ID: 1144699124

View in Genome Browser
Species Human (GRCh38)
Location 17:17325311-17325333
Sequence CTGAGTGTCTGGAGCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 2, 1: 0, 2: 4, 3: 28, 4: 334}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144699124_1144699128 -1 Left 1144699124 17:17325311-17325333 CCCTCTGAGCTCCAGACACTCAG 0: 2
1: 0
2: 4
3: 28
4: 334
Right 1144699128 17:17325333-17325355 GACCCGATGTATCTGTCCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1144699124_1144699127 -2 Left 1144699124 17:17325311-17325333 CCCTCTGAGCTCCAGACACTCAG 0: 2
1: 0
2: 4
3: 28
4: 334
Right 1144699127 17:17325332-17325354 AGACCCGATGTATCTGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 39
1144699124_1144699135 21 Left 1144699124 17:17325311-17325333 CCCTCTGAGCTCCAGACACTCAG 0: 2
1: 0
2: 4
3: 28
4: 334
Right 1144699135 17:17325355-17325377 GGTGCTGGTTTCCTTGTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 179
1144699124_1144699132 6 Left 1144699124 17:17325311-17325333 CCCTCTGAGCTCCAGACACTCAG 0: 2
1: 0
2: 4
3: 28
4: 334
Right 1144699132 17:17325340-17325362 TGTATCTGTCCCTGGGGTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 174
1144699124_1144699129 0 Left 1144699124 17:17325311-17325333 CCCTCTGAGCTCCAGACACTCAG 0: 2
1: 0
2: 4
3: 28
4: 334
Right 1144699129 17:17325334-17325356 ACCCGATGTATCTGTCCCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144699124 Original CRISPR CTGAGTGTCTGGAGCTCAGA GGG (reversed) Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
901219831 1:7577241-7577263 ATGAGTTTCTGGAGCACATAGGG - Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901842213 1:11960842-11960864 CTGAGTGACAGGAGTTCAGAAGG + Intronic
901961677 1:12831304-12831326 CTGACTGACTGTAGGTCAGATGG + Intronic
901998401 1:13172562-13172584 CTGACTGACTGTAGGTCAGATGG - Intergenic
902826291 1:18976558-18976580 CTGAGTGCCTGGAACACAGTAGG - Intergenic
902935328 1:19760875-19760897 CTGAGTGGCTGGAACTCTGTTGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904585669 1:31579268-31579290 GTGAGTGTTTGGAGCTTAGAGGG + Intronic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907307948 1:53523946-53523968 CAGAGTGACTGGCGCTGAGAGGG - Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907821201 1:57971299-57971321 ATGAGTGTCTTGAGCTGAAATGG + Intronic
908748508 1:67397954-67397976 CTCAGTTTCTAGAGCTCTGAGGG - Intergenic
910992159 1:93067545-93067567 CTTACTGTATGGAGATCAGAGGG + Intergenic
912522091 1:110252491-110252513 CTGGCTGTCTTGAGCACAGATGG + Intronic
912739610 1:112181960-112181982 CTGGGTATTTGGACCTCAGAAGG + Intergenic
915446222 1:155976396-155976418 CTGAGTGGGTGGATCTGAGAGGG - Intronic
915447357 1:155981573-155981595 CAGAGACTCTGGAGCCCAGATGG - Intronic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
916094100 1:161333003-161333025 CTGATTGTCTAGAGCTGGGAGGG - Intronic
917052981 1:170945329-170945351 TTCAGTGTCTGTAGGTCAGAAGG - Intronic
917252685 1:173079133-173079155 CAGACTATGTGGAGCTCAGATGG + Intergenic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
918269595 1:182884757-182884779 CTGAGGGTCTAGAGATCTGACGG - Exonic
