ID: 1144689654

View in Genome Browser
Species Human (GRCh38)
Location 17:17252310-17252332
Sequence CTGGCAGTCCTGACATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144689647_1144689654 5 Left 1144689647 17:17252282-17252304 CCTTTCATTCCAGAAGGGTTTCT 0: 1
1: 0
2: 3
3: 21
4: 281
Right 1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 207
1144689644_1144689654 19 Left 1144689644 17:17252268-17252290 CCTGGTCTCACAGACCTTTCATT 0: 1
1: 0
2: 2
3: 28
4: 327
Right 1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 207
1144689643_1144689654 20 Left 1144689643 17:17252267-17252289 CCCTGGTCTCACAGACCTTTCAT 0: 1
1: 0
2: 1
3: 36
4: 297
Right 1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 207
1144689648_1144689654 -4 Left 1144689648 17:17252291-17252313 CCAGAAGGGTTTCTCAAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG 0: 1
1: 0
2: 4
3: 29
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144689654 Original CRISPR CTGGCAGTCCTGACATTTGG GGG Intronic
900515866 1:3081989-3082011 CTTGCACCCCTGACATGTGGAGG + Intronic
902208238 1:14885451-14885473 CAGGCAGACCTGACATATGTTGG - Intronic
904403974 1:30274443-30274465 CTGCCAGTCCTAACAACTGGAGG - Intergenic
905746614 1:40423665-40423687 CTGGAAATCCAGACACTTGGAGG - Intergenic
906501881 1:46347216-46347238 CTGGAACTCCTGACATCAGGTGG - Intronic
908895418 1:68893140-68893162 TAGGCAGCCCTGACATTGGGCGG + Intergenic
911497603 1:98650446-98650468 CTTTCAGTCCTGCCGTTTGGTGG + Intergenic
912596944 1:110888360-110888382 CTGGCAGAGCTGAGATTTTGAGG - Intronic
912673002 1:111648842-111648864 CTTGCTGTCCTGAGATTTGGGGG + Intronic
913405592 1:118487193-118487215 CTTGAACTCCTGAGATTTGGTGG + Intergenic
914940300 1:152017004-152017026 CTGGGAGACCTGACATTCTGTGG - Intergenic
915773907 1:158461588-158461610 CTGGGAGTCCTGATAGATGGAGG + Intergenic
917552678 1:176051225-176051247 CTGGCACTCTGGACATTTGATGG - Intronic
917848764 1:179042606-179042628 CTTTCAGTCCTGCCATTTGGTGG + Intronic
917960294 1:180138284-180138306 GTGGCACTACTGACATTTAGTGG - Intergenic
923877523 1:238065337-238065359 ATGGAACTCCTGACACTTGGTGG + Intergenic
1063462775 10:6225050-6225072 GGGGGAGGCCTGACATTTGGAGG + Intronic
1064010379 10:11730603-11730625 CTTTCAGTCCTACCATTTGGTGG - Intergenic
1064680319 10:17805583-17805605 CACACAGTCCTGACATTTGGAGG + Intergenic
1066561977 10:36679504-36679526 CTGGCTCTGCAGACATTTGGGGG + Intergenic
1068222671 10:54063999-54064021 CTTTCATTCCTGCCATTTGGTGG + Intronic
1069004001 10:63297517-63297539 CTTTCAGTCCTGCCATTTGGTGG - Intronic
1069095312 10:64252183-64252205 CTCACAGTCCGGACACTTGGAGG - Intergenic
1069452654 10:68529331-68529353 CTCGAACTCCTGACCTTTGGTGG - Intergenic
1070401332 10:76055981-76056003 CTTTCAGTCCTGCCATTTGGTGG + Intronic
1071375049 10:84993863-84993885 CTGGGAGCCCTGACACCTGGAGG - Intergenic
1072556167 10:96515357-96515379 TTGGCCTTCCTGCCATTTGGTGG - Intergenic
1073877565 10:107943128-107943150 CTTGCAATCCTGACATTTTGAGG + Intergenic
1075170859 10:120112350-120112372 ATGGCTGTCCTGACATTCTGGGG + Intergenic
1077159969 11:1108192-1108214 CACGCAGTCCTGGCACTTGGAGG - Intergenic
1077424585 11:2468506-2468528 CCATGAGTCCTGACATTTGGAGG + Intronic
1077847541 11:6041766-6041788 CTGACAGTTTTGACTTTTGGGGG + Intergenic
1079503895 11:21132839-21132861 CTTTCAGTCCTGCCATTTGATGG + Intronic
1079997055 11:27305625-27305647 CTTTCAGTCCTGCCATTTGGTGG - Intergenic
1081722476 11:45300518-45300540 TTGGCACTACTGACATTTGGGGG - Intergenic
1085435233 11:76493820-76493842 CTTTCAGTCCCGGCATTTGGCGG - Intronic
1085727837 11:78969801-78969823 CTGGCAGCCCTGTAATTTAGAGG + Intronic
1087426855 11:97999276-97999298 CTGGAAGGCATGACATTTTGTGG + Intergenic
1088532307 11:110823845-110823867 TAGGCAGTAGTGACATTTGGAGG - Intergenic
1093182985 12:15988262-15988284 CTTTCAGTCCCGCCATTTGGTGG + Intronic
1099046824 12:77731224-77731246 CAGCCAGTCCTGAGTTTTGGAGG + Intergenic
1100800220 12:98223010-98223032 CCAGCAGTCCTGTCCTTTGGGGG + Intergenic
1101085958 12:101236596-101236618 CTGGGTGTCCTGGAATTTGGTGG + Intergenic
1102595848 12:113992128-113992150 CTGGCTTCCCTGGCATTTGGGGG - Intergenic
1103487608 12:121293893-121293915 GTGGCACTGCTGGCATTTGGGGG + Intronic
1105251019 13:18698329-18698351 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1105543933 13:21338352-21338374 TTGGGAGTCCTGACACCTGGTGG - Intergenic
1108376925 13:49822546-49822568 CTGGCTCACCTGATATTTGGGGG - Intergenic
1109348533 13:61145961-61145983 CTTTAAGTCCTGCCATTTGGTGG - Intergenic
1109512403 13:63396641-63396663 CTTTCAGTCCCGCCATTTGGTGG - Intergenic
1110277474 13:73656306-73656328 CTGACACTCTTGAAATTTGGAGG + Intergenic
1111474398 13:88725936-88725958 CTTTCAGCCCTGCCATTTGGTGG - Intergenic
1111962863 13:94830474-94830496 GCTGCAGTCCTCACATTTGGAGG + Intergenic
1112026852 13:95419251-95419273 TTGGCACTATTGACATTTGGAGG - Intergenic
1112278079 13:98039179-98039201 CTGGCAGACCTGAAATTTACAGG - Intergenic
1116083330 14:40204077-40204099 CTTTTAGTCCTGCCATTTGGTGG + Intergenic
1116313707 14:43359854-43359876 CTTTCAGTTCTGACGTTTGGCGG + Intergenic
1116541455 14:46107211-46107233 CTTTCAGCCCTGCCATTTGGTGG + Intergenic
1120989906 14:90366079-90366101 CTGGAACTCCTGACCTCTGGTGG + Intergenic
1121224335 14:92310168-92310190 CTGGGAATCCTGCAATTTGGGGG + Intergenic
1122347558 14:101069996-101070018 GGAGCAGCCCTGACATTTGGGGG - Intergenic
1122595757 14:102889906-102889928 CAGGTAGACTTGACATTTGGTGG + Intronic
1123976486 15:25558836-25558858 CTGGAAATACTGATATTTGGGGG + Intergenic
1124400468 15:29343505-29343527 CTGGCAGGCCTGAAATCTGTAGG - Intronic
1124458162 15:29863713-29863735 CTGGCAGTGCTGCTCTTTGGTGG + Intronic
1124964638 15:34423903-34423925 CTGGGGGTCCTCACGTTTGGAGG + Intronic
1124981255 15:34570129-34570151 CTGGGGGTCCTCACGTTTGGAGG + Intronic
1125862130 15:43009043-43009065 CTTTCAGTCCTGCCATTTGGTGG - Intronic
1130197705 15:81796173-81796195 CTGGAACTCCTGCCATTTTGGGG - Intergenic
1131136094 15:89936832-89936854 CTTGCAGTCTTTACATTTGAAGG - Intergenic
