ID: 1144684385

View in Genome Browser
Species Human (GRCh38)
Location 17:17216357-17216379
Sequence GTGCGTGCCCCCGCGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 136}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144684385_1144684393 -2 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684393 17:17216378-17216400 ACCTGAGGAGAGCACGTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 171
1144684385_1144684397 14 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684397 17:17216394-17216416 TGGGGGGGGATCTGCACGTGCGG 0: 1
1: 0
2: 0
3: 20
4: 220
1144684385_1144684392 -3 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684392 17:17216377-17216399 CACCTGAGGAGAGCACGTGGGGG 0: 1
1: 0
2: 2
3: 16
4: 176
1144684385_1144684399 27 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684399 17:17216407-17216429 GCACGTGCGGGCTGAGCCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 165
1144684385_1144684390 -5 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684390 17:17216375-17216397 CGCACCTGAGGAGAGCACGTGGG 0: 1
1: 0
2: 0
3: 0
4: 58
1144684385_1144684391 -4 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684391 17:17216376-17216398 GCACCTGAGGAGAGCACGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1144684385_1144684396 0 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684396 17:17216380-17216402 CTGAGGAGAGCACGTGGGGGGGG 0: 1
1: 0
2: 1
3: 38
4: 336
1144684385_1144684395 -1 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684395 17:17216379-17216401 CCTGAGGAGAGCACGTGGGGGGG 0: 1
1: 0
2: 3
3: 23
4: 235
1144684385_1144684389 -6 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684389 17:17216374-17216396 ACGCACCTGAGGAGAGCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1144684385_1144684398 15 Left 1144684385 17:17216357-17216379 CCACAGCCCGCGGGGGCACGCAC 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1144684398 17:17216395-17216417 GGGGGGGGATCTGCACGTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144684385 Original CRISPR GTGCGTGCCCCCGCGGGCTG TGG (reversed) Intronic
900178658 1:1301965-1301987 GTGAGTGGCCCCCAGGGCTGGGG - Intronic
900478710 1:2888098-2888120 GTGCGTGCACACGTGGGATGGGG - Intergenic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
903190184 1:21651936-21651958 GTCCGCGCCCCAGCGGGCCGCGG + Intronic
903614787 1:24643655-24643677 GTGCGTGCCGCCGGGTCCTGGGG + Intronic
905770622 1:40635893-40635915 GTGCGTGCAGCCCCGTGCTGTGG - Intronic
906248324 1:44292685-44292707 GTGCATTCCCCCCAGGGCTGTGG - Intronic
912360430 1:109090584-109090606 CTGCGTGCCCCTGCGGGCGTAGG - Exonic
915436595 1:155911293-155911315 GTGCGTGACCCGACCGGCTGTGG - Intronic
918041287 1:180915652-180915674 GTTCGTGGCCCCGGGGGTTGGGG - Intronic
919991374 1:202710224-202710246 GTCCGTGCCCCCACCGGCGGGGG + Intronic
1063077751 10:2733373-2733395 GTGCCAGCCCCAGCGGGATGGGG + Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1073216521 10:101839795-101839817 CTGCCTGCCCCAGCGGGCTCCGG + Intronic
1076146473 10:128126237-128126259 GAACGCGACCCCGCGGGCTGCGG - Exonic
1077501769 11:2912621-2912643 GTGCCCGCCCCCGCAGCCTGTGG - Intronic
1080445620 11:32334739-32334761 GGGGGTGCCCCCGCTGGCAGAGG - Intergenic
1081597031 11:44466567-44466589 GTGCGTGCCCCCGAGGGTGATGG + Intergenic
1081998259 11:47378111-47378133 GAGCATGCCCTGGCGGGCTGAGG - Intronic
1083027978 11:59566271-59566293 GTGGGTTCTCACGCGGGCTGGGG - Intergenic
1083749922 11:64755250-64755272 GTGCGTCACCCCCTGGGCTGGGG - Intronic
1091604280 12:1936861-1936883 GTGCGTGGCCGCGCAGGCTGGGG - Intergenic
1092116725 12:6014178-6014200 CTGCATGCTCCCGGGGGCTGGGG + Intronic
1093681498 12:22008364-22008386 CTGCGTGCCTCCGCATGCTGGGG + Intergenic
1094840864 12:34342198-34342220 GTGCGGCCCCCCGCGGGGTCAGG - Intergenic
