ID: 1144685440

View in Genome Browser
Species Human (GRCh38)
Location 17:17223059-17223081
Sequence CTGTGCTTCTGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 2, 2: 3, 3: 47, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144685434_1144685440 -10 Left 1144685434 17:17223046-17223068 CCCTCAGCACCATCTGTGCTTCT 0: 1
1: 0
2: 1
3: 53
4: 460
Right 1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG 0: 1
1: 2
2: 3
3: 47
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144685440 Original CRISPR CTGTGCTTCTGGAGGGCAGA AGG Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
900791116 1:4681505-4681527 CTGGGCTTCTGGCCTGCAGAAGG + Intronic
900919604 1:5662107-5662129 CTGAGCTTCTGGTGGGGTGAGGG - Intergenic
901931873 1:12601176-12601198 GTCGGCTTCTGCAGGGCAGATGG - Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904399779 1:30248441-30248463 CTTTGCTACGGGAGAGCAGAGGG - Intergenic
904764400 1:32832524-32832546 CTGGGTTCCTGGAAGGCAGAAGG - Intronic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
907372636 1:54013324-54013346 CTGTGTTCCTGCAGGGCAGGGGG + Intronic
907660260 1:56385414-56385436 ATGTGCTTCTGACTGGCAGAGGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908692909 1:66802913-66802935 CTGTTCTTCTGTAGGGAAGCTGG + Intergenic
912457479 1:109807550-109807572 CTGTGCTCCTGCAGGGTGGAAGG + Intergenic
912562459 1:110560589-110560611 GTGGGCTTCTGGAGGGCGCATGG + Intergenic
912774040 1:112492559-112492581 CTGTGCTTCTGGCTGGGGGAAGG + Intronic
913036894 1:114976558-114976580 CTTGGCTTCTAGAGGACAGACGG - Intronic
913662509 1:121016788-121016810 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914013887 1:143799984-143800006 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914163936 1:145161213-145161235 GTGTAATTCTGCAGGGCAGAAGG - Intergenic
914652510 1:149708603-149708625 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
915008950 1:152666722-152666744 CTGTGCTTCAGGTAGGAAGAAGG + Intergenic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
915548681 1:156619047-156619069 CTGGGCTCCATGAGGGCAGAGGG - Intergenic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
916056789 1:161073630-161073652 CTGTGCTCCTGGTCTGCAGAGGG + Intronic
917741414 1:177964941-177964963 ATGGGCTTCTGGAGGTGAGATGG + Intronic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918093516 1:181316889-181316911 CTGAGCTCCTGGAGGACAGGAGG + Intergenic
918124665 1:181572487-181572509 CTGTGCTGGTGGTGGTCAGAGGG + Intronic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919866941 1:201789631-201789653 TTGTGATTCTGGAGGGCATCTGG - Intronic
919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG + Intronic
921055377 1:211538830-211538852 CGGGGCTTCTCGAGAGCAGATGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921485759 1:215713512-215713534 CTCTGCTTCAGGAGGTCACATGG - Intronic
922332820 1:224592679-224592701 CTATGCTTTAGAAGGGCAGAGGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924301317 1:242641106-242641128 ATATGCCACTGGAGGGCAGAAGG - Intergenic
1062791211 10:307781-307803 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062791231 10:307839-307861 CAGTCCATCTGGAGGGCAGCAGG + Intronic
1062791252 10:307897-307919 CGGTCCCTCTGGAGGGCAGCAGG + Intronic
1062791274 10:307955-307977 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062791314 10:308071-308093 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062923879 10:1299826-1299848 CTGTGCTTCCGGAGGCCATGCGG + Intronic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1064060540 10:12132731-12132753 TTGTGCTTCCTGAGTGCAGAAGG + Intronic
1064254424 10:13732039-13732061 CTGTGCTTCTGAAGGCCAGGAGG + Intronic
