ID: 1144683491

View in Genome Browser
Species Human (GRCh38)
Location 17:17210924-17210946
Sequence CACCGCACCCAGCTGCCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 319}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144683491_1144683500 18 Left 1144683491 17:17210924-17210946 CCAGTTGGCAGCTGGGTGCGGTG 0: 1
1: 0
2: 7
3: 49
4: 319
Right 1144683500 17:17210965-17210987 AGCACTTTAGGAGGCCGAGGCGG 0: 1754
1: 94563
2: 188634
3: 137269
4: 73604
1144683491_1144683501 19 Left 1144683491 17:17210924-17210946 CCAGTTGGCAGCTGGGTGCGGTG 0: 1
1: 0
2: 7
3: 49
4: 319
Right 1144683501 17:17210966-17210988 GCACTTTAGGAGGCCGAGGCGGG 0: 1734
1: 91513
2: 228341
3: 236978
4: 163327
1144683491_1144683495 6 Left 1144683491 17:17210924-17210946 CCAGTTGGCAGCTGGGTGCGGTG 0: 1
1: 0
2: 7
3: 49
4: 319
Right 1144683495 17:17210953-17210975 CCCTCTAATTCCAGCACTTTAGG 0: 5
1: 381
2: 20671
3: 350127
4: 267543
1144683491_1144683497 9 Left 1144683491 17:17210924-17210946 CCAGTTGGCAGCTGGGTGCGGTG 0: 1
1: 0
2: 7
3: 49
4: 319
Right 1144683497 17:17210956-17210978 TCTAATTCCAGCACTTTAGGAGG 0: 7
1: 735
2: 25800
3: 354007
4: 260473
1144683491_1144683498 15 Left 1144683491 17:17210924-17210946 CCAGTTGGCAGCTGGGTGCGGTG 0: 1
1: 0
2: 7
3: 49
4: 319
Right 1144683498 17:17210962-17210984 TCCAGCACTTTAGGAGGCCGAGG 0: 121
1: 7380
2: 139179
3: 280472
4: 209784
1144683491_1144683502 22 Left 1144683491 17:17210924-17210946 CCAGTTGGCAGCTGGGTGCGGTG 0: 1
1: 0
2: 7
3: 49
4: 319
Right 1144683502 17:17210969-17210991 CTTTAGGAGGCCGAGGCGGGCGG 0: 639
1: 42513
2: 127262
3: 196648
4: 150741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144683491 Original CRISPR CACCGCACCCAGCTGCCAAC TGG (reversed) Intronic
900224716 1:1527526-1527548 CACTGCACCCAGCTGTCCCCCGG - Intronic
900315338 1:2053496-2053518 CTCAGCACCCAGCAGCCAGCTGG - Intronic
900968957 1:5978724-5978746 CAGGGCTCCCAGCAGCCAACAGG + Intronic
901036927 1:6341877-6341899 CATGGGACCCAGCTGCCAAGGGG - Intronic
901288398 1:8101460-8101482 CACCGCACCTGGCTGCAAACAGG + Intergenic
901678784 1:10901500-10901522 CACCTCACCCACCTGGCAATTGG - Intergenic
902248360 1:15136848-15136870 CACCACACCCACCTGGCAAGAGG + Intergenic
902780988 1:18705002-18705024 CTCCGCAGGCAGCTGCCTACAGG - Intronic
903119953 1:21209450-21209472 CACCACACCCAGCTGTTCACAGG + Intergenic
903770308 1:25759563-25759585 CACGGCTCCCAGCAGGCAACTGG + Intronic
904012099 1:27395722-27395744 CACCCCACCCCTCTGCCAACCGG + Exonic
904992570 1:34605123-34605145 CACCGCGCCCAGCCTACAACAGG + Intergenic
905027340 1:34859744-34859766 CGCCGCACCCAGCGGCCCGCGGG + Exonic
905170515 1:36107113-36107135 CACCGCACCCAGCTGAGCTCAGG - Intronic
905512490 1:38533176-38533198 CACCGCACCCGGTTGCCAGGAGG - Intergenic
905947640 1:41917362-41917384 CACAGCAGCCAGGTGCCCACTGG - Intronic
906458403 1:46018342-46018364 CAGTGCACCCAGCTGCCTGCTGG + Intronic
907224297 1:52929909-52929931 CACCGCACCTGGCCGTCAACAGG + Intronic
908979619 1:69939732-69939754 CAGAGTACCCAGCTCCCAACTGG + Intronic
909559283 1:76991716-76991738 CACAGAACATAGCTGCCAACTGG + Intronic
910140034 1:84016959-84016981 CACCGCACCCAGCTAATAAGTGG + Intergenic
913016325 1:114739317-114739339 CACCGCGCCCAGCTTCTAAGAGG + Intronic
913073697 1:115323381-115323403 CACAAAACCCATCTGCCAACTGG - Intronic
913111196 1:115658726-115658748 CTCCCCCTCCAGCTGCCAACAGG - Intronic
914093933 1:144528775-144528797 CACTGCACCTAACTGACAACAGG - Intergenic
914861131 1:151387039-151387061 CACCGCACCCAGCCGAGAACAGG + Intergenic