918391146 1:184064096-184064118 CTAACAGTCTGGAGCTGAGATGG + Intronic
919155052 1:193753735-193753757 CGTAGTGTCAGGAGCTCTGAAGG + Intergenic
920563881 1:206958668-206958690 CTGTGTCTCTGCAGCTCAGGAGG - Exonic
920921217 1:210298708-210298730 CTGAATGTCGAGAGCTCAGCTGG - Intergenic
921437226 1:215138148-215138170 CTGAGTATATAGGGCTCAGACGG + Intronic
922717952 1:227886798-227886820 CAGGGTGTCTGGAGCTCCCAGGG - Intergenic
923867911 1:237960355-237960377 CTGAATGTGTGGGGCACAGAAGG + Intergenic
924430791 1:243994795-243994817 CCGAAGGTCTGGAGCTAAGAGGG - Intergenic
924606733 1:245541868-245541890 CTGGGTTTCTGGGCCTCAGAAGG + Intronic
924905346 1:248446306-248446328 CTGAGTAACTGGAGCCCAGGGGG + Intergenic
1063207970 10:3853132-3853154 CTGGGTGGCGGGAGCTCAGAGGG + Intergenic
1064332658 10:14408250-14408272 CTGAGTTTCTTGGTCTCAGATGG + Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065341448 10:24710603-24710625 CTCAGTGTCTGGCACTCAGAAGG + Intronic
1065853985 10:29814893-29814915 TGGTGTGGCTGGAGCTCAGATGG + Intergenic
1066242208 10:33549222-33549244 CGGGATGTCTGGAGGTCAGATGG + Intergenic
1067120909 10:43471409-43471431 CTGTGTGTTTGCAGCTCAGTTGG + Intronic
1067682349 10:48449057-48449079 CTGAGTGCCTGGAGCTCCTCTGG - Intronic
1069086692 10:64148622-64148644 CTGAGTTTCTGTAGTACAGAAGG - Intergenic
1069577938 10:69544048-69544070 CTGATTGCCTGGAGCTCTCAGGG - Intergenic
1069859594 10:71462098-71462120 CTGTGTCTCTGAAGCTCAGCTGG + Intronic
1070702238 10:78612610-78612632 CTGAGAGTGTGGAGCCAAGAAGG - Intergenic
1071407413 10:85351489-85351511 CTGAGTGTCTGGAGGCCTGGAGG + Intergenic
1071429341 10:85594198-85594220 CTGAAAGTCAGGAGCTGAGAGGG + Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071944180 10:90622896-90622918 CTTAGTGTTTGGAGTCCAGAAGG + Intergenic
1074190492 10:111131022-111131044 TTGAGTGGCTGGAGCTGAGCTGG + Intergenic
1076581249 10:131513437-131513459 CTGAGCGTCTGCAGTTCAGCTGG + Intergenic
1078118910 11:8486111-8486133 TTGAGAGTATGGAGATCAGATGG - Intronic
1078368066 11:10722737-10722759 ATGGGTGAGTGGAGCTCAGAGGG - Intergenic
1078581591 11:12543273-12543295 CTGAGCTTCAGGAGCTCAGAAGG - Intergenic
1080196186 11:29612219-29612241 CTGAAATTCTGAAGCTCAGAAGG + Intergenic
1080900477 11:36485481-36485503 CTTACTGTCTGCAGCTCTGAAGG - Intergenic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1081710326 11:45211952-45211974 CAGAAAGTCTGGTGCTCAGAGGG + Intronic
1082108503 11:48245752-48245774 CTGAGAACCTGGAGCTCTGAAGG + Exonic
1083338821 11:61945587-61945609 CTCAGTGTCTTCAGCTCAAATGG - Intergenic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1085509457 11:77080805-77080827 CTGATTGACAGCAGCTCAGAGGG + Intronic
1086740065 11:90355799-90355821 CTGAGTGGCTGAATCACAGAAGG - Intergenic
1088813235 11:113405406-113405428 CCTGGTGTCTGGAGCTCAGAGGG + Intergenic
1089069941 11:115692004-115692026 CTGAGTGCCTGCAGCTCATCAGG + Intergenic
1089439429 11:118502832-118502854 CTGAGTTCCAAGAGCTCAGAGGG + Exonic
1089621736 11:119726599-119726621 CTGAGTGGGTGGAGCACAGCAGG + Intronic
1089754741 11:120678340-120678362 CTGAGGCTGTGGTGCTCAGAAGG + Intronic
1090481919 11:127076566-127076588 ATAAGAGTCTGGAACTCAGAAGG + Intergenic