1065424921 10:25590757-25590779 ATGTGCTTATGTAGTGCAGAAGG + Intronic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1065755359 10:28925490-28925512 CTGAGCTTCTGAGGCGCAGAAGG + Intergenic
1066359869 10:34719681-34719703 ATGTCCTTTTGGAGGGGAGAAGG - Intronic
1066421886 10:35271455-35271477 CTGTGCTTCTGGCAGGGGGAAGG + Intronic
1067048877 10:43000809-43000831 GGGCGCTCCTGGAGGGCAGAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067183708 10:44009455-44009477 CTGTGCTTTCTAAGGGCAGAAGG - Intergenic
1067774789 10:49155320-49155342 CTGGCCTTCTGGAGGGGAAATGG - Intronic
1067776469 10:49168051-49168073 CTGTGCTCCTGGTGGGTACATGG - Intronic
1068170895 10:53393224-53393246 CTCTGCTTCTTGAGGAGAGAGGG + Intergenic
1069774625 10:70919252-70919274 CTGGGCCTCCGGGGGGCAGAGGG + Intergenic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074890065 10:117728327-117728349 CTTTGCTTCTGGAGGTTAGCTGG + Intergenic
1075124482 10:119688655-119688677 TTTTGCTTCTGGAAGGCAGTTGG - Intergenic
1075837693 10:125469732-125469754 ATGTGCTACTGGAGTCCAGAGGG - Intergenic
1076002695 10:126924637-126924659 CTGTTCTTCTGGAGGCAACACGG - Intronic
1076306535 10:129469124-129469146 CTGTCCTTTTGCAGGGAAGAAGG + Intronic
1076700524 10:132270471-132270493 CGGCACTTCTGGAGGGCAGGTGG + Intronic
1077136727 11:1003258-1003280 CTGTGCTGCTGGTGGGTGGATGG + Intronic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1078581591 11:12543273-12543295 CTGAGCTTCAGGAGCTCAGAAGG - Intergenic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1080249700 11:30219170-30219192 GTGTGCTGCTGGAGGTAAGAAGG - Intergenic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1080793100 11:35538674-35538696 CTGTGACTCTTGAGGGCACAAGG - Intergenic
1081705250 11:45179124-45179146 TGGGGCTTGTGGAGGGCAGAGGG + Intronic
1082591012 11:55009676-55009698 CTGTGTTTCTGGACTGCTGAAGG + Intergenic
1083184824 11:61011395-61011417 GTGAGCTGCTGGAGGGCAGAAGG + Intronic
1083254080 11:61485732-61485754 CTGAGCCTCTGGAGGACACATGG + Intronic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083771816 11:64871764-64871786 CTTTGCACCTGGAGGGGAGAGGG + Intronic
1084337720 11:68470607-68470629 CTGTGCTGCTGGAGGGAGGTTGG + Intronic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1084959679 11:72709969-72709991 TGGTACTCCTGGAGGGCAGATGG + Exonic
1085414439 11:76310894-76310916 CTGTGCCTCTGAAGGGCACGGGG + Intergenic
1085646961 11:78230590-78230612 ATGTGCTCCTAGAAGGCAGAGGG + Intronic
1085792842 11:79510845-79510867 TTGTGCTTCTCAGGGGCAGAAGG + Intergenic
1086700994 11:89900325-89900347 CTAAGTTTCTGGACGGCAGAGGG + Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1086705173 11:89944202-89944224 CTAAGTTTCTGGACGGCAGAGGG - Intergenic
1087084159 11:94199565-94199587 CTGTGATTCAGAAAGGCAGATGG - Intergenic
1088755451 11:112881808-112881830 ATGGGCTTCAGAAGGGCAGAAGG + Intergenic
1088818033 11:113434691-113434713 CTGGGCTTCTGGAAGGCCCAGGG + Intronic
1088939454 11:114439015-114439037 GTGTGCTTTTGGGGGCCAGAAGG - Intronic
1088985875 11:114907806-114907828 CTCTGCTTCTGGGGGTTAGATGG + Intergenic
1089489629 11:118874133-118874155 CTGGGCATTTGGATGGCAGAGGG - Intergenic
1089519105 11:119052012-119052034 CTGAGCAGCTGGAGGGCTGAGGG - Intronic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1090453458 11:126826984-126827006 CTGGGATTATGGTGGGCAGAGGG + Intronic
1091771912 12:3157666-3157688 CTGTCCTGCTGGAGGTCACAAGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1091999307 12:5019475-5019497 GTGAGCCTCTGGAGGGCAGGGGG - Intergenic
1092121458 12:6046926-6046948 CTGTGCTTCAGGAGGGGTTATGG - Intronic
1092991687 12:13909089-13909111 ATGAGCTTGTGGAAGGCAGAAGG - Intronic
1096001971 12:48137707-48137729 CTGGGCTCCTGCAGGGCAGCAGG + Exonic
1096056242 12:48654844-48654866 ATGTGCTCCTGGAGGGGAGTGGG - Intronic