915136213 1:153733497-153733519 CACCGCACCCAGCTGTCCTTGGG + Intronic
915231032 1:154445460-154445482 CACCGCGCCCAGCTGTCATTAGG - Intronic
917775078 1:178324907-178324929 CTTGGCACCCACCTGCCAACTGG + Intronic
918965110 1:191334263-191334285 CACCGCAGCCAACTGCCTCCCGG - Intergenic
920535221 1:206732721-206732743 CACCGCGCCCTCCTGCCCACGGG + Exonic
920716182 1:208342486-208342508 CACCACACCCAGCTGCAAACTGG + Intergenic
920721669 1:208393175-208393197 CAACCCACCCAGCTGCTCACAGG - Intergenic
922441017 1:225654640-225654662 CACCGCACCCGGCTGAAACCAGG - Intergenic
922464254 1:225835834-225835856 CACCACACCCAGCTGACATTGGG + Intronic
922857494 1:228787531-228787553 CATGGCACTCAGCTGCCATCTGG + Intergenic
922938312 1:229437852-229437874 CACCGCACTCAGCTCTCACCTGG - Intergenic
923105846 1:230853083-230853105 CAGAGCACCCAGCTCCCATCAGG + Intronic
923623844 1:235598319-235598341 CACTGCACCCAGCTGGAATCGGG - Intronic
924957561 1:248944408-248944430 CACTGTGCCCAGCTGCCAGCAGG + Intergenic
1063175229 10:3544740-3544762 CAGCCCACTCAGCTGCCCACTGG + Intergenic
1063212523 10:3894105-3894127 CACATCACCCAGCTGTCTACAGG - Intergenic
1063627286 10:7701999-7702021 CACCGCGCCCAGCTGCCATTGGG + Intergenic
1067024920 10:42836405-42836427 GACCTCACCCAGCCGCCGACAGG - Intergenic
1067169438 10:43894402-43894424 CACCCTACCCAGCTGCCACAGGG + Intergenic
1067347023 10:45444234-45444256 CACTGCACCCAGATGCCAGCAGG - Exonic
1069028924 10:63575140-63575162 CACCGCACCCAGACCCCAAGAGG + Intronic
1069397079 10:68001080-68001102 CACTGCACCCGGCTGACAAAAGG - Intronic
1069455153 10:68548135-68548157 CACCGCACCCAGCCGAAAGCAGG + Intergenic
1070215755 10:74378810-74378832 CACCACACCCGGCTCCCTACTGG - Intronic
1074445027 10:113514517-113514539 CACCACACCCAGCCTCCATCTGG + Intergenic
1075857083 10:125638672-125638694 CACCGTGCCCAGCTGTCACCTGG + Intronic
1076169410 10:128307193-128307215 CACTGAACCCAGCAGCCAATGGG - Intergenic
1076609397 10:131711796-131711818 CACCGCACCCAGCCACACACTGG + Intergenic
1077074148 11:692562-692584 CACCGCGCCCGGCTGCAAACAGG - Intronic
1077125041 11:929831-929853 CACCGCACCCGGCTGGCACCAGG - Intronic
1077285297 11:1762913-1762935 GACCTCACCCACCTGCCAAAAGG + Intronic
1078257734 11:9674409-9674431 CACTGCACCCAGCTTCCCAAGGG - Intronic
1079205811 11:18413369-18413391 CACCACACCTGGCTGCCAATAGG + Intronic
1079328636 11:19515775-19515797 CACCCCACCCTGCTTCCACCTGG - Intronic
1080560042 11:33454799-33454821 CACCGCGCCCAGCCACCAAATGG - Intergenic
1081890098 11:46534202-46534224 CACCGCACCTGGCTGGCACCAGG - Intronic
1082063959 11:47883548-47883570 CACCACACCCAGCTACCTGCTGG - Intergenic
1083206129 11:61150419-61150441 CACCGCCCCCACCTGTCAATGGG + Intronic
1083251588 11:61471442-61471464 CACCGCACCCGGCCCCCAACAGG - Intronic
1083255440 11:61492571-61492593 CACCGCACCCAGCCGGGAGCAGG - Intergenic
1083718547 11:64592679-64592701 CACCGCACCCAGCTCCCTGGGGG + Intronic
1084016225 11:66383976-66383998 CACCGCACCCGGCCGGCAAGAGG + Intergenic
1084410336 11:69002980-69003002 CCCCCCACCCAGCTGCCTTCAGG + Intergenic
1084675220 11:70630136-70630158 CACCTCACCCCACTGCCATCAGG - Intronic
1085689666 11:78654909-78654931 TACCCCGCACAGCTGCCAACTGG - Exonic
1087281458 11:96215644-96215666 CACTGAACCCTGCTGCCACCTGG + Intronic
1089487777 11:118860492-118860514 CACCGCGCCCAGCCCCCCACTGG - Intergenic
1091695803 12:2627435-2627457 CACCGCCGCCAGCTGCCAGTGGG + Intronic
1091776963 12:3191036-3191058 GACAGCACCCTGATGCCAACTGG + Intronic
1093534115 12:20202529-20202551 CACCGGACCCAGCCCCCACCTGG - Intergenic
