ID: 1144715996

View in Genome Browser
Species Human (GRCh38)
Location 17:17436318-17436340
Sequence ATGCAGCCGGGGCTGCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144715989_1144715996 23 Left 1144715989 17:17436272-17436294 CCTCAGAAACAAAAATAAAAAAC No data
Right 1144715996 17:17436318-17436340 ATGCAGCCGGGGCTGCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144715996 Original CRISPR ATGCAGCCGGGGCTGCTTGT GGG Intergenic
No off target data available for this crispr