1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG + Intergenic
1096675601 12:53224139-53224161 CTGTGCTCATGGAAAGCAGAGGG - Intronic
1097288326 12:57894471-57894493 CTGTGCTTGTGAATGGCTGAGGG + Intergenic
1097882011 12:64694770-64694792 CTGTAGTTCTGGAAGGCTGAAGG - Exonic
1097889045 12:64759204-64759226 CTGGGCTGCAGGAGGGCAGGTGG + Exonic
1097893185 12:64799145-64799167 ATGTGCCTCTGGAGAGCTGATGG + Intronic
1100572324 12:95854414-95854436 CTGTGCTTCAGGAGAGGAGGAGG - Intergenic
1100841334 12:98614757-98614779 CTGTTCTTCTGGAAAGCATATGG + Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1101858455 12:108463388-108463410 TTGGGATTCTGGAGGGCAGGTGG - Intergenic
1101957353 12:109222989-109223011 CTGAGCACCTGGAGGGCAGGAGG - Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103917846 12:124385186-124385208 CTGTGCTTGTGGAGGAGGGAAGG + Intronic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1104666462 12:130650538-130650560 ATGTGCTGCTGGAGGGGACACGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105415001 13:20203680-20203702 TTTTGCTTCTGGAAGGCAGTTGG + Intergenic
1107846959 13:44524905-44524927 CTGTGCTTCTGGAAGGAGAAAGG + Intronic
1107980169 13:45727600-45727622 CTGTGCTTCTGGCAGGAGGAGGG - Intergenic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1108934298 13:55866919-55866941 AGGTGATTCTGGAGGTCAGAGGG - Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1111245705 13:85537123-85537145 CTGTGCCTTTGTATGGCAGAAGG + Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1113293431 13:108931296-108931318 CATTGCTATTGGAGGGCAGAAGG - Intronic
1113591727 13:111506237-111506259 CTTTGCATCTGGAGAGCTGAAGG + Intergenic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1116744833 14:48804792-48804814 CTGGGCTTCTGTGGAGCAGAGGG - Intergenic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117838266 14:59830120-59830142 GGGTGCTGCTGGTGGGCAGAGGG - Intronic
1117867528 14:60165221-60165243 CTGCGCTTCCTGAGGGCTGACGG - Exonic
1118331791 14:64821073-64821095 GTGTGATTCTGGCAGGCAGAAGG - Intronic
1119189405 14:72670203-72670225 CCGTGCTTCTGGAAGATAGAAGG - Exonic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119508243 14:75191221-75191243 CAGAGCTTTAGGAGGGCAGAAGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120475385 14:84980147-84980169 TTGAGATTTTGGAGGGCAGAAGG + Intergenic
1120999934 14:90444224-90444246 CTGTGCCTCTCCAGGGCAGGGGG + Intergenic
1121372188 14:93369731-93369753 TTGTGTTTCTGGCAGGCAGAGGG + Intronic
1122160642 14:99781611-99781633 CTGTGCTTCAGGAAGACTGATGG - Intronic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1122355472 14:101120670-101120692 TGGTGCTTCTGGTGGGCAGGTGG + Intergenic
1122891504 14:104734217-104734239 CTCTGCTCCTGCAGGGCAGGTGG - Intronic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1124650894 15:31473184-31473206 CTGTGCCTCAGGAAGCCAGAGGG - Intergenic
1127590028 15:60413388-60413410 CTGGGCTCCTGGGAGGCAGAAGG + Intergenic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128251851 15:66169332-66169354 CTGGGCTTTTGTTGGGCAGACGG - Intronic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1129248986 15:74297874-74297896 CTTAGCTTGGGGAGGGCAGAGGG - Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132472517 16:113627-113649 CAGTGCTTCTGGAGGCCAACAGG + Intronic
1132749753 16:1452096-1452118 CTGTGCTGCTGGAGCCCAGGAGG - Intronic
1132880178 16:2158668-2158690 CCCTGCTGCTGCAGGGCAGAAGG + Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1134905042 16:17972650-17972672 CCGTTCTTCTGGAGGCCGGATGG + Intergenic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1138098103 16:54229439-54229461 ATTTGCTTCTGGAGGACAGCAGG - Intergenic
