ID: 1144710697

View in Genome Browser
Species Human (GRCh38)
Location 17:17399659-17399681
Sequence CTCTGGCCTCATCCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144710697_1144710704 7 Left 1144710697 17:17399659-17399681 CCTCCCTCAGGATGAGGCCAGAG No data
Right 1144710704 17:17399689-17399711 ACTAGCCCCCGTGAGTGCTCTGG No data
1144710697_1144710710 15 Left 1144710697 17:17399659-17399681 CCTCCCTCAGGATGAGGCCAGAG No data
Right 1144710710 17:17399697-17399719 CCGTGAGTGCTCTGGCCTGGTGG No data
1144710697_1144710706 12 Left 1144710697 17:17399659-17399681 CCTCCCTCAGGATGAGGCCAGAG No data
Right 1144710706 17:17399694-17399716 CCCCCGTGAGTGCTCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144710697 Original CRISPR CTCTGGCCTCATCCTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr