ID: 1144694740

View in Genome Browser
Species Human (GRCh38)
Location 17:17295144-17295166
Sequence AAGAAAAAAGAGAATGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144694740_1144694746 6 Left 1144694740 17:17295144-17295166 CCGGCCTCATTCTCTTTTTTCTT No data
Right 1144694746 17:17295173-17295195 GGGGCCTCACTCTGTTGCCCAGG 0: 32
1: 1268
2: 20783
3: 71086
4: 172427
1144694740_1144694748 10 Left 1144694740 17:17295144-17295166 CCGGCCTCATTCTCTTTTTTCTT No data
Right 1144694748 17:17295177-17295199 CCTCACTCTGTTGCCCAGGCTGG 0: 604
1: 24239
2: 78173
3: 173312
4: 227791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144694740 Original CRISPR AAGAAAAAAGAGAATGAGGC CGG (reversed) Intergenic
No off target data available for this crispr