1091704092 12:2681970-2681992 GTGAGGATCTGGAGCTCAGGAGG + Intronic
1091713620 12:2760495-2760517 GGGAGGGTCTGGAGCTCAGGAGG + Intergenic
1091883503 12:3999209-3999231 CTGAGTGACTGGAGAAGAGAAGG + Intergenic
1094839201 12:34335895-34335917 CGGAGTGGCTGGACCTCACAGGG + Intergenic
1096263695 12:50107943-50107965 TGGAGAGACTGGAGCTCAGATGG - Intronic
1096549928 12:52365279-52365301 CTGAGTGTCTGCGGCTCAAGGGG + Intronic
1098590141 12:72201499-72201521 CAGAGGGTCTGGAGCCTAGAGGG - Intronic
1099211728 12:79799391-79799413 CTGCCTGTCTCGACCTCAGAGGG + Intronic
1099397114 12:82154191-82154213 ATGAGTGGCAGGAGTTCAGAGGG - Intergenic
1100776927 12:97985278-97985300 CTGACCGTCTGCAGCTCTGATGG + Intergenic
1101251335 12:102939088-102939110 CAGGGTGTCAGGAGCTCACAGGG - Intronic
1101894965 12:108749449-108749471 CTGAGATGCTGGAGCTCCGAGGG + Intergenic
1102730492 12:115104619-115104641 CTGATTGTCTGGGCCTGAGAGGG - Intergenic
1104104141 12:125643075-125643097 ACGTGTGTCTGGGGCTCAGAAGG + Intronic
1104211637 12:126694302-126694324 CTGAGTGGCTGGTGCTCATGGGG - Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1106411416 13:29514037-29514059 CTGGGTGTCTGGGGCTGAGCGGG + Exonic
1107189144 13:37558973-37558995 CTGTCTGTCTGCCGCTCAGAAGG + Intergenic
1107751607 13:43573297-43573319 CTGAGTGTCTGCAACCAAGAAGG + Intronic
1108261000 13:48656449-48656471 ATGAGAGTTTGAAGCTCAGACGG + Intronic
1108396748 13:49997257-49997279 CTGCCGGACTGGAGCTCAGACGG - Intronic
1108504118 13:51094945-51094967 CTGAGTCTCTTGAGATCTGATGG + Intergenic
1112811437 13:103223513-103223535 GTAAGTGTTTGGAGCCCAGAAGG - Intergenic
1114016371 14:18433385-18433407 CTGAGTGTTTGTACCTCACATGG - Intergenic
1114019588 14:18465700-18465722 CTGAGTGTCTGTCCCTCACATGG - Intergenic
1114020991 14:18478561-18478583 CTGAGTGTTTGGCCCTCACATGG + Intergenic
1114023258 14:18500450-18500472 CTGAGTGTTTGGCCCTCACAAGG + Intergenic
1114025904 14:18526187-18526209 CTGAGTGTTTGTATCTCACATGG + Intergenic
1114406999 14:22466307-22466329 CATAGTGCCTGGAACTCAGAGGG - Intergenic
1114538188 14:23436154-23436176 CTGAGTGTCAGCAGCAGAGAAGG + Intergenic
1116479921 14:45385180-45385202 CTGAATGTCAGTAGCTCTGAAGG + Intergenic
1118810777 14:69271481-69271503 CTGAGTCACAGGAGCTCTGATGG + Intronic
1119437714 14:74609078-74609100 CTGGCTGTCTGCAGCTCACAAGG + Intronic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1119874180 14:78043011-78043033 CATAGTGCCTGGAGCTCAGTAGG + Intergenic
1120112752 14:80577325-80577347 ATTTGAGTCTGGAGCTCAGAAGG - Intronic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1121315622 14:92959405-92959427 CTACGTGCCTGGAGCTCAGCTGG + Intronic
1121729038 14:96173689-96173711 CTGTGTAGCTGCAGCTCAGAGGG + Intergenic
1121832552 14:97064630-97064652 AGGAGTCGCTGGAGCTCAGAGGG - Intergenic
1122534507 14:102452758-102452780 CTGAATTTCAGGAGCTCAGTTGG + Intronic
1122698344 14:103569606-103569628 CCGGGTGTCTGCAGCTCAGTGGG - Intronic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1124682050 15:31740246-31740268 CTGAGTGCCTGGAGCAGAGGTGG + Intronic
1125574088 15:40743489-40743511 CTCAGTGTGTGGAGTTCAGCAGG + Intronic
1126384560 15:48080732-48080754 CTGAGTGTAGGGAGTACAGAGGG + Intergenic