1096698025 12:53363192-53363214 CACCGCACCCGGCTGGCACTTGG + Intergenic
1097323909 12:58254527-58254549 CTCCGCACCCAGCTGCAAGGAGG - Intergenic
1100045634 12:90376811-90376833 CACTGCACCCAGCCGCAAATTGG - Intergenic
1100225258 12:92549913-92549935 CACCGCGCCCAGCCTCCACCTGG - Intergenic
1101956116 12:109213886-109213908 CACTGCACCCGGCTGACAAAAGG + Intronic
1102047838 12:109840886-109840908 CACCACGCCCAGCTGCCCAGAGG - Intergenic
1102816547 12:115870542-115870564 GAGCTCACCCAGCTGCCAAAAGG + Intergenic
1102952818 12:117041619-117041641 CACCGCGCCCAGCCTACAACGGG + Intronic
1103977772 12:124714760-124714782 CACCGCGCCCGGCTGAGAACAGG - Intergenic
1104310250 12:127648341-127648363 CATAGCTCCCAGCAGCCAACAGG + Intergenic
1105271558 13:18881056-18881078 CACCGTACCCAGCCCCCAGCAGG - Intergenic
1107280024 13:38722940-38722962 CACTGCACCTGGCTGCCAGCTGG - Intronic
1107465018 13:40641694-40641716 CACCGCACCCAGCTGTCAGTGGG - Intronic
1110450646 13:75635681-75635703 CACCGCACCCACCTGGAAGCCGG + Intronic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1112053018 13:95662940-95662962 CACCGCACCCGGCTGACAACTGG - Intergenic
1112653616 13:101425081-101425103 CACCACACCCAGATCCTAACAGG + Intergenic
1113403252 13:110014871-110014893 CACTGCACCCAGGTTCTAACAGG - Intergenic
1113520302 13:110935960-110935982 CACCGCACCCAGCTGAAACCAGG + Intergenic
1113971644 13:114195781-114195803 CACTGCACCCAGCTGCCAGGAGG - Intergenic
1114080317 14:19198012-19198034 CACGACACCCAGCTGACAAAAGG + Intergenic
1117807185 14:59506574-59506596 CACCACACCCAGCTGAGCACAGG + Intronic
1117986123 14:61387857-61387879 CACCACACCCAGCGGACAATAGG - Intronic
1118789288 14:69074743-69074765 CACCGCACCCAGCCCACACCTGG - Intronic
1120114069 14:80593256-80593278 CACCTCACCCGGCCGACAACAGG - Intronic
1120842122 14:89095230-89095252 CCCCACACCCAGCTGCCATCTGG - Intergenic
1121002410 14:90461431-90461453 CACCGCACCCAGCTGAGACACGG + Intergenic
1121052116 14:90826244-90826266 CACCACGCCCAGCTGACATCAGG + Intergenic
1121726504 14:96155895-96155917 CACCGCACCCAGCTTCTCAAAGG - Intergenic
1122247543 14:100414599-100414621 CACCGCACCCGGCCGCCTAGAGG + Intronic
1123218132 14:106831342-106831364 CACCGCGCCCAGCCGCCGTCTGG + Intergenic
1202892074 14_KI270722v1_random:168223-168245 CCCGGCACCCTGCTGCCACCAGG + Intergenic
1124388267 15:29227628-29227650 CCCCACACCCAGCCGCCACCAGG + Intronic
1124555413 15:30720341-30720363 CACCGCACCCAGCCAGTAACTGG + Intronic
1124675846 15:31685355-31685377 CACCGCACCCAGCCAGTAACTGG - Intronic
1125377222 15:39043056-39043078 CACCGCACCCAGCCGATAAAAGG - Intergenic
1128469141 15:67937407-67937429 CTCCGCCCCCTGCTGCCAACAGG - Intergenic
1128628462 15:69237304-69237326 CACCGCACCCAGCCCCAAATTGG - Intronic
1128827823 15:70736725-70736747 CACCGCACCCAGCCTCAACCTGG + Intronic
1128972921 15:72123826-72123848 CACCGCACCCAGCCTACAAATGG + Intronic
1129340202 15:74880857-74880879 CACCGCACCCAGCCACTAATGGG - Intergenic
1129770943 15:78203317-78203339 CAAGGCACCCAGATCCCAACAGG + Intronic
1129833405 15:78685446-78685468 CAGGGGACCCAGCTGCCATCTGG + Intronic
1129844092 15:78760344-78760366 GACAGCCCCCAGCTGCCACCCGG + Intronic
1131545264 15:93310422-93310444 CACCGCACCCAGCCTGGAACGGG + Intergenic
1132506351 16:311316-311338 CACCGCGCCCAGCCCGCAACAGG + Intronic
1132601529 16:775138-775160 CACCCCACCCAGCGCCCACCAGG + Exonic
1133016281 16:2942988-2943010 CACCACGCCCAGCTGGCATCTGG + Intronic
1133218047 16:4305376-4305398 CACCGCACCCGGCTGCTAAAGGG + Intergenic
