ID: 1144722751

View in Genome Browser
Species Human (GRCh38)
Location 17:17483594-17483616
Sequence TTAATTTTTCATTCAACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 372}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144722751_1144722756 19 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722756 17:17483636-17483658 TTTAAAGAATGAGGAAAGGGAGG 0: 1
1: 0
2: 7
3: 95
4: 994
1144722751_1144722754 15 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722754 17:17483632-17483654 TATTTTTAAAGAATGAGGAAAGG 0: 1
1: 0
2: 10
3: 99
4: 1078
1144722751_1144722758 24 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722758 17:17483641-17483663 AGAATGAGGAAAGGGAGGCTGGG 0: 1
1: 1
2: 11
3: 122
4: 1165
1144722751_1144722755 16 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722755 17:17483633-17483655 ATTTTTAAAGAATGAGGAAAGGG 0: 1
1: 0
2: 21
3: 129
4: 1272
1144722751_1144722753 10 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722753 17:17483627-17483649 TATGTTATTTTTAAAGAATGAGG 0: 1
1: 2
2: 0
3: 111
4: 984
1144722751_1144722759 29 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722759 17:17483646-17483668 GAGGAAAGGGAGGCTGGGCACGG 0: 1
1: 7
2: 39
3: 340
4: 2335
1144722751_1144722757 23 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG 0: 1
1: 1
2: 20
3: 284
4: 2946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144722751 Original CRISPR TTAATTTTTCATTCAACTGC GGG (reversed) Intronic
901466866 1:9427406-9427428 TTAATTTTTCATTTTTCTGAAGG + Intergenic
902106996 1:14046109-14046131 TAAATTTTTTATCAAACTGCCGG - Intergenic
905152422 1:35941371-35941393 ATAATTTTTCATACAGCAGCTGG + Intronic
905916539 1:41688502-41688524 TTAATTTTTGATACATCTCCAGG + Intronic
906935980 1:50214464-50214486 TTAATTATTCATTCAGTAGCAGG - Intergenic
907378750 1:54067250-54067272 ATCAATTTTCATTCAACTCCAGG - Intronic
908862514 1:68505619-68505641 TCAGTTTTTCATTCATCTCCAGG + Intergenic
909728669 1:78867573-78867595 TGAACTTTTCCTTCAACTACTGG - Intergenic
910140355 1:84020456-84020478 CAAATGTTTCTTTCAACTGCTGG - Intergenic
911005903 1:93223640-93223662 TCAATTTTCCATTTAACAGCAGG - Intronic
911316513 1:96362498-96362520 TTAATTTTTTATTAAACTCATGG - Intergenic
912023244 1:105134374-105134396 TTAATTTTTAATTACTCTGCTGG - Intergenic
912218766 1:107647964-107647986 TGACTTTTTCATTGATCTGCTGG + Intronic
912263883 1:108135328-108135350 TTAGATTTTCATTAAAATGCTGG + Exonic
912325719 1:108759561-108759583 TTAATTTTTCCTTCAATTAAAGG - Intronic
912435327 1:109657234-109657256 TGAATTTTTCATTCAGCCACTGG - Exonic
912437030 1:109668944-109668966 TGAATTTTTCATTCAGCCACTGG - Exonic
912439727 1:109688692-109688714 TGAATTTTTCATTCAGCCACTGG - Exonic
912443039 1:109713138-109713160 TGAATTTTTCATTCAGCCACTGG - Exonic
912559621 1:110540719-110540741 TTTATTTTTCATGCACCTGTAGG - Intergenic
913353651 1:117892762-117892784 TTTTTTTGTCATTCAGCTGCTGG - Intronic
913395496 1:118366543-118366565 GTATGTTTTCATTCCACTGCAGG + Intergenic
914940403 1:152017919-152017941 TTAATTATTCATTCACTTTCTGG + Intergenic
916547404 1:165818560-165818582 TTCATTTTTAATTCAACTTTTGG - Intronic
916556129 1:165895882-165895904 TTTATTCTTCATTCAACAGCAGG + Intronic
918007026 1:180550738-180550760 TTACTGTTTCATCCCACTGCTGG + Intergenic
918772500 1:188579672-188579694 TTAATTTTTCTTTTACGTGCAGG - Intergenic
918782518 1:188719776-188719798 TTAATTTTGTATTCTGCTGCTGG + Intergenic
919236275 1:194846967-194846989 TTAATTTTTCATTGAAATCTAGG + Intergenic
921428979 1:215041294-215041316 TTAATTTTTATTACAACTTCTGG - Intronic
924020846 1:239780011-239780033 TTATTTATTCATTCACCTACTGG + Intronic
924312160 1:242755240-242755262 TACATTTTTTTTTCAACTGCAGG + Intergenic
