ID: 1144708765

View in Genome Browser
Species Human (GRCh38)
Location 17:17386835-17386857
Sequence AGGTGGCCTCAAAGAAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144708756_1144708765 30 Left 1144708756 17:17386782-17386804 CCATCAGGCTCCTTGGAGGAAGC No data
Right 1144708765 17:17386835-17386857 AGGTGGCCTCAAAGAAGGGTTGG No data
1144708758_1144708765 20 Left 1144708758 17:17386792-17386814 CCTTGGAGGAAGCGTCTGGAATC No data
Right 1144708765 17:17386835-17386857 AGGTGGCCTCAAAGAAGGGTTGG No data
1144708759_1144708765 -2 Left 1144708759 17:17386814-17386836 CCTGTGTTGCACCATGAAATCAG No data
Right 1144708765 17:17386835-17386857 AGGTGGCCTCAAAGAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144708765 Original CRISPR AGGTGGCCTCAAAGAAGGGT TGG Intergenic
No off target data available for this crispr