1127795644 15:62436216-62436238 CACAGTGCCTGGAACTCAGAGGG - Intronic
1127971867 15:63968223-63968245 ATGAGTAGCTGGAACTCAGAAGG - Intronic
1127975314 15:63992791-63992813 CTGACTGTCAGGAACTCAGATGG - Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128272281 15:66321048-66321070 CAGAGAGTGTGGAGCTCAGTTGG - Intronic
1128543396 15:68552019-68552041 CTGAGGTTCTGGAACCCAGAAGG + Intergenic
1128707111 15:69844347-69844369 CTGAGTGTGTGCACCCCAGAGGG - Intergenic
1130297341 15:82656650-82656672 CAGAGTGTCTGGATCTCAGTTGG - Intergenic
1131686417 15:94772772-94772794 GTGAGTGGCTGGAGCTCATCTGG - Intergenic
1132533410 16:465276-465298 CTCAGTGTTTGGGGCTGAGATGG + Intronic
1132984410 16:2756793-2756815 CTGTGTGTCTGGGGCATAGATGG + Intronic
1136289707 16:29264245-29264267 GTGAGTGGCAGGAGCACAGAGGG - Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1138434502 16:56989596-56989618 GTGAGTGCCGGGAGCTCTGAGGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141613366 16:85196535-85196557 CTGAGTCTCTGGTGCCCAGGGGG + Intergenic
1142115719 16:88355127-88355149 CTGAGTGTCTGCAGCTGGGCAGG - Intergenic
1142217535 16:88837269-88837291 CTGGATGTCTGGAGCACAGCCGG + Intronic
1142900380 17:3007929-3007951 CCAGGTGTCTGGAGCTCACAAGG + Intronic
1143730517 17:8880299-8880321 CTGAGGCTCTGGTGCTCAGGGGG - Exonic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1145092239 17:19995442-19995464 CTTAGTCTCTGGAGCACAGTTGG + Intergenic
1145260177 17:21349867-21349889 CCAGGTGTTTGGAGCTCAGAGGG + Intergenic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1148204525 17:45771557-45771579 ATGAGTGTCCTGAGCTCTGATGG - Intergenic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1151034166 17:70779313-70779335 CTGAGTCGCTGGGCCTCAGAAGG - Intergenic
1151469462 17:74309160-74309182 CTGAGATCCTGGAGCCCAGAAGG + Intronic
1152037739 17:77883685-77883707 CTCAGTGCCTGGAGCTCCAAGGG - Intergenic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1154115407 18:11609527-11609549 CACAGTGGCTGGAGCTCTGAGGG + Intergenic
1154390184 18:13930090-13930112 CTGAGGGTGGGGAGCTCAGCGGG - Intergenic
1155249310 18:23940076-23940098 CTTAGTGTCTGTGTCTCAGAGGG - Intronic
1156268755 18:35512123-35512145 CTGGGTGTCAGGAGATCACAAGG - Intergenic
1157529852 18:48410694-48410716 ATGTCTGTCTGGAGCGCAGAGGG - Intronic
1157681230 18:49608671-49608693 CTTAGGATTTGGAGCTCAGAAGG + Intergenic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160338039 18:78060159-78060181 CTGAGGGTCTGGGGCTGAGTGGG - Intergenic
1160910498 19:1471709-1471731 TTGGGTGGATGGAGCTCAGAAGG + Exonic
1160963390 19:1734737-1734759 CAGAATTTCTGCAGCTCAGATGG + Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1163190934 19:15676042-15676064 CTGAGTCCCTGGAGTTCTGAGGG + Intronic
1163497754 19:17656446-17656468 CTGTGTGACTGGGGCTCAGGTGG - Intronic
1164621103 19:29696580-29696602 CTGGGTGTCTGGATGTCAGGTGG - Intergenic
1165330093 19:35136680-35136702 CTGAGTGCCAGGGGCACAGAGGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1167565053 19:50250785-50250807 CTGTTTGTCTGGACCTCAGGAGG - Intronic
1168151964 19:54454095-54454117 ATGGGTGTCTTGTGCTCAGATGG + Intronic
1168712990 19:58512307-58512329 CTGAGTGTCTGGTACCCAGCAGG - Intronic
