ID: 1144720513

View in Genome Browser
Species Human (GRCh38)
Location 17:17466395-17466417
Sequence TTGGCCAGTGACTGGTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144720513_1144720520 30 Left 1144720513 17:17466395-17466417 CCTGTAGACCAGTCACTGGCCAA No data
Right 1144720520 17:17466448-17466470 CCAGTGATGTTTCATCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144720513 Original CRISPR TTGGCCAGTGACTGGTCTAC AGG (reversed) Intergenic
No off target data available for this crispr