ID: 1144708759

View in Genome Browser
Species Human (GRCh38)
Location 17:17386814-17386836
Sequence CTGATTTCATGGTGCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144708759_1144708766 -1 Left 1144708759 17:17386814-17386836 CCTGTGTTGCACCATGAAATCAG No data
Right 1144708766 17:17386836-17386858 GGTGGCCTCAAAGAAGGGTTGGG No data
1144708759_1144708763 -7 Left 1144708759 17:17386814-17386836 CCTGTGTTGCACCATGAAATCAG No data
Right 1144708763 17:17386830-17386852 AAATCAGGTGGCCTCAAAGAAGG No data
1144708759_1144708764 -6 Left 1144708759 17:17386814-17386836 CCTGTGTTGCACCATGAAATCAG No data
Right 1144708764 17:17386831-17386853 AATCAGGTGGCCTCAAAGAAGGG No data
1144708759_1144708765 -2 Left 1144708759 17:17386814-17386836 CCTGTGTTGCACCATGAAATCAG No data
Right 1144708765 17:17386835-17386857 AGGTGGCCTCAAAGAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144708759 Original CRISPR CTGATTTCATGGTGCAACAC AGG (reversed) Intergenic
No off target data available for this crispr