1133405768 16:5523325-5523347 CACCGCGCCCAGCTGGAAATTGG - Intergenic
1133587327 16:7208545-7208567 CACTGCACCCAGCAGAGAACAGG - Intronic
1135966443 16:27039648-27039670 CACCACACCCAGCTGCAGACAGG - Intergenic
1138410501 16:56835838-56835860 CACCGCGCCCGGCTGGTAACAGG - Intronic
1140128238 16:72135503-72135525 CACCGCACCCGGCCGTCAGCTGG + Intronic
1140189483 16:72803041-72803063 CACCGCACCCGGCCGACAGCTGG - Intronic
1140576001 16:76169828-76169850 CACCGCACCCAGCCAACAATTGG - Intergenic
1142260463 16:89040392-89040414 CACCGCACCCAGCCGACACCTGG + Intergenic
1143489411 17:7276401-7276423 CACCACACCTAGCTGCCAGTTGG - Intergenic
1144367999 17:14563187-14563209 CACCGCACCCAGCAAGCAAATGG - Intergenic
1144594943 17:16561025-16561047 CACCGTGCCCAGCTGCAAAATGG - Intronic
1144683491 17:17210924-17210946 CACCGCACCCAGCTGCCAACTGG - Intronic
1145279979 17:21459976-21459998 CATCTCACCCAGCTGCCATAGGG - Intergenic
1145397904 17:22510507-22510529 CATCTCACCCAGCTGCCATAGGG + Intergenic
1146130533 17:30270209-30270231 CACCGCACCCAGCTAGAAAATGG - Intronic
1147777016 17:42909130-42909152 CGCTGCACCCAGCCCCCAACAGG + Intronic
1148153507 17:45410160-45410182 CAGCTCACCCAGCTCCTAACAGG + Intronic
1148697428 17:49569670-49569692 CACCGCGCCCGGCTGCCATTCGG + Intergenic
1150372688 17:64654539-64654561 CACCGCACCCAGCTGATGGCTGG - Intronic
1150504460 17:65683753-65683775 CACCGCACCCAGCTGGAAGTTGG - Intronic
1150551195 17:66211863-66211885 CACCGCACCCAGCCGAGATCAGG + Intergenic
1151869126 17:76824668-76824690 CACCGCGCCCGGCTGACAGCAGG + Intergenic
1152219008 17:79050666-79050688 CACTGCATCCAGCTGCCAGCGGG + Intergenic
1152612759 17:81323616-81323638 CGCCGCGGCCAGCAGCCAACGGG + Intronic
1153287291 18:3468310-3468332 CACCGCGCCCAGCTCCCCAGTGG - Intergenic
1153886793 18:9474977-9474999 CGCCCCACCCAGCGGCCAGCCGG + Intergenic
1154993501 18:21618132-21618154 CACTGCACCCAGCTACACACAGG - Intronic
1155441357 18:25865747-25865769 CACTGCACCCAGCTCCCAGAGGG - Intergenic
1156168312 18:34450768-34450790 CACCGCACCCAGCCTACTACTGG + Intergenic
1156465052 18:37343474-37343496 GACTGCACCCGGCTGCCATCTGG - Intronic
1157227454 18:45880140-45880162 CTGCGCCCCCAGCTGCCAGCAGG - Exonic
1158474771 18:57770300-57770322 CACCCACCCCAGCTGCCAATGGG + Intronic
1159369137 18:67509020-67509042 CACTGCACCCGGCCGCCAACAGG + Exonic
1159888840 18:73935890-73935912 GACCTCACCCAGCTGCCCAGAGG - Intergenic
1160262342 18:77306313-77306335 CACTGCACTCAGCTCCCCACTGG - Intergenic
1160271877 18:77394268-77394290 CACCGCACCCAGCTGCAACCAGG - Intergenic
1160780166 19:873959-873981 AACCGCCGCCAGCTGCCAGCCGG - Intronic
1160851700 19:1195777-1195799 CACCGCGCCCAGCCGGTAACTGG - Intronic
1160852124 19:1197591-1197613 CACCGCGCCCAGCCGGTAACTGG - Intronic
1161349245 19:3783287-3783309 CACCCCACCCAGAGGCCACCCGG - Intronic
1161989442 19:7676452-7676474 CACCGCACCCAGCCTCCTCCAGG + Intergenic
1162805430 19:13135830-13135852 CGCCGGACCTGGCTGCCAACCGG + Exonic
1163062832 19:14772789-14772811 CACTGCACCCGGCTGCCATGGGG - Intronic
1163102676 19:15107626-15107648 CCCCGCACCCCGCTGCAGACTGG + Intronic
1164888933 19:31806521-31806543 CACCGCACCCAGATGCCTCCTGG - Intergenic
1165407293 19:35638622-35638644 CACCGCACCCAGCCGGTCACAGG - Intergenic
1165881183 19:39045125-39045147 CACCGCATCCTGCTGCCAGCTGG - Intergenic
1166339473 19:42129119-42129141 CACCGCACCCAGCCCCCTCCTGG + Intronic
1167056632 19:47115147-47115169 CACCACGCCCCGCTGCCAGCTGG - Intronic
1167280243 19:48563203-48563225 CACCGCACCCAGCCTCCTATCGG + Intronic