1063512462 10:6659318-6659340 TTAAGTTTTCAAGAAACTGCTGG + Intergenic
1063563888 10:7155073-7155095 TCAAGTTTACATTCAAGTGCAGG - Intergenic
1064828302 10:19431004-19431026 TTAATTTTTATTTCAAGTTCTGG + Intronic
1064904194 10:20327909-20327931 TTAATTTTTCTTTTAACAGATGG - Intergenic
1065191687 10:23217306-23217328 TTAATATTCCTTTCAGCTGCAGG - Intronic
1066131484 10:32398705-32398727 TTATTTATTCATTCTACTGTTGG + Intergenic
1068746344 10:60535008-60535030 GTAAATATTCATACAACTGCTGG + Intronic
1069103865 10:64358657-64358679 TTAATTCTTCATTCCTCTTCTGG + Intergenic
1069291561 10:66786425-66786447 TTAAGTTCTCTTTCAACTGCTGG + Intronic
1069715502 10:70518517-70518539 TAAATTTGTCATTCTAGTGCAGG + Intronic
1070494815 10:77011817-77011839 TTCATATTTCTTTAAACTGCTGG + Intronic
1071655905 10:87447625-87447647 TCAACTCTTCCTTCAACTGCAGG + Intergenic
1072222220 10:93336068-93336090 TTAATTTCTCATTAAAATGCAGG + Intronic
1074021333 10:109587290-109587312 TTATTTTTTCATTTCACAGCAGG - Intergenic
1074454115 10:113582543-113582565 TTAACTTTCCATACAACTTCAGG - Intronic
1074495416 10:113976051-113976073 TTAATCTTTCCTTCACCTGACGG + Intergenic
1077784014 11:5362901-5362923 TTAAGTTTTCTTTCTATTGCTGG + Intronic
1079885615 11:25984761-25984783 TTAATTTTTATTTCAACTAATGG + Intergenic
1080279285 11:30538124-30538146 TTAAATTTTCATTCAAATGTTGG - Intronic
1080527663 11:33143356-33143378 TTTATTTTTGCTTCAAGTGCTGG - Intronic
1081091227 11:38868173-38868195 TTAATTTTTCAGGGACCTGCTGG - Intergenic
1084503198 11:69547110-69547132 TGCATTTATCATTCAACTCCAGG + Intergenic
1085357821 11:75855390-75855412 TTAATTTATCATTAAAATGAAGG + Intronic
1086384773 11:86295924-86295946 TTATTTATTCATTCATCTGTTGG + Intergenic
1086577454 11:88356240-88356262 TCAATTATTCATTCAATTGTAGG - Intergenic
1087372927 11:97307432-97307454 TCAATCTTTGTTTCAACTGCTGG + Intergenic
1087895846 11:103585207-103585229 TACATTTTTCTTTCAACAGCTGG + Intergenic
1088209445 11:107437996-107438018 TTTTTTTTTCTTTCAACTTCAGG - Intronic
1088520470 11:110692906-110692928 TAAATTTTGCATGCAACTTCAGG + Intronic
1089277958 11:117352144-117352166 TTGATTTTTCTTTCAGCTTCTGG + Intronic
1090715378 11:129425878-129425900 TTAAGTTTTTATTTAACTGGAGG + Intronic
1091483707 12:862067-862089 TTCATTTTTCCTTCAGCTGATGG + Exonic
1092281152 12:7098570-7098592 TTGTTTATTCATTCAACTGATGG - Intronic
1093150957 12:15620791-15620813 TTAATTTTTTTTTAAACTGTTGG + Exonic
1094076923 12:26487218-26487240 TTTTTTGTTCATGCAACTGCTGG + Exonic
1094396596 12:30013540-30013562 TTAAATTTTCATTGAAGGGCAGG + Intergenic
1095785767 12:46107305-46107327 TTAATTTCTCAGTCAATTGTGGG + Intergenic
1096728617 12:53587009-53587031 TTAACTGTGCATTCAGCTGCAGG - Intronic
1096825687 12:54275641-54275663 GTAATTTTTCATTGAAATTCTGG - Intronic
1097332060 12:58342184-58342206 TTATTTTTTAACTCAACTGTGGG + Intergenic
1097590648 12:61571017-61571039 TCATTTTTTCATTCAACAGAAGG - Intergenic
1097737921 12:63202944-63202966 TTAATTATACATTCTACTGCTGG - Intergenic
1098878004 12:75887105-75887127 TTACTTTTTCACTCCAATGCAGG + Intergenic
1099553580 12:84079658-84079680 TGAACTTTGCATTAAACTGCTGG + Intergenic
1099645636 12:85351620-85351642 TGAATTTTACATTCAGCAGCAGG - Intergenic
1099993428 12:89751823-89751845 TGAATTTTTCATCAAACTGCAGG - Intergenic
1100101070 12:91106579-91106601 TTTATTTTTCATTTATCTTCTGG - Intronic
1100115995 12:91305028-91305050 TTAAATTTTCATTTTACTCCAGG + Intergenic
1100144207 12:91657345-91657367 TTTCTTTCTCTTTCAACTGCTGG - Intergenic
1102037146 12:109777645-109777667 TTAATTTCTCATGCAGCTGCCGG + Intergenic
1102868761 12:116395828-116395850 TTGATTATTCATTCAATTGATGG + Intergenic
1103856662 12:123974516-123974538 TAAATTTTTAATTAACCTGCGGG - Intronic
