ID: 1144684217

View in Genome Browser
Species Human (GRCh38)
Location 17:17215579-17215601
Sequence CTGGCTAAGCAGCCCTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144684217 Original CRISPR CTGGCTAAGCAGCCCTATGA GGG Intronic
900467142 1:2831310-2831332 CTGGCAAAGCAGCCCCGTGAGGG - Intergenic
902737512 1:18410909-18410931 CTGGCTCTGCAGCCCTAGGAAGG + Intergenic
906933950 1:50195618-50195640 CTGGCCATTCAGCCCTTTGATGG - Exonic
907542759 1:55231232-55231254 CTTACTAAGCATCCCTATGAAGG + Intergenic
909113847 1:71509849-71509871 CTGGCTAGCCACCCCTTTGAGGG - Intronic
911062301 1:93758910-93758932 CTGGCCAACCAGCCCCCTGATGG - Intronic
912461186 1:109832639-109832661 CTGGTTATGTAGCCCTATGGTGG + Intergenic
917278942 1:173360930-173360952 ATGCCTGAACAGCCCTATGATGG + Intergenic
917671015 1:177273590-177273612 CTTGGTAAGCAGCACTATGATGG + Exonic
920379808 1:205528930-205528952 CTGGTGGAGCAGCCCTAGGAAGG + Intronic
1074788484 10:116863214-116863236 CTGGCAGAGCAGCCCTCTTAGGG + Intronic
1078094734 11:8289766-8289788 CTGGCTGAGCAGCCCTCTTGGGG + Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1080334092 11:31175565-31175587 CTGGCTGAGCAGCCCTGTGGTGG - Intronic
1080354297 11:31423614-31423636 CTGGCAAAACTACCCTATGATGG - Intronic
1081771079 11:45650933-45650955 TTGGAGAAGCAGCCCCATGAAGG - Exonic
1083697359 11:64451834-64451856 GTTGCTGAGCAGCCCTGTGAGGG + Intergenic
1086161410 11:83726011-83726033 CAGGCTAAAAAACCCTATGAGGG + Intronic
1093305943 12:17518695-17518717 CTGGCAAAGCAGACCTAGCAAGG + Intergenic
1097352605 12:58564927-58564949 CTGTCCTAGCAGCCCTCTGAGGG + Intronic
1104774233 12:131382668-131382690 GTGGCTCAGCAGCCCCAGGAGGG - Intergenic
1104774268 12:131382780-131382802 GTGGCTCAGCAGCCCCAGGAGGG - Intergenic
1104774399 12:131383231-131383253 GTGGCTCAGCAGCCCCAGGAGGG - Intergenic
1104774444 12:131383399-131383421 GTGGCTCAGCAGCCCCAGGAGGG - Intergenic
1106457307 13:29938442-29938464 CTGGCTGAGCATCTCCATGAGGG - Intergenic
1107886930 13:44881433-44881455 CTTGCTAAGCAGGCCTTTTATGG - Intergenic
1108339233 13:49480686-49480708 TTCACAAAGCAGCCCTATGAGGG + Intronic
1110376076 13:74795047-74795069 CAGGCAAAGCAGCCCTATGTGGG + Intergenic
1111200986 13:84936864-84936886 TTGGCTAAACAGCCCTAAGAAGG - Intergenic
1113840564 13:113357691-113357713 CTGGTCAAGCTGCCCTCTGAGGG - Intronic
1129937493 15:79463103-79463125 CTGCCCAAGCAGCCCAAAGATGG + Exonic
1132091117 15:98948608-98948630 CTGGCCGAGCAGCCCTACCAGGG + Exonic
1140452531 16:75082259-75082281 CTTCCTAAGCAGCCCTTTGAGGG + Intronic
1141895632 16:86957145-86957167 CTGGCTGAGCTGCCCTCTGAGGG - Intergenic
1141903997 16:87010877-87010899 CTTGCTCAGCAGCCCTAGGTGGG - Intergenic
1144684217 17:17215579-17215601 CTGGCTAAGCAGCCCTATGAGGG + Intronic
1146450932 17:32973323-32973345 CTGGCTAGCCACCCCTTTGAGGG - Intronic
1148545346 17:48514498-48514520 CTGGCTCTGCAGTCCAATGATGG + Intergenic
1150484427 17:65533814-65533836 CTGGCTGAGCAGACCTAGGTGGG - Intronic
1156939056 18:42742721-42742743 CAGGTGAAGCAGCCCTAAGAAGG + Intergenic
1157317850 18:46608311-46608333 CTTGCCAAGCTGCCCTTTGAGGG + Intronic