1138145913 16:54611770-54611792 CTCTGCTTCTTGGGGGCAGTGGG + Intergenic
1138340267 16:56284624-56284646 GTGTGCTGCTGGGGGGCAGCTGG - Intronic
1139593062 16:67943840-67943862 CGGGGCTTATGCAGGGCAGAAGG + Exonic
1140270722 16:73464337-73464359 CGGCTCTTCTGGAGGGAAGATGG + Intergenic
1141017587 16:80465105-80465127 CTGAGCTTCTTGAGGGCATCTGG - Intergenic
1141480716 16:84304863-84304885 CTGGGCCACAGGAGGGCAGAGGG + Intronic
1141837440 16:86551618-86551640 ATTTGCTTCTGGATGACAGACGG - Intronic
1142194569 16:88733478-88733500 CTGGGCTTGGGGAGGGCAGTGGG + Intronic
1142348203 16:89567607-89567629 CTGTGCCTCTGAAGGGCGGACGG + Intergenic
1143042898 17:4052511-4052533 CTGTGATTCTGGAGTGAAAAAGG - Intronic
1143119853 17:4599863-4599885 GTGTGCTCCGGGAAGGCAGAAGG - Intronic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144519216 17:15943292-15943314 TTATGCCTGTGGAGGGCAGAGGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144876234 17:18398920-18398942 CTGGGCAGCTGGAGGGCAGGAGG - Intergenic
1145018101 17:19411900-19411922 CTGTGCTGCAGTTGGGCAGATGG - Intronic
1145155994 17:20545500-20545522 CTGGGCAGCTGGAGGGCAGGAGG + Intergenic
1145735989 17:27232021-27232043 CTGGGATACTGTAGGGCAGAAGG + Intergenic
1145810644 17:27761981-27762003 TTTTGCTTCTTGAGGACAGAGGG + Intronic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1146855767 17:36257506-36257528 CTGGGCAGCTGGAGGGCAGGAGG + Intronic
1146924518 17:36735044-36735066 CTGTTCTGCTGCAGGGAAGATGG - Intergenic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1148000838 17:44386042-44386064 CTGTGCCCCTGGAGGGCCGAGGG - Exonic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1149704944 17:58686485-58686507 ATTTGCATCTGGACGGCAGAGGG + Intronic
1149722057 17:58855145-58855167 CTGTGCTTCTGGAAGGGAAAGGG + Intronic
1150250965 17:63704298-63704320 CTGGGCTTCGGGAGAGCAGAGGG - Intronic
1150809366 17:68344663-68344685 CTTGGCTCCTGGAGGGGAGAAGG - Intronic
1151259743 17:72907156-72907178 CTGTCCTGCTGGAGAGCACAAGG + Intronic
1152342394 17:79732474-79732496 GCATGCTTCTGGAGGCCAGAAGG + Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1152713234 17:81885445-81885467 CGGGGCTTCTGGTGGGCAGCAGG - Intergenic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1152999338 18:439472-439494 CTCTGCTTCTGGAGACCATAAGG - Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154360146 18:13654090-13654112 CTGTGCCTCTGAAGGACAGGAGG + Intergenic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1156397287 18:36709573-36709595 CTGTCTTTCTACAGGGCAGAAGG - Intronic
1157175010 18:45443649-45443671 GTGATCTTCTGTAGGGCAGAGGG + Intronic
1157191506 18:45586027-45586049 CGGTGCCACAGGAGGGCAGAGGG - Intronic
1157446266 18:47748833-47748855 CTGTGATCCTGGAGGCCAGAGGG - Intergenic
1157528946 18:48406110-48406132 CTGTGCCTGTGTAGGGCTGAAGG - Intronic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158614581 18:58974806-58974828 GTGAGCTTGTGGAGGTCAGAGGG - Intronic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1159861109 18:73650803-73650825 CTAAGCTTCTTGAGGGCAGGTGG - Intergenic
1160218161 18:76952474-76952496 CTGTGCTTCTGGGAGGAAGCTGG + Intronic
1160915863 19:1496221-1496243 CTGTGCCCCTGGTGGGGAGAGGG - Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1162885265 19:13692373-13692395 CTGTGACTCAGGAGGGCAGGTGG + Intergenic
1165096093 19:33410664-33410686 CCATGCTGCTGGGGGGCAGAGGG + Intronic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1168056709 19:53868549-53868571 CCGTGCTTCCGAAGTGCAGAAGG + Intronic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925835565 2:7942819-7942841 CAGTGCTTCTGAATGGTAGAAGG + Intergenic
927129554 2:20046934-20046956 ATGTTCTCCTGGAGGGAAGAGGG - Intronic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