1167533640 19:50034812-50034834 CTCTGGACCTAGCTGCCAACTGG - Intronic
1167730485 19:51250744-51250766 CACCGCCCCCAGCTGCGGATTGG + Intronic
1167927081 19:52829983-52830005 CACCGTTCCCAGCTGCCTCCAGG - Intronic
925011034 2:486451-486473 TGCCGTACCCAGCTGCCAACAGG - Intergenic
926753744 2:16219819-16219841 CCCAGTACCCAGGTGCCAACTGG + Intergenic
927864980 2:26582484-26582506 CACTGCCTCCAGCGGCCAACTGG - Intronic
928411572 2:31058284-31058306 CACGGCACCCACCTCCCAGCGGG + Intronic
928421210 2:31138727-31138749 CGCCACCCCCAGCTGCCAGCTGG + Intronic
929215685 2:39409438-39409460 CACTGCAGCCAGCTTCCAAGTGG - Intronic
931269458 2:60688743-60688765 CACCGCGCCCAGCTGCAGACTGG - Intergenic
931325330 2:61216310-61216332 CACCGCACCCAGCCGCCAAATGG - Intronic
932242539 2:70168574-70168596 CACCGCACCCGGCTGCTAATAGG + Intronic
932274355 2:70440880-70440902 CACCCCAGCAACCTGCCAACAGG - Intergenic
932305170 2:70696870-70696892 CACCGCACCCAGCTCTGATCTGG - Intronic
932338617 2:70944953-70944975 CACCGTGCCCAGCTGCTTACAGG + Intronic
933042215 2:77483627-77483649 CACCGCACCCAGCAGGGAAGAGG + Intronic
933349934 2:81140745-81140767 CACCGCATCCAGCCACTAACAGG - Intergenic
934145328 2:89087908-89087930 CACCACACCCAGCTAATAACAGG + Intergenic
934946428 2:98545789-98545811 CATCTCACCCACCTGCCACCTGG + Intronic
935032605 2:99337147-99337169 CACCTCACCCCTCTCCCAACGGG - Intronic
935066533 2:99653051-99653073 AAACGCACCCAGCAGGCAACAGG + Intronic
935649207 2:105367661-105367683 CACCGCTGCCAGCAGCCAATTGG - Exonic
936051057 2:109223841-109223863 CACCACATCCAGCTACCAAGTGG - Intronic
937623980 2:124023758-124023780 GACCCCTTCCAGCTGCCAACAGG + Intergenic
940225647 2:151398607-151398629 CACCGCACCCAGCTTCAAACTGG + Intergenic
940899798 2:159116136-159116158 CACCGCGCCCAGCCACTAACAGG - Intronic
942520235 2:176796281-176796303 CACCGCACCCAGCCAATAACAGG - Intergenic
942707452 2:178792818-178792840 CAAACCACCCAACTGCCAACTGG + Intronic
944727116 2:202482825-202482847 CACCACACCCGGCTGCTACCTGG + Intronic
945999660 2:216470772-216470794 CACCGCACCCAGCCTCCAGTTGG + Intronic
948240463 2:236429088-236429110 CCCCCCACCCTGCTGCCCACAGG - Intronic
1168874872 20:1164511-1164533 CACTGAACCAAGCTGCCATCAGG - Intronic
1170228578 20:14020182-14020204 CACCGCGCCCGGCTGACAATGGG - Intronic
1171187578 20:23133779-23133801 CACAGCACCCATCTGATAACCGG - Intergenic
1171247406 20:23622931-23622953 GGCCACACCCAGCTGCCAAGAGG - Intergenic
1172285984 20:33740794-33740816 CACCGTACCCAGCCGCCACAGGG + Intronic
1172609912 20:36242679-36242701 CACCGCACCCAGCCTTTAACAGG + Intronic
1172652080 20:36510697-36510719 CACTGCGCCCAGCTGACACCTGG + Intronic
1173393372 20:42655199-42655221 CACTGCACCCAGCTGAGATCTGG - Intronic
1173592266 20:44233982-44234004 CTCCCCACACCGCTGCCAACTGG + Intergenic
1173806845 20:45931659-45931681 CACCGCACCCAGCTGAGAAGAGG + Intergenic
1175116042 20:56683135-56683157 CACAGCTCCCTGCTGCCTACAGG - Intergenic
1175865065 20:62171188-62171210 CACCGCACCCGGCCACAAACTGG + Intronic
1175902733 20:62366528-62366550 CACCCCATCCAGAGGCCAACAGG + Intronic
1176183854 20:63767354-63767376 CACCCGCCCCAGCTGCCCACCGG + Intronic
1177636712 21:23797066-23797088 CACCGCACCCAGCCCCTATCTGG + Intergenic
1177883895 21:26725486-26725508 CACCGCACCCAGCCGCAAAAAGG - Intergenic
1179219822 21:39396250-39396272 CACCGCACCCGGCCGACACCCGG - Intronic
1180264023 21:46698299-46698321 CACTGTGCCCAGCTGCCAGCAGG + Intergenic
1180697186 22:17759268-17759290 CACCGCACCCAGCCCACACCTGG - Intronic
1180965237 22:19784723-19784745 CCCTGCACACAGCTGCCCACCGG + Exonic