1094851920 12:34386128-34386150 GGGCTGGCCCCCGTGGGCTGAGG + Intergenic
1102289286 12:111685810-111685832 GCGCGGGCCCCGGCGGGCTCAGG + Exonic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1108648377 13:52452092-52452114 CTGCGTGCCCACGTGGGCAGAGG + Intergenic
1113820324 13:113208873-113208895 GTTCGGGCCCGCCCGGGCTGAGG + Intronic
1120941717 14:89956003-89956025 GTGCGGTCTCTCGCGGGCTGCGG + Intronic
1121283414 14:92715648-92715670 GTGCTTACCCCCACTGGCTGTGG - Intronic
1121635574 14:95451834-95451856 GTGCCTGAGCCCGGGGGCTGAGG + Intronic
1122317607 14:100835264-100835286 GTGTGTGCCCCCCCGGGCTTTGG + Intergenic
1122486614 14:102086636-102086658 GTGCCCTCCCGCGCGGGCTGCGG + Intronic
1122772793 14:104104736-104104758 GTGCGGGCGCTCTCGGGCTGTGG + Intronic
1131248836 15:90817962-90817984 GTGCCTGCCTCCCAGGGCTGCGG - Intergenic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1132642121 16:982686-982708 GGGCGTGCCTCCCGGGGCTGGGG - Intronic
1133032521 16:3018049-3018071 GTGCGTGCGAACTCGGGCTGCGG - Intronic
1134070036 16:11255317-11255339 GTGCGTGTCGCCGGGGGCCGGGG + Exonic
1134438871 16:14285751-14285773 GGGCGCGCCCCGGCGGGCTCGGG - Intergenic
1136479574 16:30533205-30533227 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1136483351 16:30556164-30556186 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1139404412 16:66706781-66706803 GTGCCTGGCCCCGGGGGGTGGGG - Intergenic
1143401964 17:6651918-6651940 CTGCTTGGCCCCTCGGGCTGAGG - Exonic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1148788824 17:50161552-50161574 GAGCGCGCCGCCCCGGGCTGGGG - Intergenic
1149270235 17:54969105-54969127 GTGGGTGCCCATGAGGGCTGCGG - Intronic
1149486468 17:57046441-57046463 GTGCCGGCCCACGCGGGCTCAGG - Intergenic
1149515848 17:57280330-57280352 GTGGGTACCCCAGGGGGCTGTGG + Intronic
1149993825 17:61396878-61396900 TTGCGTGACCCCGCGGGCAGTGG - Intergenic
1151559218 17:74861731-74861753 GGGCGGGCCCTCGCGGGCGGCGG - Intergenic
1152274784 17:79349857-79349879 GTGCCTGCCCCGGGGGGCTCAGG - Intronic
1152627567 17:81394874-81394896 GTGCGTGCATCCGCGAGCTCGGG + Intergenic
1152870909 17:82752496-82752518 GTGCGCGGTCCCGCGGGCCGTGG + Intronic
1156502358 18:37567572-37567594 GCCCGCTCCCCCGCGGGCTGCGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1160419578 18:78734995-78735017 GTGAGTGCCCCCGAAGTCTGTGG - Intergenic
1160527764 18:79547527-79547549 GTGCCTCCCCCGGGGGGCTGCGG + Intergenic
1160730261 19:638883-638905 GTGGGTGCCACCTGGGGCTGTGG + Intergenic
1160853607 19:1206198-1206220 GTGCGGGCCCTCGCGGGCGCCGG + Intronic
1160904320 19:1445387-1445409 GTGGGAGCCACCGCGGGCTGTGG - Intergenic
1160941384 19:1621890-1621912 GTACGTGGCTCCGGGGGCTGAGG + Exonic
1160991941 19:1863676-1863698 GTGGCCGCCCCCGCGGGCTCCGG - Intergenic
1163712490 19:18855050-18855072 GGGCGAGGCCCCGCGCGCTGAGG - Intronic
1165354141 19:35293471-35293493 GTGCCTGCCCCTTCTGGCTGGGG + Intronic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
1168315320 19:55482438-55482460 GCGCCCGCCCCCGCAGGCTGAGG + Exonic
933684650 2:85133534-85133556 GGGCGTGGCCCCGCGGGAAGCGG - Exonic
934681221 2:96285280-96285302 GTGGGGGCCCCCACGGGCAGCGG - Exonic
937320008 2:120955435-120955457 GTGCTGGCCCCCAGGGGCTGAGG + Intronic
940775060 2:157876229-157876251 GGGCTTGCCCCCGGGGGCGGCGG + Intergenic
1171337159 20:24394973-24394995 GTTTGTGCCCCCAAGGGCTGGGG - Intergenic
1172409045 20:34709085-34709107 GTGGGTGCCCCGGGGCGCTGCGG + Intronic
1173172463 20:40738427-40738449 GTGCATGCCCCAGGAGGCTGAGG + Intergenic
1173854515 20:46241438-46241460 GGGAGGGCCCCAGCGGGCTGAGG - Intronic
1173874039 20:46358532-46358554 GTGCCTGCCCCCGCTGACTCAGG - Exonic
1176284726 21:5013329-5013351 GGTCGGGCCCCCGCTGGCTGTGG - Intergenic
1176372258 21:6069102-6069124 TTGCGTGTCCCCGCGGGCCAGGG + Intergenic