928273972 2:29881993-29882015 CTGAGCTGCTGAAGGGCTGAGGG - Intronic
929919147 2:46160301-46160323 CTGAGAATCTGGAAGGCAGAAGG - Intronic
931288151 2:60849798-60849820 ATGTCCTTGTGGAAGGCAGAGGG + Intergenic
931460602 2:62447262-62447284 CTCTGCATCAGGATGGCAGAAGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
931894830 2:66717117-66717139 CACTGCTTCTGGAGCACAGAAGG - Intergenic
932327118 2:70870708-70870730 CTGTGCTTCTGGAGAAGAGTTGG + Intergenic
932734834 2:74247300-74247322 CATTGCCTCTGGAAGGCAGAGGG + Exonic
933374979 2:81467459-81467481 CGGGGCGTCTGCAGGGCAGAGGG + Intergenic
933707456 2:85302638-85302660 CAGTGCTGCTGCAGGGCAGGCGG + Intronic
933810192 2:86028251-86028273 CTGTGCTGCTGGAAGGAAGCGGG - Intronic
934132082 2:88957874-88957896 ATGTGATTCTGGAAAGCAGAAGG + Intergenic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
935720136 2:105972720-105972742 CTGGGCTTCAGGAGGGGATAGGG - Intergenic
936010906 2:108924809-108924831 AGTGGCTTCTGGAGGGCAGAAGG - Intronic
936328270 2:111524063-111524085 GGGGGCTTCTGGAGGGGAGAAGG + Intergenic
936460549 2:112711184-112711206 CTGTGCTGCAGAAAGGCAGAAGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
938087786 2:128412586-128412608 CTGAGATTCTGCAGGGCAGGTGG + Intergenic
938257221 2:129868715-129868737 CTCTCCTTCTGGAGGGAGGATGG - Intergenic
938293556 2:130162953-130162975 CTGTCCCTGTGGAGGGCAGGAGG - Intronic
938462999 2:131510008-131510030 CTGTCCCTGTGGAGGGCAGGAGG + Intergenic
939349102 2:141009943-141009965 CTGTGTTTCTTGAGGGCCAATGG + Intronic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
939539114 2:143471898-143471920 CTTTGCTTCTGCAGGCCATAGGG - Intronic
939975081 2:148708166-148708188 CTGTACTTCCGTAGGGCAGGTGG - Intronic
940023861 2:149184391-149184413 CTGTCCTTCTGCAGGGCCCAGGG + Intronic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
940911855 2:159216395-159216417 CTGTTCCTCTGGAGGGAGGAAGG - Intronic
942190581 2:173465132-173465154 CTGTGCTGCTTGCGGGCAGCTGG + Intergenic
942756654 2:179349131-179349153 CTCTGCTTCTGGAGGGATGCTGG - Intergenic
942861018 2:180612205-180612227 ATGTGCTTCTGGAGGAGACAGGG + Intergenic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
946028752 2:216688929-216688951 ATGTGCTTCCAGAGGGCAGCTGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947746316 2:232509058-232509080 GTTTCTTTCTGGAGGGCAGAGGG - Intergenic
948117172 2:235502053-235502075 CTGTGCTTCTGAGGGGCTGAGGG + Intronic
948225996 2:236309832-236309854 CCGTGCTCCTGGAGGACGGAGGG + Intergenic
948518927 2:238523548-238523570 CTGCGCATCTGGAGGCCAGAAGG + Intergenic
948776258 2:240290444-240290466 CTGTGCTTGTGGTGGGGAGGCGG - Intergenic
1169234802 20:3922425-3922447 CTGTGTCTCAGGAGGGCTGAGGG + Intronic
1169421842 20:5466676-5466698 CTTTGCATCTGGAGGCCAGCTGG - Intergenic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1170196918 20:13698560-13698582 CTGTGCTTGTGTATGGTAGATGG - Intergenic
1170730612 20:18971861-18971883 CTGTCCTGCTCCAGGGCAGATGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1172153743 20:32809373-32809395 CTTTTCTTCTGCAGGTCAGATGG + Intergenic
1172830383 20:37829098-37829120 CTGTCCATCTGGGGGGCAGGGGG + Intronic
1173048002 20:39531066-39531088 CTGAGCTTCTGAAGGTCAGAGGG - Intergenic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1173365276 20:42379542-42379564 CTGAGCCTGTGGAGGGCAGCAGG + Intronic
1173749806 20:45468384-45468406 CTTTGCTGCTGGAGGCTAGAGGG - Intergenic
1174331875 20:49826541-49826563 ATGTGCTTTTGGAGTGCAGATGG - Intronic
1174579652 20:51562622-51562644 CTCTGCATCTGGAGGGCACGGGG + Intronic
1175329805 20:58155783-58155805 CTCTGCTTCTGCAGAGCAGGAGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1176430746 21:6573995-6574017 CTGAGCTCATGAAGGGCAGAGGG + Intergenic
