intronic
1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG + Exonic
1127864189 15:63018490-63018512 TTGCTTCCCCTGCAGGATGAGGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128600785 15:68993768-68993790 CTGGTTGGCCTCCAAGAGGAGGG + Intronic
1132935629 16:2479335-2479357 CTAGTTCACCTGCAGTCTGAGGG + Intronic
1132937160 16:2486977-2486999 CTGGTGGCCCTGGAGGAGGAAGG - Intronic
1136028389 16:27484958-27484980 CTGGTGCAGCTGGAGGAGGCAGG - Intronic
1136576839 16:31130253-31130275 CTCCTTCTCCTGCAGGAGGCAGG - Exonic
1137270099 16:46897724-46897746 GCGGCTCACCTGCCGGAGGAAGG - Exonic
1137273538 16:46918607-46918629 CTGGTACACCTGCGGGGGCACGG - Exonic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1138176095 16:54899630-54899652 TTTGTTTACGTGCAGGAGGATGG + Intergenic
1140035041 16:71365263-71365285 CTGGTGCAGCTCAAGGAGGAAGG + Intronic
1143504488 17:7356218-7356240 CTGCTCCACCTGCAAGGGGACGG + Exonic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1143838903 17:9714977-9714999 CTGGTCCACCTGCTGCAGGCAGG - Intronic
1144154801 17:12488954-12488976 ATGGATCACCTACAGGAGGAAGG + Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1146260017 17:31415006-31415028 CTGCTTCCCCTGCTGGAGAAGGG - Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1147658611 17:42105159-42105181 CTGGTCCCTCTGCAGGCGGAGGG + Exonic
1147718059 17:42521385-42521407 CTGGCTCACCACCAGGAGGTGGG - Exonic
1148076041 17:44935650-44935672 CTGCCTCACCTACAGAAGGAAGG - Intronic
1148760734 17:49998465-49998487 GTGGGTCACCTGCAGGGGCAGGG + Intergenic
1150125665 17:62632905-62632927 CTGCCTCATCTACAGGAGGAAGG - Intronic
1150219274 17:63486972-63486994 CTTGTTGTACTGCAGGAGGAAGG - Exonic
1150905391 17:69330708-69330730 ATTGTTCACCAGCAGGAGGAGGG - Intergenic
1151215568 17:72574570-72574592 ATGGACAACCTGCAGGAGGAAGG - Intergenic
1151819738 17:76491053-76491075 CTGGACCAGCTGCAGGATGAGGG - Intronic
1152330614 17:79670501-79670523 CTCCTTCACCTGCAGGGTGAAGG + Intergenic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1154048148 18:10927070-10927092 CTGGGTCACACGCGGGAGGAGGG + Intronic
1156764208 18:40631735-40631757 CTAGTTCTCCTTCAGGAGGTGGG + Intergenic
1157441777 18:47717158-47717180 ATGGATCAGCTGCAGGGGGAAGG + Intergenic
1159810310 18:73011445-73011467 CTTGTTAACCTGAAGAAGGAGGG - Intergenic
1160767019 19:813228-813250 CTGGTGCACATCCCGGAGGAGGG - Exonic
1161762681 19:6185851-6185873 GTGGTCCACCCTCAGGAGGATGG + Intronic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1162530999 19:11236528-11236550 CTGGTGCACGTCCTGGAGGAGGG - Exonic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163221766 19:15926826-15926848 CTGGTTCTTCTGCATGTGGATGG - Intronic
1163267381 19:16229134-16229156 CTGGTTCACAAACAAGAGGAAGG - Intronic
1163286478 19:16351640-16351662 GGGGTTTTCCTGCAGGAGGAAGG + Intergenic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1165374303 19:35430921-35430943 TGGATTCAACTGCAGGAGGACGG + Intergenic
1166510061 19:43400843-43400865 CTGATTCACCTATAGGAGGAGGG - Intergenic
1167300331 19:48674084-48674106 GTGCATCAGCTGCAGGAGGATGG + Intergenic
1168191120 19:54739461-54739483 CTGGTTTGCCTGCAGATGGATGG + Intronic
1168201264 19:54817488-54817510 CTGGTTTGCCTGCAGAGGGATGG + Intronic
1168316382 19:55486529-55486551 CAGGAACACCGGCAGGAGGAGGG - Exonic
925880326 2:8346748-8346770 CTGCTTCAGATGGAGGAGGAAGG - Intergenic
