ID: 1144714042

View in Genome Browser
Species Human (GRCh38)
Location 17:17422021-17422043
Sequence AGGGTCCTGGAGAGGCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144714042_1144714054 13 Left 1144714042 17:17422021-17422043 CCATTGGGCCTCTCCAGGACCCT No data
Right 1144714054 17:17422057-17422079 TGGGTGGATCCACACACATGTGG No data
1144714042_1144714050 -3 Left 1144714042 17:17422021-17422043 CCATTGGGCCTCTCCAGGACCCT No data
Right 1144714050 17:17422041-17422063 CCTGCCCACCACATGGTGGGTGG No data
1144714042_1144714055 17 Left 1144714042 17:17422021-17422043 CCATTGGGCCTCTCCAGGACCCT No data
Right 1144714055 17:17422061-17422083 TGGATCCACACACATGTGGTTGG No data
1144714042_1144714046 -7 Left 1144714042 17:17422021-17422043 CCATTGGGCCTCTCCAGGACCCT No data
Right 1144714046 17:17422037-17422059 GGACCCTGCCCACCACATGGTGG No data
1144714042_1144714045 -10 Left 1144714042 17:17422021-17422043 CCATTGGGCCTCTCCAGGACCCT No data
Right 1144714045 17:17422034-17422056 CCAGGACCCTGCCCACCACATGG No data
1144714042_1144714047 -6 Left 1144714042 17:17422021-17422043 CCATTGGGCCTCTCCAGGACCCT No data
Right 1144714047 17:17422038-17422060 GACCCTGCCCACCACATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144714042 Original CRISPR AGGGTCCTGGAGAGGCCCAA TGG (reversed) Intergenic