1106950325 13:34876225-34876247 GTAATTTTTCATTCAACTAGTGG - Intergenic
1107041057 13:35947928-35947950 TTCATTTTTCTTTCAACTAGAGG - Intronic
1107850010 13:44561899-44561921 TTATTCTTGAATTCAACTGCTGG + Intronic
1109297231 13:60549001-60549023 GTAAATTGTCATTCATCTGCTGG + Intronic
1109323664 13:60840343-60840365 TTCTTTATTCATTCACCTGCTGG + Intergenic
1109603911 13:64666762-64666784 TTATTTATCCATCCAACTGCTGG + Intergenic
1110486084 13:76044768-76044790 TCAACTTTTAATACAACTGCTGG + Intergenic
1110588120 13:77219423-77219445 TTCATTTTTCCTTTAGCTGCTGG - Intronic
1110813203 13:79833616-79833638 TTAATTTTTTTTTCAATTGATGG + Intergenic
1110918652 13:81056614-81056636 TTATTTTTTCACTCAACTCAAGG + Intergenic
1111593195 13:90376561-90376583 TTAATTTTTCTTTCAACTTAAGG + Intergenic
1111725554 13:92003936-92003958 TTAATTTTTTAATCCACTTCTGG - Intronic
1112776439 13:102848871-102848893 TTTATTTTTCAATTAACTACAGG - Intronic
1112822200 13:103350641-103350663 TTAATTAGTCATTCAAATGATGG + Intergenic
1112844498 13:103622753-103622775 TTAATTTGTCTTTCTACTGCTGG + Intergenic
1113257802 13:108525991-108526013 TTAATTCTGCATTCACCAGCTGG - Intergenic
1113955067 13:114095997-114096019 TTAATTTTTCACACAACGACTGG + Intronic
1114848564 14:26354209-26354231 TTAAGTTTTCACTGTACTGCTGG + Intergenic
1115923932 14:38409885-38409907 TTAATTTTTCATCACACTGGGGG + Intergenic
1116129897 14:40841962-40841984 TAAATTATTCATTCACTTGCAGG + Intergenic
1116676896 14:47918274-47918296 TTAATTTCTCTTTCAACTTGAGG - Intergenic
1117678326 14:58177959-58177981 GTAATTTTTCATTTAAATGATGG - Intronic
1117983589 14:61365623-61365645 TTGATTTTTTTTTAAACTGCAGG + Intronic
1118981675 14:70722152-70722174 TTACTTTTTAATTAAACTGAAGG - Intergenic
1118991903 14:70804655-70804677 TTAAATATTCATTTAAATGCAGG + Intronic
1120578118 14:86209366-86209388 TTAATTTTTCTTTTAAGTGTAGG - Intergenic
1122995916 14:105264006-105264028 GTAATTTTTCATTGAATCGCTGG - Intronic
1124681051 15:31731122-31731144 TTGATGTTTCAGTCAAATGCTGG + Intronic
1124937898 15:34189725-34189747 TTACTTTTTGAGTAAACTGCAGG - Intronic
1126367831 15:47914321-47914343 TTAATTATTCATTCATCAGTTGG - Intergenic
1127336912 15:57996002-57996024 TTTATTTTTCCCTCCACTGCCGG + Intronic
1127479054 15:59361575-59361597 ATAATTCTTCATTTAACTTCAGG - Intronic
1127947731 15:63771885-63771907 ATAATTTTTTTTTTAACTGCTGG - Intronic
1128411985 15:67408678-67408700 TTGATTTTTCATTCAAGTAGTGG - Intronic
1128694643 15:69751595-69751617 TTCTTCTTTCATTCAGCTGCTGG - Intergenic
1130730176 15:86483589-86483611 TTTATTTTTCATTCAGTTTCAGG + Intronic
1140317760 16:73915429-73915451 TTCATTTTTCAGTCATTTGCAGG + Intergenic
1140585236 16:76282802-76282824 TTAATTTTTCAAAAAACTGTAGG - Intronic
1141340311 16:83197546-83197568 ATAATTTTTCATTTAATTGAGGG - Intronic
1141767591 16:86068838-86068860 TTGTTTATTCATTCACCTGCTGG - Intergenic
1141886653 16:86896871-86896893 TTATTTTTTCATGCTACTGGTGG + Intergenic
1144142720 17:12365144-12365166 TTAATAATTCAATCTACTGCAGG + Intergenic
1144184163 17:12780874-12780896 TAAACTTTACATTCAACTTCTGG - Intergenic
1144722751 17:17483594-17483616 TTAATTTTTCATTCAACTGCGGG - Intronic
1144756769 17:17684392-17684414 TTAATTTTGCAATCCACTGATGG + Intronic
1147354331 17:39881806-39881828 TTAATTATTGATTCAATTTCTGG + Intergenic
1148745876 17:49917856-49917878 TGACTCTTTCATTGAACTGCAGG + Intergenic
1149315843 17:55437867-55437889 TAAATCTTTCATTCACATGCTGG + Intergenic
1149773876 17:59342234-59342256 TTGATTTCTCTTTAAACTGCTGG - Intronic
1149826391 17:59832491-59832513 CTATTTTTTCAGTCAACTGCAGG - Intronic
1151071161 17:71213741-71213763 TTCATTTTTCATTCATTTGTAGG - Intergenic
1151167201 17:72215062-72215084 TTATTTTTTTATTCTACTGGAGG - Intergenic
1151775813 17:76201002-76201024 TTAATTTTTTAGTGAACTACAGG - Intronic
