ID: 1144720658

View in Genome Browser
Species Human (GRCh38)
Location 17:17467456-17467478
Sequence ACATGGCCTCACATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144720649_1144720658 29 Left 1144720649 17:17467404-17467426 CCTGAGCCAAACACCATTTCTTA No data
Right 1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG No data
1144720650_1144720658 23 Left 1144720650 17:17467410-17467432 CCAAACACCATTTCTTATACCTT No data
Right 1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG No data
1144720652_1144720658 4 Left 1144720652 17:17467429-17467451 CCTTTCGTATCCTCACAGCACCT No data
Right 1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG No data
1144720653_1144720658 -6 Left 1144720653 17:17467439-17467461 CCTCACAGCACCTAATAACATGG No data
Right 1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG No data
1144720651_1144720658 16 Left 1144720651 17:17467417-17467439 CCATTTCTTATACCTTTCGTATC No data
Right 1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144720658 Original CRISPR ACATGGCCTCACATGGAGCA GGG Intergenic
No off target data available for this crispr