1176674904 21:9768544-9768566 CTGAGCTTCGGGGGGGCTGAGGG + Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178338635 21:31766370-31766392 CTCTGCTTGGGGAGTGCAGAAGG + Intergenic
1178875965 21:36414117-36414139 CTGTGCTGCCTGACGGCAGAAGG - Intronic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179706140 21:43181457-43181479 CTGAGCTCATGAAGGGCAGAGGG + Intergenic
1180249320 21:46570238-46570260 CTGCCCTTCTGGAGGGCAGCAGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1182415998 22:30221796-30221818 CTGTGCTCCCCGACGGCAGAGGG - Intergenic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183259015 22:36782231-36782253 GTCTGCTGCAGGAGGGCAGAAGG + Intergenic
1183570784 22:38651836-38651858 GTGTGCTCCATGAGGGCAGAAGG - Intronic
1183672875 22:39283393-39283415 CTGGGCCTCAGGAGGGCTGATGG - Intergenic
1183734266 22:39635355-39635377 CTGCGCTTCTCAAGGGCAGGGGG - Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
1184829794 22:46977416-46977438 CTGAGCTTCTTGGGGACAGAGGG - Intronic
1185082200 22:48715658-48715680 CTGTCCTGCTGGAGAGAAGAGGG + Intronic
1185202593 22:49517267-49517289 CTGTGCTTCTTGGGGACCGAGGG - Intronic
1185275942 22:49950305-49950327 CTGTGCTACTGCAGGGCGGGAGG - Intergenic
1185355061 22:50363559-50363581 CTCTTCTTCTTGAGGGCATATGG + Intronic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
949379948 3:3433392-3433414 CTGTGCATCTTGAGTGCAGGGGG - Intergenic
949474622 3:4431662-4431684 CTGTGCCGGTGAAGGGCAGAGGG - Intronic
952849994 3:37719940-37719962 TTATTTTTCTGGAGGGCAGAGGG + Intronic
952866822 3:37860781-37860803 CTGTGCTTGTGCAAGGCAGCTGG - Intergenic
954646056 3:52132261-52132283 CTGAGCTTCAGGAGGGGAGGAGG - Intronic
954684820 3:52364773-52364795 CTGGGCAGCTGGAGGGCAGCTGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958079538 3:88728660-88728682 CTGTGCATCTGGCTGACAGATGG + Intergenic
959409558 3:106003605-106003627 CTGTCCATCTGGATGTCAGATGG - Intergenic
960008209 3:112803870-112803892 ATGTACTCCTGGAGGGCAGGAGG - Intronic
960695742 3:120394647-120394669 CTATGCTTTTAGAGGGCTGAAGG + Exonic
960944147 3:122954498-122954520 CTCTGCTTCATGAGGGCAGGAGG + Intronic
961082504 3:124038262-124038284 CTGTGCTCCTGGAGTGCACAGGG - Intergenic
961869275 3:129976123-129976145 CTGAGCTTCCGAAAGGCAGAAGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962418912 3:135210005-135210027 CTGTGCCTCTGGATGGGTGATGG + Intronic
965600437 3:170448770-170448792 CTGTGCTCCTGATGGGGAGAAGG + Intronic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
966203257 3:177378915-177378937 TTGTGCTTCTGAAGGGGAGAGGG + Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967438390 3:189477849-189477871 CTGGGCTTCTGGAGGGGAGGGGG - Intergenic
967931161 3:194691316-194691338 CTTTGCTCCTGGAGCTCAGAGGG + Intergenic
968108347 3:196020336-196020358 CTGCCATTCTGGAGGGGAGATGG - Intergenic
968600390 4:1505990-1506012 CCCTGCTTCTGGAGGGCACAGGG - Intergenic
969605878 4:8202075-8202097 ATGTGCTTCCGGAGAGGAGATGG + Intronic
969696301 4:8737028-8737050 CTGTGTTTCTGGACAGCTGATGG - Intergenic
970024645 4:11610537-11610559 CTGTACTTATGGAGCACAGAAGG + Intergenic
971194868 4:24462947-24462969 ATGTGCTTGTGCAGTGCAGAAGG - Intergenic
971393241 4:26205103-26205125 CTGTGCTCCTGGTGGCCAGCGGG - Intronic
973628819 4:52799186-52799208 CTGTGCTACTGGAGAGGAGAAGG + Intergenic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
975369548 4:73568640-73568662 TTGTGCTTGAGGAGGGAAGAAGG - Intergenic
976888917 4:90020974-90020996 CTCAGCTACTGGAGGGCACAGGG + Intergenic
979626734 4:122853350-122853372 CTCTGATTCTGGAGGGTGGAGGG - Intronic
979647396 4:123087525-123087547 CTGTGCTTCTGGCAGGAGGAAGG - Intronic
982588420 4:157272628-157272650 TTGTGCTTCTGGCAGGGAGAGGG + Intronic