926318786 2:11733187-11733209 TTGGATCAGCTGCAGGGGGAAGG - Intronic
927096282 2:19749944-19749966 CTGGCCCAGCTGCAGGAGGCTGG - Intergenic
932338281 2:70943441-70943463 CTCGGACACCTGCAGGAGGCTGG - Intronic
933935185 2:87198044-87198066 CTGCTTCACATCCAGGAAGAAGG - Intergenic
934608667 2:95718108-95718130 CTTCTTCACCTGCAGGAGCCAGG - Intergenic
934620258 2:95799247-95799269 CTGCTCCTCCTGTAGGAGGAGGG - Intergenic
936088027 2:109482730-109482752 CTTCCTCTCCTGCAGGAGGAAGG + Intronic
936541962 2:113359551-113359573 CTTCTTCACCTGCAGGAGCCAGG - Intergenic
937461839 2:122095949-122095971 CTGCCTTACCTCCAGGAGGAAGG + Intergenic
937956575 2:127425047-127425069 CTGGTTCACCTTCTGCAGGCAGG + Intronic
942858601 2:180582662-180582684 CTGATTAGCCTGCTGGAGGAAGG - Intergenic
947915359 2:233828876-233828898 CTGCTTCACCTGGAGGGGCATGG - Exonic
948002579 2:234580402-234580424 CTTGTTTAACTGGAGGAGGATGG - Intergenic
948085321 2:235242483-235242505 CTCCTTCACTTGCAGGAGGAGGG - Intergenic
1169026077 20:2372540-2372562 ATGGATTACCTGCAGGAGGCAGG - Intergenic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1170138602 20:13102912-13102934 CTGTTTACCCTGCAGGGGGAGGG - Intronic
1170262770 20:14429825-14429847 ATGGTTCTCCTGAAGGAGGCTGG - Intronic
1170698072 20:18678254-18678276 CTGGTGCACCTGCAGACAGAGGG - Intronic
1171393498 20:24816205-24816227 CACGTCCACCTGCTGGAGGAGGG - Intergenic
1171447347 20:25214208-25214230 CTCATTTACCTGCAGGAGGAGGG + Intronic
1172299819 20:33841462-33841484 CAGGCTCACCTGCAGGACAAGGG - Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1175495448 20:59411207-59411229 CTAGTTCACATTCAGGGGGAGGG - Intergenic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1178466130 21:32849784-32849806 ATGTTTCACTTGCAGGAGCAGGG + Intergenic
1178892312 21:36530436-36530458 CTGGTTGACCTGCCTGAGGTGGG - Intronic
1179044351 21:37831438-37831460 CTGGGTTACCTGCAGGACCAGGG - Intronic
1179613437 21:42566709-42566731 CTGCTTCATCTGCAGCAGAAAGG - Intronic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1182661720 22:31929776-31929798 CTGGTCTACCAGCGGGAGGATGG - Intergenic
1183716593 22:39536838-39536860 CTGCTCCACGTGCAGGAGGCGGG + Intergenic
1183737806 22:39653569-39653591 CTGCCTCCCCTGCAGGAGAAGGG - Intronic
1183743551 22:39680916-39680938 CAGCTGCACCTGCAGGAAGAGGG - Exonic
1184330216 22:43822310-43822332 CTGGCTGGCCGGCAGGAGGATGG + Intergenic
1184345528 22:43910355-43910377 CTGCTTCACCACCAGGAGGCTGG + Intergenic
1184444004 22:44536558-44536580 CTGTTTCTCCTGCACGGGGATGG - Intergenic
1184879941 22:47298298-47298320 AGGTCTCACCTGCAGGAGGATGG - Intergenic
1185243075 22:49756749-49756771 ATCATTCACCTGCAGGAAGAGGG - Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949819273 3:8098388-8098410 CTGCTTCACATGCATTAGGATGG - Intergenic
949894612 3:8759972-8759994 CTGTCTCACCTGGAGGAGGCGGG - Intronic
951627458 3:24681331-24681353 CTGGCTCTCAGGCAGGAGGAAGG + Intergenic
953041453 3:39258163-39258185 CTGGCACAGCTGCAGGAAGATGG + Intergenic
953677655 3:45015914-45015936 CTGGGTCACATGGAGCAGGAGGG - Intronic
954106764 3:48413769-48413791 CTGGGTCACGTGCAGTATGACGG - Exonic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956227962 3:66980872-66980894 CTGGTTCACCTTTAGGAAAATGG - Intergenic
959040260 3:101414350-101414372 CTGGTGCACCTGCTGCAGGGAGG - Intronic
961368849 3:126417663-126417685 CTGGGTCTCCTGCAGGGGTAGGG + Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
