ID: 1144710217

View in Genome Browser
Species Human (GRCh38)
Location 17:17396594-17396616
Sequence ACGTCGGCTGGCATTCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144710217_1144710222 10 Left 1144710217 17:17396594-17396616 CCCTGGAGAATGCCAGCCGACGT No data
Right 1144710222 17:17396627-17396649 CATTCAAGCACCCTGTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144710217 Original CRISPR ACGTCGGCTGGCATTCTCCA GGG (reversed) Intergenic
No off target data available for this crispr