1181010779 22:20039338-20039360 CACCGCACCCGGCTGTAAACAGG - Intronic
1181304085 22:21904569-21904591 CACCCCACCCAGGAGCCATCAGG - Intergenic
1181645328 22:24228143-24228165 CACTGCACCCAGCCGAGAACGGG - Intronic
1182312348 22:29418214-29418236 CACCGCACCCAGCCTCGAATGGG + Intronic
1182811549 22:33121234-33121256 CTGGCCACCCAGCTGCCAACTGG + Intergenic
1183021776 22:35033303-35033325 CCCCACACACAGCTGCCACCAGG - Intergenic
1183087574 22:35495870-35495892 CACCGCACCCAGCCTGGAACTGG - Intergenic
1183362049 22:37387860-37387882 CACCGTACCCAGCTGCCTCCGGG + Intronic
1183577444 22:38700901-38700923 CACCGCAGCCGGCCGCCACCTGG + Intronic
1184438851 22:44496882-44496904 CAGTGCATCCAGCTTCCAACGGG - Exonic
1184576614 22:45372999-45373021 CACCGCACCCGGCTGACTCCAGG + Intronic
1185430256 22:50806656-50806678 CACTGTGCCCAGCTGCCAGCAGG + Intergenic
950080621 3:10219604-10219626 CACCGCACCTGGCTGCCATCAGG + Intronic
950426668 3:12928101-12928123 CCCCTCACTCAGCTGCCAGCTGG - Intronic
951903548 3:27680765-27680787 CACTGCACCAGGCTGCCAAGTGG + Intergenic
952399422 3:32949778-32949800 CACCGCACCCAGCCTGCTACTGG - Intergenic
952748345 3:36803081-36803103 CACCACACCCAGTTGACACCAGG + Intergenic
953518010 3:43615939-43615961 CACCGCGCCCGGCTACCAAATGG + Intronic
953900209 3:46836073-46836095 CACCGCACCTGGCTGCCACTTGG - Intergenic
954054370 3:48009387-48009409 CACCGCACCCAGCTGACTCATGG + Intronic
954272009 3:49517279-49517301 CACCGCACCCAGCCCCCAAGAGG + Intronic
956540512 3:70332880-70332902 TACCGCGCCCAGCTGGCACCAGG + Intergenic
956590787 3:70912581-70912603 CACTGCACCCAGCCTTCAACAGG - Intergenic
958915987 3:100050816-100050838 CACCGCACCCAGCCTCCCCCAGG + Intronic
959053302 3:101545072-101545094 CACCGTGCCCAGCTGCCAAGGGG - Intergenic
959909502 3:111747936-111747958 CAGCGCATCCAGTTGCCCACAGG - Intronic
960321342 3:116240885-116240907 CACCGCACCCAGCTGTCTGCAGG - Intronic
962247225 3:133805869-133805891 CACCGCCGCCATCTGCCACCCGG - Exonic
963597514 3:147346919-147346941 CACTGCACCCAGCTGCATATAGG - Intergenic
965926281 3:173984753-173984775 CACTGCACCCAGCTGGCAACAGG - Intronic
966472477 3:180306777-180306799 CTCAGCACCCAGCTGTCCACGGG + Intergenic
968373024 4:12299-12321 CAGCGTCCCCAGCTGCCAGCAGG - Intergenic
968697088 4:2036405-2036427 CAGCTCCCCCAGCTGCCATCAGG + Intronic
971348270 4:25831805-25831827 CACCGCACCCAGCTATCATCTGG + Intronic
972273922 4:37539366-37539388 CACCGCGCCCGGCTGCCACAGGG - Intronic
973974380 4:56247555-56247577 CACCGTGCCCAGCTCACAACAGG - Intronic
974036113 4:56819901-56819923 CACTGCGCCCAGCTGCAAAATGG + Intronic
975176295 4:71293273-71293295 CACCGCACCCAGCCTCCTTCTGG - Intronic
975570042 4:75806271-75806293 CACCGCACCCAGCCTACAAATGG + Intronic
975782274 4:77851785-77851807 CACAGCGCCCAGCTGACAAATGG + Intergenic
976390800 4:84501885-84501907 CACCGCTCCCAGCTGTAGACAGG - Intergenic
978812052 4:112860513-112860535 CAACCCACCCAGCTACTAACTGG + Intronic
979372249 4:119902878-119902900 CACCGCACCCAGCTGTGATCTGG + Intergenic
981498134 4:145416510-145416532 CACCGCACCCAGCCGAAAGCAGG + Intergenic
983298528 4:165896769-165896791 CACCGCACCTGGCTGTCAAATGG + Intronic
983812110 4:172075621-172075643 CACCGCGCCCGGCCCCCAACAGG + Intronic
984995116 4:185423145-185423167 CACCGCGCCCAGCTGGCACAGGG + Intronic
985606953 5:862935-862957 TACCGCACCCAGCTTCCACTGGG - Intronic
988854905 5:35219013-35219035 CCCCCCACCCCGCCGCCAACAGG - Intronic
989105983 5:37863513-37863535 CACCGCAACCAGCTGGAAGCTGG + Intergenic