1153302521 18:3603661-3603683 AAAACTTTTCATCCAACTGCCGG - Intronic
1153938854 18:9958718-9958740 CTTATTTTTCTTTAAACTGCAGG + Intronic
1154352116 18:13592719-13592741 TTAATGTTTCATTTAACTCTTGG + Intronic
1155916603 18:31563905-31563927 TTAATTCTTCATTCCACTGATGG + Intergenic
1155974483 18:32113457-32113479 TTAATTTTTTTGTCTACTGCTGG + Intronic
1156128803 18:33941986-33942008 TGTATTTTTCATTTAACTGAAGG + Intronic
1156455662 18:37292294-37292316 TTAGTTTTTCATTCCAGTACAGG + Intronic
1158569780 18:58588415-58588437 TTAATTTTTATTTTAACTTCTGG + Intronic
1158788593 18:60746486-60746508 TTAATTTTTCATTCAAATGAGGG - Intergenic
1160385061 18:78491857-78491879 GTATTTTTTCTTACAACTGCAGG + Intergenic
1164284294 19:23798916-23798938 TTAATTTTTTATCAAAGTGCTGG + Intronic
1166494586 19:43290039-43290061 TTTCTTTTTCATTCATCTACAGG + Intergenic
1167255570 19:48426113-48426135 TAATTCTTTCATTCTACTGCTGG + Intronic
925089824 2:1145125-1145147 ATAATTTTTTTTTCAACAGCAGG + Intronic
925437804 2:3856449-3856471 TTTATTTTTCATTCAACTCACGG - Intergenic
926531942 2:14058579-14058601 TTATTTTTTCACACAATTGCTGG - Intergenic
926556852 2:14367830-14367852 TTATTTATTTATTCAAATGCAGG - Intergenic
928405608 2:31012145-31012167 TTAATTTTTCACACTGCTGCTGG + Intronic
928590450 2:32809381-32809403 TTAATTTTACCGTGAACTGCAGG - Intronic
929289532 2:40173310-40173332 TTATTTTTTAAATCAAGTGCAGG - Intronic
929344872 2:40869818-40869840 TTTGTTTTTCATTCACCTACTGG + Intergenic
931535495 2:63271400-63271422 TTAATGTTTCACTCAACCACAGG - Intronic
932110661 2:68996262-68996284 TTATTTCTTTATTCTACTGCAGG - Intergenic
932218206 2:69980250-69980272 TTGATTTCTCAATCACCTGCAGG - Intergenic
933009520 2:77041661-77041683 TTACTTTTTCATACATCTGTTGG + Intronic
933287131 2:80396626-80396648 TTAATTTTTCCTACAATTACAGG + Intronic
933316048 2:80716640-80716662 TTAATTTCTCTTTCCACTGAAGG - Intergenic
933856216 2:86417057-86417079 ATAATTTTTCATTCAAGTACCGG + Intergenic
935824885 2:106936010-106936032 TTTATTTTTTCTTGAACTGCAGG + Intergenic
936530549 2:113273713-113273735 TTACTGTTTCATTTAATTGCAGG + Intronic
936757300 2:115730511-115730533 TGAAGTTTTCAGTCAACTGAGGG + Intronic
936890771 2:117367082-117367104 CTTATTTTTCATATAACTGCTGG + Intergenic
936996208 2:118416774-118416796 TTAATTTCTCATTAAACTATGGG + Intergenic
937519034 2:122688649-122688671 GTAATTTTTAATTCATCTCCAGG - Intergenic
938227868 2:129632635-129632657 TTATTATTTCCTACAACTGCAGG - Intergenic
939209379 2:139153103-139153125 TTAATTTTTTTTTTAACTTCAGG - Intergenic
940478473 2:154196445-154196467 TTAATTTTTTATTAATCTACTGG + Intronic
941295238 2:163730322-163730344 TAACTTTTTCATTTAACTTCTGG - Intronic
941462128 2:165784078-165784100 TTAATTCTTCTATCAACAGCTGG + Intronic
941624063 2:167810749-167810771 ATAATTTTTAATACAACTCCAGG + Intergenic
942526649 2:176860341-176860363 TTAATTTTTGATTTACATGCAGG - Intergenic
943432542 2:187822769-187822791 TTATTTGTTCATTCACCTACTGG - Intergenic
944657775 2:201893279-201893301 TTTATTTTTCATTCACTTCCAGG + Exonic
945450529 2:209989729-209989751 GTAATATTTCAGTCATCTGCAGG - Intronic
946671791 2:222112774-222112796 TTATTTATTCATTCCACTGTAGG + Intergenic
946776824 2:223151459-223151481 TTAATTTTTCATCCATCTTTGGG - Intronic
946797810 2:223374380-223374402 ATAATTTTTCATTTAATTACAGG - Intergenic
947967412 2:234292983-234293005 ATAATATTTCTTACAACTGCAGG - Intergenic
1169493681 20:6092681-6092703 TCTATTTTTCATTCAACAGAAGG + Intronic
1169549209 20:6684923-6684945 TTGATTTTTCTTACCACTGCTGG - Intergenic
1169986779 20:11453733-11453755 TGCTTTTTTCATTCAACTTCAGG - Intergenic
1170176903 20:13481306-13481328 TTCTTTATTCATTCATCTGCTGG + Intronic
1170342897 20:15349270-15349292 ATCCTTTTTCATTCATCTGCTGG + Intronic