1157373889 18:47144931-47144953 CTGCATAAGCAGCCCTATAAGGG + Intronic
1157471438 18:47991952-47991974 CTGGGTAAGCAGCCATGTGTTGG - Intergenic
1163038784 19:14587524-14587546 CTGCCTCAGCTGCCCCATGATGG - Intronic
1163039530 19:14592191-14592213 CTGCCTCAGCTGCCCCATGATGG - Intronic
1165097503 19:33417585-33417607 CTGGCATAGCAGCCCTGGGAGGG - Intronic
1166386122 19:42382380-42382402 CTGGCTTATCAGCTCCATGAGGG - Intergenic
1166852225 19:45766440-45766462 CGGGCCAGGCAGCCCTGTGAAGG - Exonic
925548977 2:5049692-5049714 CTGGCTAAAAAGCCCTAACAAGG - Intergenic
933475096 2:82779485-82779507 CTGGCTAGCCACCCCTTTGAAGG - Intergenic
938592142 2:132749754-132749776 GTGGCTAAGCAGACATTTGAAGG - Intronic
940427138 2:153542678-153542700 CTGGCTAAACAACCCTATCAAGG + Intergenic
1170607996 20:17888090-17888112 CTGCTTAAGCAGCCCTGTGCAGG + Intergenic
1173917825 20:46722500-46722522 CTGGATAAGCATCTTTATGAAGG + Intronic
1180181628 21:46120832-46120854 CTGCCTAAGCACCCCTATCTTGG - Intronic
1184632105 22:45789786-45789808 TTGGCAAAGCAGCCTCATGAAGG - Intronic
949554549 3:5141816-5141838 CTGGCTAGCCATCCCTTTGAGGG + Intronic
954917831 3:54163973-54163995 CGGGCTAAGCAGCCCACTGCAGG + Intronic
960611968 3:119562863-119562885 CTAGATCAGCTGCCCTATGATGG - Intergenic
976078724 4:81329987-81330009 CTGTCTAAGCAACCTTCTGATGG - Intergenic
982400375 4:154960219-154960241 CTGGCTCAGTAGGCCTAAGATGG + Intergenic
984024491 4:174526568-174526590 CTGGGTAAGCAGCCCTTTTTTGG + Intergenic
985494087 5:194857-194879 CTGGCTGAGCAGCCTGAAGAAGG - Exonic
992634669 5:78716074-78716096 CTGTCTGAGCAGCACCATGATGG - Intronic
992878801 5:81084642-81084664 ATTGGTAAGCAGCCCAATGAAGG + Intronic
997625812 5:135329888-135329910 CTGGCAAGGAAGCCCTCTGATGG - Intronic
998139316 5:139690856-139690878 CTGGCTCAGCAGCCCTGCAATGG + Intergenic
1004881902 6:20017089-20017111 TTCTCTAAGCAGCCCTCTGAGGG + Intergenic
1011520426 6:88198286-88198308 TTGGCTGAGCAGGGCTATGAAGG + Intergenic
1011797726 6:90975768-90975790 CTGGCTTAGCACCCATATGCTGG + Intergenic
1012247381 6:96940623-96940645 CTGCTTAAGCAGCCCCAAGAAGG + Intronic
1016939624 6:149473514-149473536 TTGGCTAAGCTCCCCTGTGACGG - Intronic
1019885341 7:3899623-3899645 CTGGCTGAGCAGGCCTGGGAGGG - Intronic
1021522019 7:21548303-21548325 CTGGCTAGCCACCCCTTTGAGGG + Intronic
1045654688 8:104374804-104374826 TTGTCTCTGCAGCCCTATGAGGG - Intronic
1047693966 8:127384706-127384728 CTGGCTGGGCTGCCCTACGATGG + Intergenic
1048003374 8:130397880-130397902 CTAGATAAGAAGCCCCATGAGGG + Intronic
1051613612 9:18985591-18985613 CTGGCAAAGCTGCCCAAGGATGG + Intronic
1056451328 9:86719825-86719847 CTGGGGCTGCAGCCCTATGAAGG + Intergenic
1060035589 9:120252837-120252859 GTGGCTGAGCAGCCCAAAGAGGG + Intergenic
1060443866 9:123669553-123669575 CTGCCTGAGCAGCCATTTGAAGG + Intronic
1188063923 X:25633897-25633919 CTGGCTCAGCAGCCCACTGCAGG + Intergenic
1190478383 X:50850432-50850454 CTGGCTCTGTAGCCCTATGGTGG - Intergenic
1194782267 X:98038788-98038810 ATTGCTAATCAGCCCTAAGAGGG - Intergenic
1199851836 X:151729348-151729370 TTGGCAAAGCAGCCCAATCATGG + Intergenic