ID: 1144708763

View in Genome Browser
Species Human (GRCh38)
Location 17:17386830-17386852
Sequence AAATCAGGTGGCCTCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144708756_1144708763 25 Left 1144708756 17:17386782-17386804 CCATCAGGCTCCTTGGAGGAAGC No data
Right 1144708763 17:17386830-17386852 AAATCAGGTGGCCTCAAAGAAGG No data
1144708755_1144708763 28 Left 1144708755 17:17386779-17386801 CCTCCATCAGGCTCCTTGGAGGA No data
Right 1144708763 17:17386830-17386852 AAATCAGGTGGCCTCAAAGAAGG No data
1144708759_1144708763 -7 Left 1144708759 17:17386814-17386836 CCTGTGTTGCACCATGAAATCAG No data
Right 1144708763 17:17386830-17386852 AAATCAGGTGGCCTCAAAGAAGG No data
1144708758_1144708763 15 Left 1144708758 17:17386792-17386814 CCTTGGAGGAAGCGTCTGGAATC No data
Right 1144708763 17:17386830-17386852 AAATCAGGTGGCCTCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144708763 Original CRISPR AAATCAGGTGGCCTCAAAGA AGG Intergenic
No off target data available for this crispr