983450572 4:167906284-167906306 TTATGCTTCTGGTGGACAGAGGG + Intergenic
986025258 5:3844679-3844701 CTGTGCTTCTGGAGTGGAAAGGG - Intergenic
986265503 5:6186820-6186842 GTGGGCTTCTGGATGGCAGCGGG + Intergenic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
986593732 5:9398637-9398659 CTTTTCATCTGAAGGGCAGAAGG - Intronic
986994610 5:13592749-13592771 ATTTACTTCTGGAGGGGAGAAGG - Intergenic
987308167 5:16657985-16658007 CTTGGCTTCTGGAGGGCTCAAGG + Intergenic
988008779 5:25455189-25455211 CAGTGCTTCTGGATAGAAGATGG - Intergenic
988255270 5:28810623-28810645 CTTTCCTTCTGGAGGGCGGAGGG + Intergenic
988340167 5:29960506-29960528 CTGTGCTTCTGGTGGCCACAGGG + Intergenic
989651589 5:43696595-43696617 CTCTGCTACTGCAGTGCAGAAGG - Intronic
990347573 5:54884575-54884597 GTGAGCTTCAGGAGGGCAGAGGG + Intergenic
990968356 5:61474989-61475011 ATGTGCTTTTGGAGGGCTGAAGG - Intronic
992379666 5:76224791-76224813 CTGTGCTTGTGAAGAACAGATGG - Intronic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
993204372 5:84861414-84861436 CTGTGTTTCTGGATAGCAGAAGG - Intergenic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994645705 5:102466181-102466203 GTGGCCTACTGGAGGGCAGAGGG - Intronic
995762296 5:115576313-115576335 ATTTGATTATGGAGGGCAGAGGG - Intergenic
996218173 5:120893627-120893649 CTGTGCTTCCGGCAGGGAGAAGG - Intergenic
996500347 5:124209632-124209654 CTTTGCTTTTGGAGGAAAGAGGG - Intergenic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
998884967 5:146684644-146684666 CGATGCATCTGGAGGGTAGATGG - Intronic
999208772 5:149869679-149869701 CTGTGCTGCAGGAAGGCAGCTGG + Intronic
999376050 5:151087157-151087179 CTGTGCTTCTGCAGGAAGGAGGG + Exonic
1000336782 5:160247170-160247192 CTTTGAACCTGGAGGGCAGAAGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001791491 5:174461215-174461237 CCTGGCTTCTGGGGGGCAGAGGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002323118 5:178387455-178387477 CTGAGCTGCAGGAGGGCAGCAGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002522217 5:179798213-179798235 CAGTGCTTCCAGAGGGCCGAAGG + Exonic
1002857205 6:1048489-1048511 CTGTTCTTCCGGAAGGCCGATGG - Intergenic
1002869204 6:1150706-1150728 GAGTGCTTGGGGAGGGCAGAGGG - Intergenic
1003272249 6:4617580-4617602 CTCTGATTCTGGAGGTCAAATGG - Intergenic
1003880676 6:10477075-10477097 CTCTGCTTCTGTGGGGCACATGG + Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006170484 6:32089140-32089162 CTGCCCTCCGGGAGGGCAGAAGG - Intronic
1007167064 6:39836124-39836146 CTGTGAATCTGGCCGGCAGAGGG - Intronic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1008154458 6:47996506-47996528 CGGGGCTTCTGGGGTGCAGAGGG - Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1012440448 6:99257358-99257380 CTGTGCTTCTGGAAGGCCTGCGG + Intergenic
1013176379 6:107680817-107680839 CTGCCCTTCTGGTGGGAAGAAGG - Intergenic
1013910193 6:115266701-115266723 CTGTGCTTCTGGTAGGGAAAGGG - Intergenic
1015988540 6:138911528-138911550 CTCTGCTACTGAAAGGCAGATGG + Intronic
1016933639 6:149432376-149432398 CTTAACTTCTGGAAGGCAGAGGG - Intergenic
1017690157 6:156956127-156956149 CTCTGCTTCTGTAGTGCACAGGG + Intronic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018802601 6:167235781-167235803 GTGTGCTCTTGGAGGGCTGAGGG - Intergenic
1019020474 6:168913685-168913707 CTGTGCTGCAGGAAGACAGAGGG + Intergenic
1019570264 7:1708124-1708146 TTTTGCATCTGGAGGGCAGGAGG - Intronic
1020250732 7:6466355-6466377 CTGAGCTCCTGGTGGGCAGTGGG - Intronic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1022043082 7:26598966-26598988 TTTTTCTTATGGAGGGCAGAGGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1024292110 7:47812260-47812282 CTGGGCTGCTGCAGGGAAGAGGG - Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1027164606 7:75825491-75825513 CTGAGTTTCTGGAAGGCAAAAGG + Intergenic