991774349 5:70069989-70070011 TGCCGCACCCAGCTGTAAACTGG + Intronic
991853644 5:70945412-70945434 TGCCGCACCCAGCTGTAAACTGG + Intronic
992943725 5:81789110-81789132 CACCACACCCAGCTGAAAACAGG + Intergenic
993997945 5:94744796-94744818 CACCGCGCCCAGCCACCAATAGG + Intronic
997512940 5:134465843-134465865 CACCACACCCAGCTTCCCAGAGG - Intergenic
998012449 5:138706144-138706166 CACCGCACCCAGCTGGAAGCTGG - Intronic
1000336456 5:160245071-160245093 CACCGCACCCAGCCCCTACCTGG - Intergenic
1001260262 5:170222375-170222397 CACGTCAGCCAGGTGCCAACTGG - Intergenic
1001982330 5:176045792-176045814 CGCCCCATCCTGCTGCCAACAGG - Intergenic
1002235131 5:177798265-177798287 CGCCCCATCCTGCTGCCAACAGG + Intergenic
1003482184 6:6544554-6544576 CCCTGCACCCAGCTGCCCACTGG - Intergenic
1003866588 6:10368946-10368968 CAAGTCACCCAGCTGCTAACAGG + Intergenic
1003872615 6:10414188-10414210 TCCCGCACCCAGCGGCCAGCAGG + Intronic
1005705176 6:28444168-28444190 CACCGCACCCGGCCACAAACAGG + Intergenic
1007416356 6:41693725-41693747 CTCTCCACCCAGCTACCAACGGG + Intronic
1007831891 6:44645299-44645321 CATCCCACCCAGGCGCCAACAGG + Intergenic
1008891156 6:56492581-56492603 CACTGCACCCGGCTGACAGCAGG - Intronic
1011608196 6:89125490-89125512 CACTGCACCCAGCTGAGAAATGG - Intergenic
1013468291 6:110436892-110436914 CTCCTCCCCCATCTGCCAACTGG + Intronic
1013722982 6:113053823-113053845 CACCGCACCCGGCCGAAAACAGG - Intergenic
1015908900 6:138147100-138147122 GACCTCACCCAGCTCACAACTGG + Intergenic
1018283805 6:162216240-162216262 CACCGCGCCCGGCCGCAAACTGG - Intronic
1019016842 6:168886114-168886136 CACCGCAGCCAGCAGCCATGCGG + Intergenic
1019109952 6:169701921-169701943 CACAGCACCCAGCTCCCAGGAGG + Intronic
1019290142 7:246248-246270 CTGGGCACCCAGCTGCCGACGGG - Intronic
1019304849 7:328476-328498 CAACCCACCCTGCTGCCACCCGG + Intergenic
1019398415 7:836088-836110 CACCTCCCCCAGCAGCCGACAGG - Intronic
1019610982 7:1936545-1936567 CACCAGACCCGGCTGCCCACAGG + Intronic
1019755453 7:2765445-2765467 CACCGCGCCCAGCCTACAACAGG + Intronic
1019788904 7:2997618-2997640 CACCCCACCCAGCAGCAACCAGG + Intronic
1019913302 7:4114822-4114844 TTCTGCACCCAGCTGCCAGCAGG + Intronic
1020200199 7:6073675-6073697 CACCGCGCCCAGCCACAAACAGG - Intergenic
1020653114 7:10898745-10898767 CACCACACCTAGCTGCTAATAGG - Intergenic
1020755797 7:12201753-12201775 CACCGCACCTGGCTGAGAACTGG - Intergenic
1021544230 7:21795232-21795254 CACCAAACCTAGCAGCCAACTGG - Intronic
1023221049 7:37920621-37920643 CACTGCTCACTGCTGCCAACAGG - Exonic
1023882480 7:44328123-44328145 CACCCTCCCCAGCTGCCACCTGG - Intronic
1023996916 7:45164258-45164280 CACCGCACCCAGCAGATAATTGG - Intronic
1024366805 7:48529492-48529514 CCCAGCACCCACCAGCCAACAGG + Intronic
1024776834 7:52797769-52797791 CACCACACCCAGCAGCCATTTGG - Intergenic
1027758599 7:82248827-82248849 CACCGCGCCCAGCTGCAAGAGGG - Intronic
1027890372 7:83965965-83965987 CACCGCGCCCAGCCACCAATGGG + Intronic
1028094120 7:86739263-86739285 CACCGCTCCCAGCCTACAACAGG + Intronic
1029709049 7:102289682-102289704 CATCCCACCCAGCTGCCTTCTGG - Intronic
1030209721 7:106984381-106984403 CACCGCACCCGGCTGGCATCAGG - Intergenic
1030870640 7:114751402-114751424 CACCGCTCCCAGCTGACAATTGG + Intergenic
1031160810 7:118165604-118165626 CACCGCACCCAGCTGTATTCTGG + Intergenic
1032422770 7:131796179-131796201 CACTGCACCCAGCTTCCATCAGG + Intergenic
1032549747 7:132773080-132773102 CACCGTGCCCAGATGGCAACAGG + Intergenic
1033218879 7:139514549-139514571 CACCGCACCCAGCCTCCACCTGG + Intergenic
