ID: 1144708766

View in Genome Browser
Species Human (GRCh38)
Location 17:17386836-17386858
Sequence GGTGGCCTCAAAGAAGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144708758_1144708766 21 Left 1144708758 17:17386792-17386814 CCTTGGAGGAAGCGTCTGGAATC No data
Right 1144708766 17:17386836-17386858 GGTGGCCTCAAAGAAGGGTTGGG No data
1144708759_1144708766 -1 Left 1144708759 17:17386814-17386836 CCTGTGTTGCACCATGAAATCAG No data
Right 1144708766 17:17386836-17386858 GGTGGCCTCAAAGAAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144708766 Original CRISPR GGTGGCCTCAAAGAAGGGTT GGG Intergenic
No off target data available for this crispr