925173485 2:1766992-1767014 CAGAGTGTCCAGAGCTCAGCAGG - Intergenic
926814761 2:16789328-16789350 CTGGGGGTCTGGATCTCACAGGG - Intergenic
926901850 2:17760286-17760308 ATGTGAGTCTGGAGCTCAAAGGG - Intronic
927519885 2:23692356-23692378 CTGAGTGTCAGGAGCTCCCGGGG + Intronic
928301832 2:30131993-30132015 CTGAGTGGAAGGAGCTCACATGG - Intergenic
929233993 2:39587749-39587771 ATGAAAGTCTGGGGCTCAGAGGG - Intergenic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932263182 2:70344045-70344067 CAGAGTGGCTGCAGCTGAGATGG + Intergenic
932306136 2:70705373-70705395 CTGGCTCTCTGGAGCCCAGAAGG + Intronic
932720812 2:74138020-74138042 CTGAGTGGGTGAAGCCCAGAAGG - Intronic
933540465 2:83634737-83634759 ATGAGTGTTGGTAGCTCAGAAGG - Intergenic
935735824 2:106105980-106106002 CTGAGTGTCTGGTGCTGAGGGGG - Intronic
936104319 2:109612281-109612303 CTGATTGTCTGGGGTTAAGAAGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937039049 2:118807092-118807114 CTCAAGGTCTGGAGCCCAGAGGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
943749120 2:191493680-191493702 CTGAGTGGCTGGAGATAAAATGG + Intergenic
945907693 2:215613569-215613591 CCGAGTTTCTGCACCTCAGAGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946909866 2:224449405-224449427 CTGAGTTCCTGGTCCTCAGAGGG + Intergenic
947711903 2:232321303-232321325 CTGACTGTATGGAGCTCACCAGG + Intronic
948013788 2:234671433-234671455 CAGAGAGTCTGGAGCTGAGCTGG - Intergenic
948265647 2:236633457-236633479 GTGTGTGTCTGGAGCTGGGATGG + Intergenic
948845652 2:240681707-240681729 CTGAGTGGAGGGAGCTCACAAGG + Intronic
948848203 2:240693023-240693045 CTGAGTGGAGGGAGCTCACAAGG - Intronic
1169305800 20:4489384-4489406 CTGAGAGTCTGTATCTCAGAGGG - Intergenic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1171376959 20:24700263-24700285 GTGAGTGCCTGCTGCTCAGATGG + Intergenic
1173048002 20:39531066-39531088 CTGAGCTTCTGAAGGTCAGAGGG - Intergenic
1173319352 20:41973688-41973710 CAGAGTGTCTTTAGCTCAGTAGG - Intergenic
1173594198 20:44248066-44248088 CTCCGTGTCTTGAGCTGAGAAGG + Intronic
1175290721 20:57873356-57873378 CTGACTGTGTTGGGCTCAGATGG - Intergenic
1175415067 20:58795679-58795701 CTGAAGGTCTGAATCTCAGATGG + Intergenic
1176715651 21:10347095-10347117 CTGAGTCTCTTGAGCATAGAAGG - Intergenic
1176960776 21:15156452-15156474 CAGTGTGTCTGGGGCTCACAAGG - Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180440878 22:15364258-15364280 CTGAGTGTTTGTACCTCACATGG - Intergenic
1180444092 22:15396525-15396547 CTGAGTGTCTGTCCCTCACATGG - Intergenic
1180445471 22:15409099-15409121 CTGAGTGTTTGGCCCTCACATGG + Intergenic
1180447361 22:15427406-15427428 CTGAGTGTTTGGCCCTCACAAGG + Intergenic
1180450025 22:15453240-15453262 CTGAGTGTTTGTATCTCACATGG + Intergenic
1180602693 22:17032858-17032880 CTGAGTCTCTTGAGCATAGAAGG + Intergenic
1181855816 22:25780750-25780772 CTGAAAGTCTGAAGCACAGACGG - Intronic
1182259248 22:29061178-29061200 TTGAGTGTCTACAGCTCATATGG - Intronic
1182304090 22:29356096-29356118 CTGGGTGTCTGGGGCTCTGCCGG - Intronic
1182687579 22:32132814-32132836 CTGGGTGTCTGGGGCTCTGCCGG + Intergenic
949987648 3:9553121-9553143 CTGAATTTAGGGAGCTCAGAAGG + Intronic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