1034411102 7:150942618-150942640 CAGAGCACCCAGCTGCATACCGG + Intergenic
1034430361 7:151038232-151038254 CACCGCACCCAGCCGCCACTGGG - Intronic
1035112786 7:156497338-156497360 CTCAGCACCCAGCTGCCTCCTGG - Intergenic
1035292720 7:157849904-157849926 CACGGGCCCCAGCTGCCATCAGG - Intronic
1038168988 8:25111459-25111481 CCCCGTGCCCAGCTGCCTACTGG + Intergenic
1038259967 8:25984391-25984413 CACCGCGCCCAGCCGCGAATGGG - Intronic
1039049243 8:33478163-33478185 AAGGGCACTCAGCTGCCAACAGG + Intronic
1039732283 8:40293005-40293027 CACCGCACCCTGCCGACAAAAGG + Intergenic
1040406375 8:47107670-47107692 CACCGCACCCGGCTGACAGCAGG + Intergenic
1041344870 8:56886866-56886888 CACCACATCCAGTTGCCAAAGGG + Intergenic
1041373976 8:57193552-57193574 CACCTCAACCAGCTGCCCCCTGG - Intergenic
1041766988 8:61429131-61429153 CACCGCACCCAGCTGCAGGCAGG - Intronic
1042970791 8:74406886-74406908 AACTGCACTCAGCTACCAACAGG - Intronic
1043340471 8:79231377-79231399 CACTGCACCCAGCTGCAAGATGG + Intergenic
1046699382 8:117383045-117383067 CACCGCGCCCAGCCGACAATGGG + Intergenic
1047221666 8:122923634-122923656 CACCACACCCACCTGCCTGCTGG + Intronic
1047737129 8:127775838-127775860 CACAGCTCCCAGCTGACAGCTGG - Intergenic
1048209682 8:132444277-132444299 CTCCTCACCCAGCCACCAACTGG + Intronic
1049543406 8:143218602-143218624 AACCGCACCCAGCTTCCCAGAGG + Intergenic
1049974683 9:850105-850127 CACCACGCCCAGCTGACAATAGG + Intronic
1051512333 9:17891871-17891893 CACCACACCCGGCTGCCAACTGG + Intergenic
1055395919 9:75874973-75874995 CACCGCACCCAGCCGCAAAATGG + Intergenic
1056645934 9:88411883-88411905 CACCGCACCCGGCCTCAAACGGG - Intronic
1058893428 9:109380542-109380564 CACCGTGCCCAGCTTCCAGCTGG + Intronic
1059145176 9:111893505-111893527 CACCGCGCCCAGCCGCAAACTGG + Intergenic
1059227227 9:112683176-112683198 CACCGCACCTGGCTGGCCACAGG - Intergenic
1059445838 9:114337258-114337280 CAGCCCAACCAGCTGCCAAGTGG - Exonic
1060222948 9:121774017-121774039 CACCACACTCTGCTGCCAAGAGG - Intronic
1060434498 9:123581943-123581965 TACCTCACACAGCTGCCTACAGG + Intronic
1060613985 9:124994321-124994343 CACTGCACCCAGCTGACCACTGG + Intronic
1060911535 9:127355079-127355101 CACCGCACCCAGCTGGGAATAGG + Intronic
1061034155 9:128104171-128104193 CACCTGACCCAGATGCCAATGGG + Intronic
1061354500 9:130094154-130094176 CACCGCGCCCAGCCCACAACTGG - Intronic
1061374873 9:130217858-130217880 TGCCGCATCCAGCTGCCCACTGG - Exonic
1061462651 9:130752668-130752690 CACTGCACCCAGCCACCAAGGGG - Intronic
1062269864 9:135703468-135703490 CACAGCACCCACCTGGCACCCGG + Intronic
1062542332 9:137047096-137047118 CACTGTGCCCAGCTGACAACGGG + Intergenic
1185453236 X:294046-294068 CACCGCACCTGGCTGACACCAGG - Intronic
1186482545 X:9907076-9907098 CACCGGACCCAGCAGCCACAGGG + Intronic
1187556385 X:20356357-20356379 CACCGCGCCCGGCTACCAATGGG - Intergenic
1189469009 X:41299753-41299775 CACCGCGCCCAGCTGCCTGCAGG + Intergenic
1191053119 X:56215532-56215554 CACCGCACCCAGCCAGCAATTGG - Intergenic
1191122796 X:56923591-56923613 CACCACACCCATCTTACAACAGG - Intergenic
1193514036 X:82441360-82441382 CACTGCACCCAGCTGACAATAGG - Intergenic
1195280274 X:103326670-103326692 CACCGCACCCAGCCACATACAGG - Intergenic
1198183334 X:134231075-134231097 CACCGCACCCGGCCCCCATCAGG + Intergenic
1201682772 Y:16667121-16667143 CACCGCACACAGCCCCCAAGAGG + Intergenic
1202244399 Y:22803947-22803969 CACCACACCCAGCTGTCATAAGG + Intergenic
1202397387 Y:24437693-24437715 CACCACACCCAGCTGTCATAAGG + Intergenic
1202473394 Y:25232395-25232417 CACCACACCCAGCTGTCATAAGG - Intergenic