1132713499 16:1279424-1279446 CTGGCTGCCCTGGAATTTGGCGG - Intergenic
1132739461 16:1404241-1404263 GTTTCAGTCCTTACATTTGGGGG - Intronic
1133655840 16:7862757-7862779 CTTGCAATCCTGAAATTTGTAGG + Intergenic
1134125276 16:11612182-11612204 TTGGCTGTCCTGAGCTTTGGCGG - Intronic
1135986853 16:27190233-27190255 CTTTCAGTCCTGCCATTTGCTGG - Intergenic
1139015532 16:62684642-62684664 CTTTCAGTCCTGCCATTCGGTGG - Intergenic
1140953318 16:79839614-79839636 TTGGCACTCTTGACATTTGGGGG + Intergenic
1141357127 16:83357709-83357731 TTGGCACTACTGACATTTTGAGG - Intronic
1142348774 16:89570510-89570532 CTGGGAGGCCTGACACTGGGTGG - Intergenic
1143741363 17:8956361-8956383 CTGGGAGTCCTGTCATAAGGTGG + Intronic
1143748405 17:9010597-9010619 CTGGCATTTCTGAGATTTGCTGG + Intergenic
1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG + Intronic
1144863198 17:18318621-18318643 CTGGAACTCCTGACCTTAGGTGG + Intronic
1146787936 17:35734633-35734655 CTGGCACTCCTGACATTTTGTGG - Intronic
1150686671 17:67326608-67326630 CTGGAAGCCCTGACCTTTAGAGG + Intergenic
1152530530 17:80916094-80916116 CTTGTAGCCCTGACATTTGGTGG - Intronic
1153724040 18:7937141-7937163 CTTGCAGCCCTGCCATTTGGTGG - Intronic
1154437831 18:14360585-14360607 CTGGAAGCCCTGGGATTTGGGGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156259163 18:35428629-35428651 CTGGGGGTTCTGACAGTTGGAGG - Intergenic
1157009711 18:43632140-43632162 TAGGCAGTGCTGACATGTGGTGG - Intergenic
1157375698 18:47162220-47162242 CTCCCAATACTGACATTTGGGGG + Intronic
1158133028 18:54174103-54174125 TTGGCATTCTTGACATTTGGGGG + Intronic
1159221385 18:65468564-65468586 CTGGCAGTCCAGAAAATTGGAGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160341449 18:78092623-78092645 AGGGCTGGCCTGACATTTGGCGG + Intergenic
1161847425 19:6719711-6719733 CTGGAAGTCCAGAGACTTGGAGG - Intronic
1162648123 19:12064894-12064916 CTGGGAGTCCCGAGACTTGGGGG + Intronic
1162801831 19:13115583-13115605 CTGGCAGCCCTGGAATTTAGCGG - Intronic
1164888806 19:31805566-31805588 CTGGCACTACTGATATTTTGAGG + Intergenic
1164984489 19:32638477-32638499 CTTTCAGTCCTGCCATTTGGTGG - Intronic
1166112400 19:40630666-40630688 GCGGCAGTCCTGACAGCTGGAGG + Intergenic
1166641104 19:44495864-44495886 CAGGCAGTCCTGACAACTGTAGG + Intronic
1166772224 19:45290787-45290809 CTAGCAGTCCTCACAGGTGGTGG - Intronic
1166893766 19:46010388-46010410 CTGGCAGACCTGGCATGTAGAGG - Intronic
1167244292 19:48364478-48364500 ATGGCAGTGCTGAGGTTTGGGGG - Exonic
926269326 2:11353408-11353430 CTTGCAGCTCTGACTTTTGGTGG - Intergenic
927056274 2:19368423-19368445 CTGGCTTTCCTGTCATCTGGTGG + Intergenic
927080551 2:19625855-19625877 CTGGCAGTGGTGACATTGGGTGG - Intergenic
927402408 2:22728444-22728466 CTGGTATTCCCGGCATTTGGGGG + Intergenic
928995488 2:37286220-37286242 CTTGCAGTACTGACATATCGTGG + Exonic
930014392 2:46960385-46960407 CTGGTATACCTGATATTTGGTGG + Intronic
930353491 2:50288384-50288406 GTGGCATTACTGACATTTTGGGG - Intronic