950261755 3:11547100-11547122 AAGAGTGTCTGGGGCCCAGAGGG + Intronic
950716497 3:14851158-14851180 CAGACTGCCTGTAGCTCAGACGG + Intronic
951317124 3:21201667-21201689 GTGAGTCTCTTGAGCTCTGACGG + Intergenic
951336845 3:21433876-21433898 GTGTGTGTCTGGAGCTCATGTGG - Intronic
953199539 3:40766633-40766655 CTGAGTCTCTAGAGCTCTCAGGG - Intergenic
953532758 3:43752953-43752975 CTCAGTGTCAGGAGCTTAGAAGG - Intergenic
953882556 3:46698602-46698624 ATGAGGGACTGAAGCTCAGAGGG + Intergenic
954439341 3:50513137-50513159 CTGAGTGCCTGGGGCTTACAGGG - Intergenic
954576977 3:51681727-51681749 CTGAGTGTCTGCATGGCAGAGGG - Intronic
955214121 3:56970985-56971007 CTTAGTGACTGGAGCACAGAAGG + Intronic
955547710 3:60048960-60048982 CTGAGTGTCTAGAACTGAGTTGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
956593048 3:70935948-70935970 CTGAATCTCTGGGGCTCAGGTGG + Intergenic
957146302 3:76428844-76428866 ATGACTGTCGGCAGCTCAGAAGG - Intronic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959403875 3:105936842-105936864 ATGAGTGACTGGAGCACAGAGGG - Intergenic
961075317 3:123976770-123976792 CTGACTGTCAGGAGAACAGAGGG + Intronic
961535821 3:127569899-127569921 CACAGTGTCAGGAGGTCAGAGGG + Intergenic
962622041 3:137189896-137189918 CTGAGAGTCTTCAGCTCAGAGGG - Intergenic
962830676 3:139136527-139136549 CTGAGTGGCTGGAGCCAAGGTGG + Intronic
963209228 3:142670315-142670337 TTGTGTGACTGGAGCTGAGATGG + Intronic
964305317 3:155333434-155333456 CTGAGGGTCTGGAGCTGGGCCGG + Intergenic
964884458 3:161465079-161465101 CTGAGTTTCTATACCTCAGAGGG + Intergenic
966294348 3:178401775-178401797 CTGAATGTCTGAATCACAGAAGG + Intergenic
966839394 3:184076542-184076564 CTGCCTGCCTGGAGCCCAGAAGG + Intergenic
967146572 3:186611727-186611749 CTTAATGTCAGAAGCTCAGAAGG - Intergenic
967402797 3:189082692-189082714 TTGAATTTCTCGAGCTCAGAAGG + Intronic
968313512 3:197703493-197703515 CTGGGTCCCTGGAGCTCAGCAGG - Intronic
968805414 4:2768742-2768764 CTGAGAAACTGGGGCTCAGAAGG + Intergenic
968984584 4:3868219-3868241 CTGCGTGTGTGGAGCTCACAGGG + Intergenic
969185248 4:5469637-5469659 CTGAGTGGCTATAGCTCTGAGGG + Intronic
969509954 4:7612127-7612149 CCGAGTTTCCGGAGCTCAGAAGG + Intronic
970380142 4:15499118-15499140 CTGAATGGGTGGAGCACAGAAGG + Intronic
971480976 4:27114696-27114718 CTGAGGGCCTGGAGCTCTGGGGG + Intergenic
973274895 4:48296504-48296526 CTGAGTGCCTGGGGCTGAGTCGG - Intergenic
973547148 4:51993320-51993342 ATGTGAGTCTGGAGCTTAGATGG + Intergenic
973607212 4:52599837-52599859 CAGATGGGCTGGAGCTCAGAGGG - Intronic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
975472491 4:74786143-74786165 TTGAGTGTCAGAAACTCAGATGG + Intronic
975683028 4:76895881-76895903 CTTGGTGTCTGGAGCAAAGAAGG - Exonic
978194694 4:105957299-105957321 CTGAGGGTCTGGATCTTACATGG - Intronic
978702697 4:111667994-111668016 TTGATTGACTGGAGCTCAGCTGG - Intergenic
980520201 4:133921689-133921711 GTGAGTGTCATGAGATCAGATGG + Intergenic
980736403 4:136895250-136895272 CTGAGAATCAGGAGCACAGAGGG - Intergenic
981828401 4:148971715-148971737 CTGGGTGTTTGGATCTCAGTAGG - Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