1171914198 20:31000098-31000120 TTATATTTTCATTCAACTTACGG - Intergenic
1171942455 20:31344678-31344700 TTATTTTTTGTTTCAAATGCTGG - Intergenic
1173123049 20:40311572-40311594 TTCATTTGTCACTCAGCTGCAGG - Intergenic
1173154534 20:40596577-40596599 TTTATTTTTCATTAAAATGTTGG - Intergenic
1173344047 20:42182203-42182225 TTAATTTTTACTTCATCTGGAGG + Intronic
1173427723 20:42957348-42957370 TTAATTTTTCATATAGCTGTAGG + Intronic
1173466505 20:43286958-43286980 TAACTTTTTCATTCAACTCTTGG - Intergenic
1173528296 20:43749646-43749668 TTAATTTTTCTCTGAATTGCCGG - Intergenic
1174227685 20:49016052-49016074 TTATTTTTTTATTCCACTTCTGG + Intronic
1174957386 20:55114416-55114438 CTAAATTTTCATACTACTGCAGG + Intergenic
1179605149 21:42511026-42511048 TTAAATGTGCATTCAGCTGCTGG - Intronic
1183077425 22:35435856-35435878 TTCCATTTTCATTCAACTGGGGG - Intergenic
1185227652 22:49661978-49662000 TTAATTTTTAATTGAAATGATGG - Intergenic
949710511 3:6864896-6864918 TTGAATTTTCATTTGACTGCTGG + Intronic
950664033 3:14484065-14484087 TTTGTTTGTCTTTCAACTGCTGG + Intronic
950992387 3:17453059-17453081 TTATTTCTTCATTGACCTGCTGG - Intronic
951041249 3:17990967-17990989 TTAACTTTGCATTCATCTGTAGG + Intronic
951252580 3:20411322-20411344 TTAAAAATTCATTCAACTGATGG + Intergenic
951347836 3:21567560-21567582 TTAATTTTTCCGTCAGCTGGTGG - Intronic
951379324 3:21964010-21964032 TTAAATATTCATTTAATTGCGGG + Intronic
951861225 3:27254799-27254821 TTAATTTTTAAATTAACTGAAGG - Intronic
951875179 3:27416905-27416927 CAAATTTCTCATTCAACTGAGGG - Intronic
952282989 3:31941074-31941096 TGAATGTTTCATTCACCTGTCGG - Intronic
952910805 3:38183638-38183660 TTAAACTTTCATTCTAATGCTGG + Intronic
953833644 3:46324703-46324725 TTAATTTTCTATTCCACTTCTGG - Intergenic
955828287 3:62972927-62972949 TTCATTTTTATTTCAACTGGGGG - Intergenic
956522130 3:70117522-70117544 TTAACTTTTCAATCAATTGAAGG - Intergenic
956729163 3:72180891-72180913 TTAATTTTTTATTGAAATTCAGG - Intergenic
958600804 3:96294244-96294266 TTTATTTCTCATTCATCTGGAGG + Intergenic
958633225 3:96708014-96708036 TTAATTTTTCTTTCAATTATGGG - Intergenic
958664780 3:97122865-97122887 TTTATTTTTCATAAAACAGCAGG - Intronic
959481794 3:106882248-106882270 TTAATTCTTCATTAAACTTTTGG - Intergenic
959796220 3:110431544-110431566 TTATTTATTCATTCATCTGTTGG + Intergenic
960019160 3:112930463-112930485 TTAATTTTTCCTTTAAATGATGG - Intronic
961835286 3:129653073-129653095 TTTTTTTTTCATTCAACAGTGGG + Intronic
961871424 3:129991380-129991402 CTAATTGTTTATACAACTGCTGG + Intergenic
962243350 3:133770177-133770199 TGAGTTTTTCATTCATATGCTGG + Intronic
963576717 3:147069541-147069563 ATAATTTTTAATACAACTTCTGG + Intergenic
963818606 3:149862659-149862681 TTATTTTTTCATTCATTTGCTGG + Intronic
964106450 3:153045441-153045463 GCAATCTTTCATTTAACTGCAGG + Intergenic
964142009 3:153414142-153414164 TTCATTTTTCAATCGACTGAAGG + Intergenic
964517457 3:157528058-157528080 TTAATTTTTCATGCACTTGGGGG + Intronic
964985251 3:162730870-162730892 TTAATTTTTCAGTCCCCTGAAGG - Intergenic
965714990 3:171593553-171593575 TTCATTATCCATTCAACTGTTGG + Intergenic
966275547 3:178161647-178161669 TTTATTTTTAATTAAACTGATGG + Intergenic
966450777 3:180058798-180058820 TTAATTAATCATTCACTTGCTGG - Intergenic
970044773 4:11839498-11839520 TTCACTCTTCACTCAACTGCAGG + Intergenic
970877078 4:20884074-20884096 GAAATGTCTCATTCAACTGCTGG + Intronic
971679749 4:29681764-29681786 TTTATTTATGATTCCACTGCAGG + Intergenic
971851582 4:31991930-31991952 TTAATTATTCAAACAACTGCTGG - Intergenic
973663426 4:53132705-53132727 TAAAATTTTCATTCAAGTGTGGG + Intronic
973727489 4:53790679-53790701 TTAAGTCTTTATTCAGCTGCAGG - Intronic
974396959 4:61349745-61349767 TTATTTTTCCATTAAACTGCGGG + Intronic