930727202 2:54694007-54694029 CTTGCAGTCAAGACAATTGGTGG - Intergenic
931073157 2:58677824-58677846 CTGGCAATTCTGAAATTTGTAGG + Intergenic
931710515 2:64986226-64986248 CTGGCCTCCGTGACATTTGGTGG - Intergenic
932096106 2:68850303-68850325 CTGGCACACCAGAAATTTGGAGG - Intergenic
932815033 2:74854629-74854651 CTGGCAGTCCTGGCAGTTAAGGG + Intronic
935131796 2:100266146-100266168 CTGGCAGACTGGACACTTGGTGG + Intergenic
936613265 2:114022799-114022821 CTGGCAAGCCTGAAATTTGTAGG - Intergenic
939748171 2:146004106-146004128 CTGGCAGGCCTGGATTTTGGGGG + Intergenic
940422731 2:153498817-153498839 CTTTCAATCCTGCCATTTGGTGG + Intergenic
940714357 2:157202878-157202900 TTGGCATTACTGGCATTTGGGGG + Intergenic
941131125 2:161651413-161651435 CTTTTAGTCCTGCCATTTGGCGG - Intronic
941998926 2:171627240-171627262 CTTTCAGTCCTGCCATTCGGCGG - Intergenic
942204186 2:173603037-173603059 CTGTGAGTACTGACATTTTGGGG + Intergenic
943063563 2:183063399-183063421 CATGTAGTGCTGACATTTGGTGG + Intergenic
943548026 2:189305670-189305692 CTGGCAGATTGGACATTTGGTGG - Intergenic
944069710 2:195655374-195655396 CTTGCAGTCCTTACATTTTAGGG - Intronic
944681805 2:202084122-202084144 CTGCCAGTTCTGGGATTTGGGGG + Intronic
945689860 2:213020076-213020098 ATTGCAGTTCTGACATTTGATGG - Intronic
947316686 2:228866480-228866502 CTGCCAGTCCTGCCAGCTGGAGG + Intronic
948334870 2:237200094-237200116 CTTTCAGTCCTGCCATCTGGTGG + Intergenic
948683764 2:239658116-239658138 ATGGGGGCCCTGACATTTGGAGG + Intergenic
948698227 2:239744815-239744837 CAGGCAGTGCTGTCACTTGGGGG + Intergenic
948948588 2:241234616-241234638 CTGGCAGGGCTGACATTTGGAGG - Intronic
1170314868 20:15031374-15031396 CTTTCAGTCCTGCCATCTGGTGG + Intronic
1170597142 20:17814544-17814566 CTGGCAGTCCTGATATGTCTTGG - Intergenic
1170711064 20:18791520-18791542 TTGGCAGCCCTGTCATTAGGGGG - Intergenic
1173710129 20:45148242-45148264 CTGGCAGACTTGACATTTTGTGG + Intergenic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175501405 20:59453530-59453552 CTGGCATTATTGACATTTGGGGG + Intergenic
1177037338 21:16060426-16060448 TTTTCAGTCCTGCCATTTGGTGG + Intergenic
1179996719 21:44977616-44977638 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1180878199 22:19185141-19185163 GTGGCAGTGCTGACCTTGGGAGG + Intronic
1181166930 22:20988927-20988949 CAGGCCGTCCTGGCATTTGAGGG + Intronic
1182257323 22:29048611-29048633 CTGGCAGCCCTGGGTTTTGGAGG + Intronic
1182299027 22:29327812-29327834 CTTTCAATCCTGACATTCGGTGG + Exonic
1183197809 22:36365384-36365406 CTGGCAGCCCTGACTTAGGGTGG - Intronic
1183693566 22:39405562-39405584 CTGGCAGGCCTGGCATTTGGGGG + Intronic
1183924675 22:41197431-41197453 CTGGCAGTCCTGGCACTGGTAGG + Intergenic
950230007 3:11268229-11268251 CTTGAACTCCTGACATCTGGTGG - Intergenic
953289907 3:41650252-41650274 CTTTCAGTCCTGGCATTTGGTGG - Intronic
954193744 3:48983726-48983748 CTTGCAGTACAGACATTTTGAGG - Exonic
954308671 3:49747347-49747369 CTGGAAGTCCTGATATTTGAAGG - Intronic
954427784 3:50452469-50452491 CTGACAATCCTGACATGTGATGG + Intronic