983943800 4:173564202-173564224 GTGAGCGTCTTGAGCTCTGAGGG - Intergenic
985631305 5:1015483-1015505 CTGGGTCCCTGGAGCTCTGAAGG + Intronic
985913821 5:2902870-2902892 CAGAGTTTCTGAAGCTCAGCTGG - Intergenic
986526866 5:8688445-8688467 CTGGGGGTCAGGAGCTCAGCTGG + Intergenic
987056396 5:14197232-14197254 ATCAGTATCTGGTGCTCAGAGGG - Intronic
989483610 5:41962318-41962340 CTGCTTGTCTGCATCTCAGAGGG + Intergenic
990118504 5:52419551-52419573 CTATGTGCCTGGAGCTCAGGAGG - Intergenic
990134715 5:52631370-52631392 CAGCTTGTGTGGAGCTCAGAGGG - Intergenic
990472361 5:56127764-56127786 CAGAGGGTCTGGTACTCAGATGG - Intronic
990788594 5:59451424-59451446 GTATGTGTCTGGAGCTCAGGAGG - Intronic
992357834 5:76003816-76003838 CATAGGGTGTGGAGCTCAGAGGG + Intergenic
994704389 5:103183246-103183268 CTGAGTGTGTCTAGCCCAGAGGG + Exonic
995497744 5:112765445-112765467 GTGAGTGACTGGAGCAAAGACGG - Intronic
995981694 5:118112186-118112208 CTGAGTCTCAGGAGATCTGATGG + Intergenic
996315734 5:122158730-122158752 CTATGAGTCTGGAACTCAGAAGG + Intronic
996695133 5:126385963-126385985 CTGGGTCTCTGGAGCAGAGAGGG + Intronic
997875873 5:137546332-137546354 CTGAGTGACAGGAGCCCTGATGG - Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999251655 5:150185951-150185973 CAGAGTGTGTGGAGTTCAGTGGG - Intergenic
999288934 5:150410916-150410938 CTGAGTGGTCTGAGCTCAGAGGG + Intronic
1000773557 5:165388425-165388447 CTGAGTTTCTGCACTTCAGAGGG - Intergenic
1001334102 5:170783602-170783624 CTGAGTGTCTGGAGATCGTCTGG - Intronic
1001929899 5:175665425-175665447 CTGGATGCCTGGAGCACAGAGGG + Intronic
1002108243 5:176890973-176890995 CTGGGTGGCTAGGGCTCAGATGG - Intronic
1002193718 5:177491525-177491547 CTGAGTGTCTGGGGCTCAGCTGG + Intronic
1002968658 6:1992200-1992222 GTGTGAGTCTGGAGCTCAGCGGG - Intronic
1002970019 6:2006048-2006070 ATGCTTGTCTGGAACTCAGAAGG - Intronic
1003936268 6:10977879-10977901 CTGAGTGACTGCAGCTGAGATGG - Intronic
1005198809 6:23319558-23319580 CTGTGTGTCTGGAGCTGAAGGGG + Intergenic
1005234793 6:23747451-23747473 CCGACAGTCTGGAGCCCAGAAGG + Intergenic
1007790849 6:44307276-44307298 CTCAGTGTCTGCATCTCTGATGG - Exonic
1011991197 6:93519769-93519791 CTGAGTGTGTGGTGTTAAGAAGG - Intergenic
1012445202 6:99300253-99300275 CTGAGTGTCCAGAGTTCAGAAGG - Intronic
1012660627 6:101886044-101886066 CTGAATATGTGGAGCACAGAAGG - Intronic
1014188837 6:118468018-118468040 CTTAGTGTCTGGACCATAGAAGG + Intronic
1014401895 6:121000143-121000165 CTTTGTGTCTGGAGCTCTCAGGG - Intergenic
1016873781 6:148844557-148844579 CTGAGTGGCTGGAGCAGACAGGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017186736 6:151609064-151609086 CTGAGTTTTTGCATCTCAGAAGG + Intronic
1017813423 6:158000443-158000465 CTGAGAGCCTGGGGCTCAGTAGG + Intronic
1018969718 6:168517878-168517900 CTGAGAGTCTGGAGCTGGGCTGG - Intronic
1019007901 6:168817962-168817984 CTGGGTTTCTGGACCTGAGATGG + Intergenic
1019686546 7:2384991-2385013 CTGGGTGGCTGCAGCTCAGCAGG + Intergenic
1021033230 7:15764434-15764456 CTGGGTGCCTGGAGTTCAGCTGG + Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021490609 7:21216207-21216229 CTGGGTGTCAGGATTTCAGATGG + Intergenic
1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG + Intergenic
