ID: 1144707137

View in Genome Browser
Species Human (GRCh38)
Location 17:17377162-17377184
Sequence GAGGTGCCCGGCGCCCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144707137_1144707144 27 Left 1144707137 17:17377162-17377184 CCGCCCGGGGCGCCGGGCACCTC No data
Right 1144707144 17:17377212-17377234 AGTAAGCCAGCAGCTTTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144707137 Original CRISPR GAGGTGCCCGGCGCCCCGGG CGG (reversed) Intergenic
No off target data available for this crispr