954631333 3:52049339-52049361 CATGCAGTCCTGACACCTGGTGG + Exonic
955666167 3:61351052-61351074 CAGCCTGTCCTGACATGTGGTGG - Intergenic
956442765 3:69296262-69296284 CTTTCAGTCCTGTCTTTTGGTGG - Intronic
957614099 3:82506087-82506109 CTTTCAGTCCTGCCATTTGGCGG - Intergenic
957614563 3:82509986-82510008 CTTTCAGTCCTGCCATGTGGTGG - Intergenic
959490985 3:106988311-106988333 CTTGCAGTCCTGGTAGTTGGTGG - Intergenic
961205437 3:125077636-125077658 CCGGCTGTACTGACATTTTGGGG + Intergenic
964515017 3:157498383-157498405 ATGGCACAACTGACATTTGGTGG + Intronic
965367829 3:167821184-167821206 CTTTCAGTCCTGCCATTTGGTGG - Intronic
966098852 3:176242147-176242169 CTGGCAGACCTATCATCTGGAGG + Intergenic
967018713 3:185503968-185503990 CTGCCCTTCCTGAGATTTGGTGG + Intergenic
969199620 4:5592471-5592493 CTGACATTCCTGGTATTTGGCGG - Intronic
969910596 4:10441769-10441791 ATGACAGTCCTGACATCTGTTGG + Exonic
971354095 4:25878910-25878932 TTGGCACTCGTGACATTTTGGGG - Intronic
971660162 4:29403869-29403891 CAGACAGTGCTGACATTTTGAGG + Intergenic
972404214 4:38731226-38731248 CTGGAACTCCTGACCTTTTGTGG - Intergenic
973534469 4:51867392-51867414 CTTTTAGTCCTGCCATTTGGTGG + Intronic
973601356 4:52545749-52545771 CTGAAAGTCTTGACATTTGAGGG - Intergenic
974023500 4:56711931-56711953 CTTTCAGTTCTGCCATTTGGTGG - Intergenic
976083070 4:81377462-81377484 CTGGCAATGCTGATATTTGCTGG - Intergenic
979939954 4:126749832-126749854 CTGGAACTCCTGACCTTAGGTGG + Intergenic
980249154 4:130291460-130291482 TTAGCACTCCTGACATTTTGAGG - Intergenic
980250309 4:130306652-130306674 CTGGCATTATTGACATTTGGGGG + Intergenic
981889143 4:149715617-149715639 CTTTCAGTCCTGCCATCTGGTGG + Intergenic
982220830 4:153123860-153123882 CTGGCAAGCCTGAAATTTGTAGG - Intergenic
985925521 5:3013067-3013089 CTGTCGGTCCTGACCTTTGATGG - Intergenic
989206399 5:38813210-38813232 CTGGCATTGCAGACACTTGGAGG + Intergenic
992997513 5:82347597-82347619 CTGACATTCCTGACACTGGGTGG - Intronic
994246879 5:97488657-97488679 CTTTTAGTCCTGCCATTTGGTGG + Intergenic
994321719 5:98402280-98402302 TTTGCAGTCATGACATTTTGAGG - Intergenic
997042741 5:130277497-130277519 CTTTCAGTCCTGCCATTTGGAGG + Intergenic
997128799 5:131256114-131256136 CTGGTAGTCCTCTCATTTGTGGG - Intronic
997608031 5:135190920-135190942 CTGGCAGTTTTGGAATTTGGTGG + Intronic
1000422447 5:161054119-161054141 CGGGAAGTCCGGACATTTGCTGG - Intergenic
1004068824 6:12277848-12277870 CTGGAAGCCCTGAGATTTGCTGG + Intergenic
1006541191 6:34741169-34741191 ATGGCAGCCATGACATGTGGTGG + Intergenic
1013263162 6:108467147-108467169 CTGACAGTCCTGATCTTTGCTGG - Intronic
1014391764 6:120873031-120873053 CTTTTAGTCCTGCCATTTGGTGG - Intergenic
1014418687 6:121214794-121214816 CTTTCAGTCCTCCCATTTGGTGG + Intronic
1014818366 6:125958868-125958890 TTGGCACTTCTGACATTTTGAGG - Intronic
1016776598 6:147911312-147911334 CTGGGAATCCTGACTTTTGAAGG - Intergenic
1018216958 6:161537887-161537909 CTGGCAGGGCTGTAATTTGGAGG - Intronic
1019565148 7:1675369-1675391 ATTGCTGCCCTGACATTTGGAGG + Intergenic