1179717523 21:43297534-43297556 GTGGGTGCCCCCACTAGCTGGGG - Intergenic
1179751261 21:43469437-43469459 TTGCGTGTCCCCGCGGGCCAGGG - Intergenic
1179872455 21:44250146-44250168 GGTCGGGCCCCCGCTGGCTGTGG + Intronic
1180190696 21:46161203-46161225 GTGCGGGCAGCGGCGGGCTGCGG + Exonic
1180568146 22:16692668-16692690 CTGCATGCTCCCGGGGGCTGGGG + Intergenic
1180950577 22:19718847-19718869 GTCTGTGACCCCGCGGGCTCCGG + Intronic
1181236203 22:21448962-21448984 GTGCATGGCCTCCCGGGCTGTGG + Exonic
1183489679 22:38109699-38109721 GTGTGGGCCTCCTCGGGCTGGGG + Intronic
1183613545 22:38927385-38927407 CTGCGTCCCCTGGCGGGCTGCGG + Intergenic
952902937 3:38121627-38121649 GGTGGTGCCCCTGCGGGCTGTGG + Exonic
967290749 3:187917446-187917468 ATGCCTGCCCCAGCCGGCTGGGG - Intergenic
968434149 4:576317-576339 GGGAGGGGCCCCGCGGGCTGGGG - Intergenic
968657459 4:1784887-1784909 GTGGGTGCCCCCCTGGGATGTGG + Intergenic
970195635 4:13547773-13547795 CTGCGCGCCCCCGAGGGCCGGGG - Intergenic
979281973 4:118878839-118878861 GTGGGTGCCTCTGCTGGCTGGGG - Intronic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
990919195 5:60944688-60944710 GGGGGTTCCCCCGCGGGCTCAGG - Intronic
997963358 5:138338628-138338650 CTGCCTGTCCCCGCGGGGTGGGG - Intronic
999300265 5:150486311-150486333 GTGCGTGCGCCTCCGGGCTCCGG - Intronic
1001293504 5:170483113-170483135 GTGTGTGCACCTGCAGGCTGTGG + Intronic
1002754698 6:148157-148179 GTGCGTGCCCGCGCCGGCGCGGG - Intergenic
1004044475 6:12011847-12011869 GGGCGTCCCCGCGGGGGCTGGGG - Intronic
1004323981 6:14656810-14656832 GTGCTTGCCCCTGAGGGGTGCGG - Intergenic
1006155047 6:32009370-32009392 GCGCGTGGACCTGCGGGCTGGGG - Intergenic
1006161358 6:32042105-32042127 GCGCGTGGACCTGCGGGCTGGGG - Exonic
1006932592 6:37697001-37697023 CTGCGTCCCCACGCGGGCAGCGG - Exonic
1009946618 6:70347983-70348005 GTGGGTGCCGCTGCTGGCTGGGG - Intergenic
1016714203 6:147204492-147204514 GTGCCTCCCCTCCCGGGCTGCGG + Intronic
1019431142 7:1000386-1000408 GCACGTCCCCCCGGGGGCTGAGG - Intronic
1019491237 7:1314546-1314568 ATTCCTGCCCCCGCAGGCTGGGG - Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1022722939 7:32957314-32957336 GTGCGTGCCGCAGCGGGGAGGGG - Intergenic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1031966581 7:128031749-128031771 TTGCGCGCCGCCGGGGGCTGCGG - Intronic
1033662003 7:143408732-143408754 GCGCGCGCCCCCGGGGGCAGCGG + Exonic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1035740598 8:1925422-1925444 GTGCGTCCCACCCCGGGCCGCGG - Intronic
1037902479 8:22695705-22695727 GCGCGTGCACCCGGAGGCTGCGG + Intergenic
1038507330 8:28095887-28095909 GTCCGTGGCCCAGGGGGCTGAGG - Intronic
1038689040 8:29744424-29744446 CTGCGTGCCCCCGACAGCTGGGG - Intergenic
1039477830 8:37849959-37849981 GTCTGTGCCTCCGCGGGCTCGGG + Intergenic
1049096114 8:140549085-140549107 GTGGGCGCTCCCGCTGGCTGTGG - Intronic
1049716295 8:144094731-144094753 GAGGGTGCCCCTGCAGGCTGAGG - Intergenic
1049808392 8:144551779-144551801 GTGCTTGCTCCCGGGGGCCGGGG - Intronic
1051482880 9:17578852-17578874 GTTCCTGCCCCCGGGGGCTGCGG - Intergenic
1057488568 9:95505911-95505933 GTGCGCGCCCCCGGCGGCCGCGG - Intronic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059428778 9:114237579-114237601 CTGCGTTCCCCCGCTGGTTGTGG - Intronic
1061348096 9:130042887-130042909 CTGCGTTTCCCCGCGGCCTGGGG - Intronic
1062410844 9:136423529-136423551 GTGCTTCCCTCCTCGGGCTGTGG + Exonic
1062517649 9:136944337-136944359 GTCCGGGCCCTGGCGGGCTGAGG - Intronic
1062537678 9:137028029-137028051 GTGCGCGCGGCCTCGGGCTGAGG + Intronic
1062556248 9:137114560-137114582 GTCCGGGGCCCTGCGGGCTGTGG + Exonic
1203792180 EBV:157596-157618 GGGGGTGCTCCCGCGGGCCGCGG + Intergenic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1189473906 X:41334536-41334558 GTGCGTGCGCAGGCGGGCGGAGG + Intronic
1192425140 X:71068408-71068430 GTGCGCGCCGCCGCCGCCTGTGG - Intronic