974621299 4:64359179-64359201 ATACTTTTTCTTTCAACAGCCGG - Intronic
974751695 4:66150396-66150418 TTACCTTTTGAGTCAACTGCAGG + Intergenic
974752399 4:66157374-66157396 TTATTTATTCATTCATGTGCTGG + Intergenic
974967336 4:68777348-68777370 TTAATTTCTCAGTCAATTGATGG + Intergenic
975263943 4:72339619-72339641 TCATTGTTTCATTCAGCTGCTGG + Exonic
975801050 4:78059047-78059069 TTCATTATTCATCCAGCTGCGGG + Intronic
975913141 4:79292555-79292577 TTAATCCCTCATTCAACAGCAGG - Intronic
976638418 4:87311475-87311497 TTAAATTCTCATTAAACTGCAGG - Intronic
977773366 4:100886553-100886575 TTATTTTTTCATTGACCTACTGG + Intergenic
977886963 4:102262927-102262949 ATAATTTTGCTTTCAACTGTAGG - Exonic
978603950 4:110458808-110458830 TTTATTTTTAAGTCAATTGCAGG + Intronic
979001792 4:115230453-115230475 TTTAATTTTCATTAAACTGTAGG - Intergenic
979092979 4:116510514-116510536 TTTATTTTTTTTTCAACTGGGGG + Intergenic
979095595 4:116546001-116546023 TTCATTTTTTATTTAACTTCTGG + Intergenic
979514378 4:121590262-121590284 TTAATTTCCCATTCAATTTCTGG + Intergenic
979556622 4:122055338-122055360 ATTTTTTTTCATGCAACTGCAGG + Intergenic
979568644 4:122187712-122187734 TTAAATTTTCTTTTAACTACTGG + Intronic
979815180 4:125092243-125092265 TTTATTTTTCATTCTTCTTCAGG - Intergenic
979987128 4:127329061-127329083 TTCATTTTTCTTTCAACTCTGGG - Intergenic
980435127 4:132762801-132762823 TAAATTTTTCATCCAACTTATGG - Intergenic
980708754 4:136536404-136536426 TTAATTTGTCAATCAAGTGATGG + Intergenic
981420027 4:144538842-144538864 TTAATTTTTACCTCAACTTCAGG + Intergenic
981639658 4:146926331-146926353 TAAGTTTTTCTTTCAACTTCTGG - Intronic
982088254 4:151858132-151858154 TTAATGTGTCCCTCAACTGCAGG + Intergenic
983305167 4:165975464-165975486 TTATTTTTTCCTTAAACAGCTGG - Intronic
983461125 4:168027108-168027130 TTCATTTTCCATTCATCTGTGGG + Intergenic
983563685 4:169127296-169127318 TTCATTTTTTATTCTACTGGTGG + Intronic
984027524 4:174561046-174561068 CTAATTTTTCATTCAAAAACTGG + Intergenic
984344208 4:178500905-178500927 TTAATTTTTCTTTTAGCTTCTGG - Intergenic
984684329 4:182648956-182648978 TTGTTTTTCCATTCTACTGCTGG + Intronic
986431595 5:7686579-7686601 TTAAGTTGTCATTAAACTGATGG - Intronic
986811403 5:11363260-11363282 CTAATTTTTCATTAAATTCCTGG + Intronic
986926908 5:12765884-12765906 TTTATTATTCATTCTACTGTTGG + Intergenic
987155444 5:15084618-15084640 TTAATTCTCTATGCAACTGCTGG - Intergenic
987774767 5:22349907-22349929 TTAATCTTTCAATGAACTACTGG - Intronic
989618412 5:43360298-43360320 TTAATTTTAGGTTCAAGTGCAGG + Intergenic
991328732 5:65467118-65467140 GTAATTTTTTAATCAACTGAAGG + Intronic
991623842 5:68576497-68576519 TTATTTCTTCATTCACCTACTGG + Intergenic
992471113 5:77055381-77055403 TTAATGTTTATTTCAACTTCTGG + Intronic
993534987 5:89072813-89072835 TTATTTTCTCATTAAAATGCAGG + Intergenic
993929756 5:93923425-93923447 TTTATTATTTTTTCAACTGCAGG + Intronic
994733744 5:103525873-103525895 TTTTTTTTACATTAAACTGCAGG + Intergenic
996042677 5:118833333-118833355 TTTTTTTTTCATTTACCTGCTGG + Intergenic
997154179 5:131534498-131534520 TTAATTTTATATTTAAATGCGGG - Intronic
998192354 5:140037595-140037617 TTAAATTTTCTTTCAACAGAGGG - Intronic
998201314 5:140125160-140125182 ATAATTTTGCATACAACTTCAGG + Exonic
998324362 5:141266320-141266342 AAAAGTTTTCATTGAACTGCAGG + Intergenic
998341487 5:141421758-141421780 TTACTTTTCCTTGCAACTGCGGG + Exonic
998572841 5:143279798-143279820 TTCTGTTGTCATTCAACTGCTGG + Intronic
1000524291 5:162336503-162336525 TAATTTTTTCTTTCAATTGCTGG + Intergenic
1001791686 5:174463197-174463219 ATAATTGTTCAGTCAACTGGAGG + Intergenic
1002667589 5:180837119-180837141 TTAATTCTTCATCCAGCTGATGG - Intergenic
1003296835 6:4837238-4837260 ATAATTTATCATTCAAATGGAGG + Intronic