1021677731 7:23097860-23097882 CTTTCAGTCCTGTCATTTGTTGG - Intergenic
1023090664 7:36614753-36614775 CCGGCAGTGCTGGCATCTGGTGG + Intronic
1023616785 7:42028333-42028355 CTGGGAGACACGACATTTGGGGG + Intronic
1023992385 7:45136172-45136194 CTAGCAGCCCTGACATCCGGGGG + Intergenic
1024024691 7:45400428-45400450 CTTTCAGTCCTGCCATTTGGTGG - Intergenic
1024856984 7:53794106-53794128 TTTACAGTCCTGCCATTTGGAGG + Intergenic
1026863967 7:73811174-73811196 CTGGCAGTCCTGCCCCTGGGTGG + Intronic
1030144473 7:106339651-106339673 CTGGCAGTCATGGCCTATGGTGG + Intergenic
1030290824 7:107871086-107871108 CTGGCAGCCCTGGCAGCTGGAGG - Intergenic
1030359510 7:108580165-108580187 CTTTCAGTCCCGCCATTTGGTGG - Intergenic
1030559517 7:111066734-111066756 CAGACACTCCTGACATTTCGGGG - Intronic
1030721999 7:112881848-112881870 CTTTCAGTCCTGTCATTGGGTGG - Intronic
1036279670 8:7389878-7389900 CTGGCACTGCTGTGATTTGGGGG - Intergenic
1036341849 8:7922002-7922024 CTGGCACTGCTGTGATTTGGGGG + Intergenic
1038746343 8:30258484-30258506 TTGGCACTCCTGACATTTGTAGG - Intergenic
1044374711 8:91456329-91456351 CTGGCAGATTTGACATCTGGTGG + Intergenic
1044613950 8:94120382-94120404 TTTTCAGTCCTGCCATTTGGTGG - Intergenic
1046217562 8:111169354-111169376 ATTGCAGTGCTGGCATTTGGAGG - Intergenic
1046472855 8:114701402-114701424 CTGGCAGATCTGAAATTTGTAGG - Intergenic
1046892384 8:119436964-119436986 ATGGCATTATTGACATTTGGGGG - Intergenic
1048374041 8:133806645-133806667 CTGGGAGTCTTGTCATTTGGGGG + Intergenic
1055796997 9:79985534-79985556 CTGCCAGGCCTGTCATTTCGGGG + Intergenic
1056852704 9:90097663-90097685 CTGGCATTTCTGCCAGTTGGAGG - Intergenic
1058843042 9:108929302-108929324 CTGGCAGTCATCACATGTGCAGG + Intronic
1059591933 9:115671234-115671256 CTGGCAGTCGTTATATTGGGTGG + Intergenic
1060017343 9:120098206-120098228 CTGGCCGTCCTGCCATTTCAGGG - Intergenic
1061193120 9:129093777-129093799 CTGCCAGGCCTGACCATTGGTGG - Intergenic
1061338640 9:129961091-129961113 CTAGAACTCCTGACCTTTGGTGG - Intronic
1061527326 9:131176993-131177015 CTGGCACTACTGACATTTTGGGG - Intronic
1061598391 9:131647840-131647862 TTGGCACTACTGACATTTTGGGG + Intronic
1186423852 X:9448159-9448181 CAGGCAGGCCTGAAATTTGTAGG + Intergenic
1187444350 X:19347461-19347483 CTGGCAGTCCTAATCTTTGCAGG + Intronic
1187700691 X:21962152-21962174 AGGGCATTCCTGACATTTAGTGG + Intronic
1192928965 X:75784811-75784833 CGAGCAGTCCAGACGTTTGGGGG - Exonic
1193211392 X:78810820-78810842 CTTTCAGTCATGCCATTTGGTGG + Intergenic
1194316176 X:92379923-92379945 CTTTCAGTCCTGCCATTTGGTGG - Intronic
1195613019 X:106890609-106890631 CTGAGAGTGGTGACATTTGGTGG - Intronic
1195880246 X:109586028-109586050 CTTTCAGTCCTGCCATTAGGTGG + Intergenic
1196728606 X:118920096-118920118 AAGGCAGTACTGATATTTGGGGG + Intergenic
1197159209 X:123304896-123304918 CAGGCAGTCTTGGAATTTGGTGG + Intronic
1200624221 Y:5491497-5491519 CTTTCAGCCCTGCCATTTGGTGG - Intronic
1201253115 Y:12080657-12080679 CTGGCACTGCTGACATTTGGGGG + Intergenic