1022783134 7:33606590-33606612 CTTAATGTCTGGAGCAGAGAGGG + Intergenic
1023868749 7:44251665-44251687 TTGAGGGTTTGGAGCTCAAATGG - Intronic
1025776811 7:64568032-64568054 CTCAGTGACTGTACCTCAGACGG - Intergenic
1029619989 7:101684407-101684429 ATGACTGGCTGGAGCACAGAGGG + Intergenic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1036056602 8:5262016-5262038 CGGAGAGTCTGGAGCTCACCTGG - Intergenic
1037258578 8:16982126-16982148 TTCAGTGTCAAGAGCTCAGAGGG - Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038893316 8:31752295-31752317 CAGAGTGACTGGAGCTAAGTGGG + Intronic
1040469384 8:47724627-47724649 CTGAGCATCTGGGTCTCAGATGG + Intronic
1040694646 8:49980986-49981008 CTGTGTGCATGGGGCTCAGAAGG - Intronic
1040710708 8:50185221-50185243 CTGAGTCTCTTGAGATCTGATGG + Intronic
1041886689 8:62817077-62817099 CTGAGTTTCTGTGCCTCAGAGGG + Intronic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1042834330 8:73064458-73064480 CTGATTGCTTGGACCTCAGAAGG + Intergenic
1045351817 8:101348257-101348279 CTGATTGCCTGGAGCCCACATGG + Intergenic
1047697761 8:127419764-127419786 ATGAGTGACTGAAGCTAAGAAGG + Exonic
1048744667 8:137600569-137600591 CTGAGTGTCAAGAGAACAGAAGG + Intergenic
1049767361 8:144361078-144361100 CTGAGTGCCTGCAGCCCAGGAGG + Exonic
1053464266 9:38293706-38293728 CTCAGTGTCTGAAGTTCAGCTGG - Intergenic
1055072012 9:72176057-72176079 CTGAGTGGCTTGAGCTCAGGAGG + Intronic
1055145936 9:72934718-72934740 CTTAGTGCCTGGAGCTTAGTAGG - Intronic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG + Intronic
1057837159 9:98454712-98454734 CTGAGTTTCAGCAGCACAGAGGG + Intronic
1059414155 9:114153115-114153137 CAGAGAGACTGGAGCTCAGGAGG + Intergenic
1061204711 9:129156271-129156293 CTGGGTGTCTGGAGCTGGGGCGG + Intergenic
1061940088 9:133879135-133879157 CTGCGAGTCTGCAGCTGAGACGG - Intronic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1185666291 X:1767924-1767946 CAGAGTGACTGCAGCCCAGAGGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187123444 X:16431170-16431192 CTGAGTGTGTAGAGATCAAATGG - Intergenic
1187245603 X:17550609-17550631 CTGAATGTCTGGAGTTTAGGAGG + Intronic
1187340736 X:18419408-18419430 CTGAGTGTCAGGAATTCAGGAGG + Intergenic
1188305270 X:28554543-28554565 CTGAATGTCAGGAGTCCAGATGG + Intergenic
1190246568 X:48694879-48694901 CTGCCTGTCTGGATCTGAGAGGG - Intergenic
1190734808 X:53249233-53249255 CTGAGGGTCTGTGACTCAGAGGG - Intronic
1192373509 X:70535520-70535542 GTGAGTTGCTTGAGCTCAGAAGG + Intronic
1193932270 X:87568158-87568180 GTGATTATCTGGAGCTAAGAAGG + Intronic
1194243526 X:91480675-91480697 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1198015362 X:132604913-132604935 CTGAGTGTCTGGACAGCAGGGGG - Intergenic
1198066466 X:133101846-133101868 CTCAGTCTCTCGAGCTCAGGTGG + Intergenic
1198503020 X:137271318-137271340 CTGCCTGTGTGGAGTTCAGAGGG + Intergenic
1199171087 X:144734992-144735014 CTGAGTCTCAGGAGATCTGATGG - Intergenic
1200080735 X:153575221-153575243 CTGAATGTCTGGGGCCCACACGG - Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200562507 Y:4722050-4722072 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1201743053 Y:17343956-17343978 CTGATTGTGTGGAGCTAGGAAGG + Intergenic