ID: 1144710304

View in Genome Browser
Species Human (GRCh38)
Location 17:17397353-17397375
Sequence GAGGAGAGACTGGCTGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144710294_1144710304 16 Left 1144710294 17:17397314-17397336 CCAGAATCAGAGTAATGGCCACT No data
Right 1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG No data
1144710298_1144710304 -2 Left 1144710298 17:17397332-17397354 CCACTTCCGGGGATACAAAGAGA No data
Right 1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG No data
1144710300_1144710304 -8 Left 1144710300 17:17397338-17397360 CCGGGGATACAAAGAGAGGAGAG No data
Right 1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144710304 Original CRISPR GAGGAGAGACTGGCTGGGAA AGG Intergenic
No off target data available for this crispr