1027241943 7:76336370-76336392 CTGTGCTTGTGTGGGGCAGGGGG + Intronic
1027613175 7:80388459-80388481 CTGGGCTTCTGAGGGGCAGGTGG - Intronic
1031117282 7:117681975-117681997 TTGTGACTCTGGAGGGCACAAGG + Intronic
1031761281 7:125716159-125716181 CTGTGCTGTTGGAGGGGACACGG - Intergenic
1034269773 7:149797875-149797897 CTGAGCTCCTTGAGGGCAGTGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034851634 7:154499322-154499344 CTGTGCTCCTAGAAGGCAGGGGG - Intronic
1035213387 7:157345947-157345969 CTGAGCTTCTGTAGGGTGGAGGG + Intronic
1035701087 8:1639630-1639652 CTGTGCTGCTGGAGACCATAGGG - Intronic
1036709541 8:11069281-11069303 CAGGGCTTCTGGGAGGCAGAAGG - Intronic
1037951437 8:23020876-23020898 CTGCACTTCTGGAAGGCACAGGG - Exonic
1042089477 8:65143418-65143440 CAGTGCTTCTGAAAGGCAAATGG - Intergenic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1044743672 8:95352237-95352259 CTGTCCTCCTGGAAGTCAGAAGG - Intergenic
1045845522 8:106630905-106630927 CTGTGCTAGCTGAGGGCAGAAGG + Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1047558981 8:125965970-125965992 CTGATCATCTGAAGGGCAGATGG - Intergenic
1049283240 8:141761174-141761196 TTGGGCTGCTGGAGGGCAGGTGG + Intergenic
1049311452 8:141935935-141935957 CTGTCCTTCCGGAGGGCACCTGG - Intergenic
1049444643 8:142624407-142624429 CTGTCCTTAGGGAGGGCCGAGGG - Intergenic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1052067153 9:24036093-24036115 CAGTTCTACTGGAAGGCAGAAGG + Intergenic
1052124276 9:24756045-24756067 CTCTGCTACTGCAGTGCAGAAGG + Intergenic
1052590696 9:30490173-30490195 CTGTACTACTGGAGTGGAGAGGG - Intergenic
1052849719 9:33370059-33370081 CTGTGATTCTGCCAGGCAGAGGG - Exonic
1053351171 9:37414346-37414368 CTGCTCTTCTGGGGAGCAGAGGG - Intergenic
1054761476 9:69008145-69008167 CTGTGCACTTGGAGGGCAGGAGG + Intronic
1055033027 9:71789859-71789881 CTCAGCTTCTGGAGGGTAGCTGG + Intronic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1057269799 9:93644455-93644477 CAGTGCTTCTGGTGTGCAGCGGG + Intronic
1057397524 9:94693023-94693045 CTGGGCTGCTGGAATGCAGAGGG + Intergenic
1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG + Intronic
1058214187 9:102212857-102212879 CTTAGCTTCTGTAGGGCAGTTGG - Intergenic
1058685688 9:107477807-107477829 ATGAGCTTCTGGAGGGCACTAGG - Intergenic
1059332248 9:113542933-113542955 CTGTGCTGCCGCAGGGCTGAAGG + Intronic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1060199806 9:121645830-121645852 CTGGGCTTCTGGAGGACTGGAGG + Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062481445 9:136754350-136754372 GTGTCCTTCCGGAGGGCCGATGG - Intergenic
1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG + Intergenic
1185603853 X:1355778-1355800 GTGTGCTGCAGGTGGGCAGAGGG + Intronic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1189725321 X:43962981-43963003 CTGACCTTCTGGCTGGCAGAGGG + Intronic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190487432 X:50941841-50941863 CTCTGCTGGTGGAGGACAGAGGG + Intergenic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1197723257 X:129759223-129759245 CTTACCTTCTGGAAGGCAGAGGG - Exonic
1197739124 X:129875779-129875801 CTCTGCCTCTGCAGGCCAGAAGG - Intergenic
1197771976 X:130094955-130094977 CTGAGCTGCTGGTGGGCCGAGGG + Intronic
1199502391 X:148521876-148521898 CAGTGCTTTTGGACGGCACAAGG - Intronic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic
1200826930 Y:7656104-7656126 GTTTTCTTCTGGAGGGAAGAAGG + Intergenic
1202232949 Y:22673694-22673716 GTTTTCTTCTGGAGGGAAGAAGG - Intergenic
1202310207 Y:23522464-23522486 GTTTTCTTCTGGAGGGAAGAAGG + Intergenic
1202560594 Y:26148129-26148151 GTTTTCTTCTGGAGGGAAGAAGG - Intergenic