963094400 3:141520375-141520397 GTGGTGTACCTGCTGGAGGAGGG + Intronic
963212659 3:142710285-142710307 CTCATTCACATCCAGGAGGAGGG + Intronic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
964656278 3:159069400-159069422 CTGGAACACCTGCAGGTGAAAGG - Exonic
966779031 3:183567665-183567687 CTGGTTCATCTCCAGGATGAAGG - Intergenic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967887365 3:194342235-194342257 CTGGTTCCCCTGCAGGTGGAGGG + Exonic
968704285 4:2070831-2070853 CTGGTGCCACTGCAGGAGGCCGG - Intergenic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
969666263 4:8559069-8559091 CTGGTTCAGCCTCAGCAGGAAGG + Intronic
969725646 4:8916644-8916666 CTGGATCACCTCCAGGCGGTTGG - Intergenic
971536405 4:27756760-27756782 CTGATTCACCTCTAGGATGAAGG - Intergenic
972720423 4:41691280-41691302 CTGGTCCCCCTGCAAGAGGCTGG + Intronic
974350534 4:60738885-60738907 CTGGTTCTCCTGCATGCAGAAGG - Intergenic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
985162761 4:187061606-187061628 CTGGCTCACCAGCAGTAGCAAGG - Intergenic
986535772 5:8785421-8785443 GTTGTTCACCACCAGGAGGAAGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987046762 5:14116047-14116069 CTGGTTCTCCAGCTTGAGGATGG - Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987877432 5:23696777-23696799 CTGCTTCAATTGCAGGAGGATGG - Intergenic
992151535 5:73909454-73909476 CTGGTTCTCCAGCAGCAGGAGGG + Exonic
995209796 5:109524684-109524706 CTGTTTTCTCTGCAGGAGGATGG - Intergenic
996481200 5:123976631-123976653 CAGGTTAGCCTGCAGGAAGAAGG - Intergenic
996543086 5:124649689-124649711 CTAGGACACCTGCAGGAGGCAGG + Exonic
997666927 5:135637238-135637260 CTGGTTCAACTCCAGCAGGAAGG - Intergenic
999644615 5:153705364-153705386 ATGGTTCTCCTGCCAGAGGAAGG + Intronic
999818330 5:155199808-155199830 CTGCTGCATATGCAGGAGGAAGG + Intergenic
1000464234 5:161555394-161555416 CTGCTTCACCAGCAGGAGTAAGG - Intronic
1000881576 5:166703869-166703891 CTTGATCACTTGCAGGAGGATGG + Intergenic
1004169966 6:13288240-13288262 CTGGATCAACTGGAGCAGGAAGG - Exonic
1004879804 6:19996275-19996297 GTGGGTCCCCTGCAGGAGGCTGG + Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005517917 6:26572145-26572167 CTGGTTCACCTGCACTCGGTGGG - Intergenic
1005726611 6:28655378-28655400 CTGAGTCTCCTGCAGGAGGCTGG + Intergenic
1006378472 6:33684584-33684606 CTGGTTGCCCTGGGGGAGGATGG - Exonic
1008541415 6:52549553-52549575 CTGTTTCACATGCAGGAGCTTGG - Intronic
1011353021 6:86444316-86444338 CTGTCCCACCTCCAGGAGGAAGG + Intergenic
1014395564 6:120924126-120924148 CTGGTTCTCCAGCATGTGGATGG - Intergenic
1017017311 6:150112175-150112197 ATGGTTCAAATGCAGGATGAAGG + Intergenic
1019027818 6:168985927-168985949 CTTGATCACCTGGCGGAGGAGGG - Intergenic
1019628027 7:2031201-2031223 CTGGTGCAGCTGCAGGCAGAGGG - Intronic
1020243030 7:6410142-6410164 ATCATCCACCTGCAGGAGGAGGG - Exonic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1020573122 7:9890891-9890913 CTGGGTCACCTGGAGGTGGGTGG - Intergenic
1020636872 7:10707044-10707066 CTGCTCCACCTGCAGAAAGAAGG + Intergenic
1021580271 7:22144759-22144781 GTAGTTCAGCTGCAGGATGAAGG + Intronic
1022363942 7:29690997-29691019 TTGGTTCAGCAGCAGAAGGATGG - Intergenic