1003433531 6:6063651-6063673 TTAATTTTTAATTTAAGTTCCGG + Intergenic
1003656655 6:8017451-8017473 TCCCTTTTTCATTCAAGTGCTGG - Intronic
1005016482 6:21379690-21379712 TTAATTTTTCAGTCAAGTAGAGG + Intergenic
1007255290 6:40524042-40524064 TTTAATTTTCCTGCAACTGCTGG - Intronic
1008013735 6:46494361-46494383 TTATTTGTTCATTCACCTGTTGG + Intergenic
1008152490 6:47971408-47971430 GTATTTTTTCATTCTTCTGCTGG - Intronic
1009404594 6:63296697-63296719 TTAATTGTTTATTCAGTTGCAGG - Intronic
1009759703 6:67988698-67988720 TTAATGTTTCCTACAACTGTAGG - Intergenic
1009862567 6:69353755-69353777 TTACTTTTTAATACAAATGCTGG - Intronic
1010127784 6:72453923-72453945 TTCTTTATTCAGTCAACTGCTGG - Intergenic
1010361352 6:74998276-74998298 TTAATTTGTCATTGAAGTGGAGG - Intergenic
1010760858 6:79721328-79721350 TTAACTTTAAATTCAACTACAGG + Intergenic
1010974036 6:82293062-82293084 TTAATTTCTCAGGTAACTGCAGG + Intergenic
1011768700 6:90652287-90652309 TTTATTTTTCACCCCACTGCGGG - Intergenic
1012269885 6:97195646-97195668 TTGATTTTTCTTTTAACAGCAGG - Intronic
1012753053 6:103187204-103187226 TTAATTTTTTTTTCAATAGCTGG + Intergenic
1013416756 6:109932448-109932470 TTAATATTTAATGAAACTGCTGG + Intergenic
1013534076 6:111047368-111047390 TGAATTTTTCATTCAGCCACTGG + Intergenic
1013828436 6:114243561-114243583 TTAATTTTCCAAGCAAGTGCTGG + Intronic
1016056461 6:139582875-139582897 TTAATTTTCCCTTTCACTGCAGG - Intergenic
1017575195 6:155794478-155794500 TTGCTTTTTCATTCAGCTTCTGG - Intergenic
1017774046 6:157666340-157666362 TTAATAAATCATGCAACTGCTGG - Intronic
1021663128 7:22941849-22941871 TTAATTTTTCATACAAAGACTGG + Exonic
1022589183 7:31644747-31644769 TTAATTTTTTAATCAATGGCTGG - Intronic
1023669042 7:42556738-42556760 ATAATTTTTCATACAACTTTGGG - Intergenic
1024137601 7:46426496-46426518 TTTCTTTTTCATTCAAGTGGAGG - Intergenic
1027573071 7:79896219-79896241 TTAATTTCTCCTTCATCAGCCGG + Intergenic
1027666285 7:81045665-81045687 TTATTTTTTCATAGAACTACTGG + Intergenic
1028652411 7:93165413-93165435 TTTATCTTTCCTTCAACTGTTGG - Intergenic
1028840949 7:95429714-95429736 TGAAATTTACATACAACTGCTGG + Intronic
1029193330 7:98787107-98787129 TTTATATTTCAGTCAAGTGCCGG - Intergenic
1030680846 7:112432273-112432295 TTAATTTTTCATTCATTTATTGG + Intronic
1031510519 7:122643296-122643318 ATAATTTTTGATTCAAGTGATGG - Intronic
1033571645 7:142635198-142635220 TTATTTTTTCATTCAACATTAGG - Intergenic
1033786594 7:144738791-144738813 GTAATTTTTCATTAAGATGCTGG + Intronic
1033879848 7:145867900-145867922 TTAATTTTCCTTTCATCTTCTGG + Intergenic
1033964746 7:146961174-146961196 TTACATTTTCATTCCCCTGCTGG + Intronic
1034117511 7:148597044-148597066 TTATTTTTTCATTTACCTACTGG + Intronic
1036120279 8:6009364-6009386 TTATTTTTTCATTCATCTGAAGG - Intergenic
1037118749 8:15257582-15257604 TTATTTATTGATTCAACTTCAGG + Intergenic
1037153812 8:15674907-15674929 TTAATTTTTCACACAAATGCTGG + Intronic
1037190034 8:16113320-16113342 TTTATTTTTCATGGAAATGCTGG - Intronic
1037321439 8:17647016-17647038 TCAATTCTTCATTCTCCTGCTGG + Exonic
1040663460 8:49602448-49602470 TGATTTTTTCATACAACTGTTGG + Intergenic
1041187068 8:55311956-55311978 TTAATTTTTAATTCAGTAGCTGG - Intronic
1042105551 8:65322745-65322767 TTGATTTTTCATTTTACTGTTGG - Intergenic
1042570935 8:70163872-70163894 TTCATTTTTTTTTCTACTGCTGG - Intronic
1043017931 8:74964118-74964140 TTAATATTTCATTCACATGATGG + Intergenic
1043285312 8:78520768-78520790 TTAATTTTGCATACAAATGCAGG + Intronic
1043817973 8:84826479-84826501 TAAATTTTTCATTAAGCTACTGG - Intronic
1044204478 8:89476432-89476454 TGAATTTATCATTAAACTGTAGG + Intergenic
1044238429 8:89858532-89858554 CTATTTTTTCATTCTACTGTTGG + Intergenic
1045338695 8:101232678-101232700 TTAATTTTATATGCAACTGCTGG + Intergenic