1022697425 7:32722732-32722754 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1022934681 7:35161234-35161256 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1023025038 7:36042408-36042430 GTGGTTCAGCTGCAGGAAGGGGG + Intergenic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1026575398 7:71567273-71567295 CTGCTACACCAGCAGGAGCAAGG + Intronic
1026598272 7:71752447-71752469 CTAGGTCACCTGCTGGAGGAGGG + Intergenic
1029830622 7:103254014-103254036 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1030349887 7:108472549-108472571 CTGGATCAGCTGCAGTTGGAAGG - Exonic
1034318695 7:150159501-150159523 CCAGCTCAGCTGCAGGAGGAGGG - Intergenic
1034774062 7:153807711-153807733 CCAGCTCAGCTGCAGGAGGAGGG + Intergenic
1034869862 7:154674430-154674452 CTGGTTGATCTGCAAGGGGAGGG + Intronic
1035534005 8:377464-377486 CTGGTTCAGCTGTATCAGGAAGG - Intergenic
1036294750 8:7526951-7526973 CTCTTTCACCTGCAGAAGAAGGG + Intergenic
1036296385 8:7541534-7541556 CTTTTTCACCTGCAGAAGAAGGG + Exonic
1036326181 8:7779485-7779507 CTTTTTCACCTGCAGAAGAAGGG - Exonic
1036327813 8:7794040-7794062 CTCTTTCACCTGCAGAAGAAGGG - Intergenic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038004136 8:23415924-23415946 CTGGGGCTCCTGCAGGAGGAAGG - Intronic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1039465328 8:37781362-37781384 CTGGTCCAGCTTCAGGGGGAAGG - Intergenic
1044850274 8:96420402-96420424 CCAGTTCACCTGCAGGAGAAAGG + Intergenic
1046553397 8:115745411-115745433 CTGGTTTCCTTGCAGGGGGATGG - Intronic
1048303115 8:133265859-133265881 CTGGTTGACCTTGAGGAGGGCGG - Intronic
1048443832 8:134478713-134478735 CTCGGTGACCTGCGGGAGGAGGG + Exonic
1048458821 8:134602704-134602726 CTCGTTCACCTGCCTGAGCAAGG - Exonic
1048799666 8:138184321-138184343 CCTGTTCACCTGCAGGATGAAGG - Intronic
1048833919 8:138500384-138500406 CTGGTTCTGCTGCAGGTGGAAGG + Intergenic
1049183412 8:141235244-141235266 TTGCTTCACCTGCATGAAGAAGG - Intronic
1049213036 8:141395513-141395535 CCAGTTCCCCTCCAGGAGGAAGG - Intronic
1049425694 8:142537011-142537033 GTGGTTGACCGGCAGGAGGAGGG + Exonic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1052867280 9:33472040-33472062 CTGGTTGACCTCCCGTAGGAAGG + Exonic
1055612857 9:78041126-78041148 CGGGTTGATCTGCAGGAGGTTGG + Intergenic
1056767358 9:89453138-89453160 CTGCTTCACCTGCACTGGGATGG - Intronic
1056874122 9:90311607-90311629 ATAGAACACCTGCAGGAGGAGGG - Intergenic
1057476715 9:95409154-95409176 CTGGTTCCTCCTCAGGAGGAGGG + Intergenic
1059760034 9:117329054-117329076 CAGGTTAACCTGCAGCTGGAGGG + Intronic
1059925846 9:119208457-119208479 CTGATTCACCTGATTGAGGAGGG - Intronic
1061047787 9:128176467-128176489 CTGGAACTCCTGCAGCAGGAGGG + Exonic
1062250210 9:135590043-135590065 CTGCCTCACCTGCTGGAGCAGGG - Intergenic
1062390620 9:136332262-136332284 CTGGTGCAGCTGCAGGTGGCTGG + Intronic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1187356677 X:18580323-18580345 CTGGTCTACCTGCAGGACCAAGG - Intronic
1187927212 X:24261286-24261308 CGGGTTCAGATGCAGGGGGAAGG - Intergenic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1192264172 X:69527575-69527597 CTGTTTCAGCTTCAAGAGGACGG - Intronic
1195678195 X:107523399-107523421 CTGGGCCACCTGCAGGAAGATGG + Intronic
1196444480 X:115738382-115738404 TTGGTTCACCTGAAGGTTGAAGG + Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1198616481 X:138463529-138463551 CTGGTTGACCTGCCGGGAGATGG - Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1200073962 X:153542194-153542216 CTCGTTCCCCAGAAGGAGGAGGG + Intronic