1046292495 8:112181270-112181292 TTTGTTTTTCATTCACTTGCAGG + Intergenic
1046617509 8:116493640-116493662 GTAATTTTTTATTCCAGTGCTGG - Intergenic
1046644756 8:116773987-116774009 TTATTTTTTCATACAACTTGGGG + Exonic
1046972938 8:120242940-120242962 TTACTTTTCGATTCAAGTGCTGG - Intronic
1047112017 8:121801213-121801235 TTAATTTTTCCTTAAAATTCAGG + Intergenic
1047638004 8:126787132-126787154 TCAATTTTCCATTTAAGTGCAGG + Intergenic
1047881608 8:129200579-129200601 TTAATTTTTCTTTCCCCTTCTGG + Intergenic
1049092643 8:140528103-140528125 GTAATTTTACATTGATCTGCGGG - Intergenic
1049650525 8:143765834-143765856 TTACTGATTCATTCTACTGCTGG + Intergenic
1049866376 8:144940441-144940463 TTGTGTTTTCATTCATCTGCAGG + Intronic
1050573767 9:6970485-6970507 TTAATATTTGATTAAAGTGCTGG + Intronic
1050789832 9:9453601-9453623 TTTATATTTCAGTCAAGTGCAGG + Intronic
1051051598 9:12939564-12939586 TGAGTTTTTCACTTAACTGCAGG - Intergenic
1051885012 9:21883344-21883366 TTAATTTTTTGTTCAACTGATGG - Intronic
1052432898 9:28390247-28390269 TTAATTTTGTAGTCATCTGCTGG - Intronic
1052884174 9:33627431-33627453 TTATTTTTTCATTCAACATTAGG - Intergenic
1056297649 9:85208455-85208477 TACATATTTCATTAAACTGCAGG - Intergenic
1056485448 9:87052562-87052584 TTTTTTTTTCATTCAACTTATGG + Intergenic
1056489725 9:87093671-87093693 TTAATTTTTATTTCAAGTTCAGG + Intergenic
1056499699 9:87196782-87196804 TTAATTTCTCATCCAAATCCTGG - Intergenic
1057340420 9:94196742-94196764 TTTATTTTTTATTCAATTGTTGG + Intergenic
1057573371 9:96220319-96220341 TTATTTATTCATTCAGCTGTTGG - Intergenic
1059533969 9:115063955-115063977 GTACTTTTTCATTCAGGTGCAGG - Exonic
1059596927 9:115730872-115730894 TTCATTTTTCTTTTAAGTGCAGG + Intergenic
1059946740 9:119416836-119416858 TTTACTGTTCACTCAACTGCAGG + Intergenic
1062139490 9:134948019-134948041 TTAGTTTCTCATGCAGCTGCAGG - Intergenic
1185497895 X:571671-571693 TTAATTTTGCATACAAAAGCTGG + Intergenic
1185958282 X:4517138-4517160 TAAAATTTTCATTCATCAGCTGG - Intergenic
1189482261 X:41401338-41401360 TTAATTTTTCATTTCACTGTAGG - Intergenic
1189497362 X:41521115-41521137 TTAATTTGTCATCCAAGGGCAGG - Intronic
1192138442 X:68628625-68628647 TTAATTTTTCATTAAACATTTGG + Intergenic
1193071660 X:77312509-77312531 TAAATTTTTCATTCAACCAATGG - Intergenic
1193385167 X:80861581-80861603 TTAATTTTTCATTGACCCACTGG + Intergenic
1194092401 X:89594157-89594179 TTAATTTTTCATTTATTTTCTGG - Intergenic
1194338446 X:92679087-92679109 TTCTTTTTTCATTGAACTGCTGG + Intergenic
1194419472 X:93655693-93655715 TTATTTTTCCATTCATCTGTTGG - Intergenic
1194501569 X:94688073-94688095 TAACTTTTTCATTCAACTCTTGG - Intergenic
1194646226 X:96461688-96461710 TACATTTTTCATTCAATTGGGGG - Intergenic
1195232671 X:102866875-102866897 GCAATTTTTCATTTATCTGCAGG - Intergenic
1195362057 X:104092316-104092338 TTATTTATTCATTCTACTGTTGG + Intergenic
1195628738 X:107031581-107031603 TCACTTTTTCCATCAACTGCTGG + Intergenic
1196344230 X:114633332-114633354 ATAATACTTCATTCAACTACAGG - Intronic
1196779174 X:119367158-119367180 TTATTTTTCTATTCAACTGGTGG + Intergenic
1197500770 X:127239555-127239577 TCAATTTTACATTCTACTGAGGG + Intergenic
1197525363 X:127555699-127555721 TTAATTTTTACTTGAATTGCGGG + Intergenic
1197899217 X:131351597-131351619 AGAATTTTTCATCCAAATGCAGG - Intronic
1199068614 X:143449844-143449866 TTAATTTTTCATATAGATGCTGG - Intergenic
1199381051 X:147173008-147173030 TTAATTTTTCTTTCACCTGGAGG + Intergenic
1200445033 Y:3250193-3250215 TTAATTTTTCATTTATTTTCTGG - Intergenic
1200646850 Y:5795870-5795892 TTCTTTTTTCATTGAACTGCTGG + Intergenic
1202347732 Y:23952592-23952614 TTAACTTTTCATTAAATTGAAGG - Intergenic
1202523040 Y:25717499-25717521 TTAACTTTTCATTAAATTGAAGG + Intergenic