ID: 1144722752

View in Genome Browser
Species Human (GRCh38)
Location 17:17483595-17483617
Sequence TTTAATTTTTCATTCAACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 792
Summary {0: 1, 1: 1, 2: 3, 3: 64, 4: 723}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144722752_1144722757 22 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG 0: 1
1: 1
2: 20
3: 284
4: 2946
1144722752_1144722754 14 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722754 17:17483632-17483654 TATTTTTAAAGAATGAGGAAAGG 0: 1
1: 0
2: 10
3: 99
4: 1078
1144722752_1144722756 18 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722756 17:17483636-17483658 TTTAAAGAATGAGGAAAGGGAGG 0: 1
1: 0
2: 7
3: 95
4: 994
1144722752_1144722755 15 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722755 17:17483633-17483655 ATTTTTAAAGAATGAGGAAAGGG 0: 1
1: 0
2: 21
3: 129
4: 1272
1144722752_1144722759 28 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722759 17:17483646-17483668 GAGGAAAGGGAGGCTGGGCACGG 0: 1
1: 7
2: 39
3: 340
4: 2335
1144722752_1144722758 23 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722758 17:17483641-17483663 AGAATGAGGAAAGGGAGGCTGGG 0: 1
1: 1
2: 11
3: 122
4: 1165
1144722752_1144722753 9 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722753 17:17483627-17483649 TATGTTATTTTTAAAGAATGAGG 0: 1
1: 2
2: 0
3: 111
4: 984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144722752 Original CRISPR TTTAATTTTTCATTCAACTG CGG (reversed) Intronic
901515048 1:9739669-9739691 TTTAATTTTTTATAAAAATGGGG - Intronic
903397836 1:23015608-23015630 TTTTATTATCCATTCATCTGTGG - Intronic
903765323 1:25730472-25730494 TTTAATTGTTCAGTCACATGAGG + Intronic
904481174 1:30794367-30794389 TTTGTTTTTCCATTCACCTGTGG - Intergenic
905022678 1:34828567-34828589 TTTACTTCCTCATTCAACCGAGG - Intronic
905834314 1:41104172-41104194 TTCAATCATTCAATCAACTGGGG + Intronic
906229155 1:44146174-44146196 TTTAATAATTCCTTAAACTGGGG - Intergenic
906414627 1:45611197-45611219 TTTAATTTTTCCTACAAATTGGG - Intronic
906741092 1:48186154-48186176 TTTCATCTTTCATTCAATAGTGG - Intergenic
907030874 1:51170190-51170212 TATAATTTTTCAGTCAACAATGG + Intergenic
907228952 1:52977026-52977048 TGTATTTATTCATTAAACTGTGG + Intronic
908108195 1:60867806-60867828 TTAAATTTTTCTTTCAGCTGGGG - Intronic
908421873 1:63966755-63966777 TTTAGCTTTCCTTTCAACTGAGG + Intronic
909119121 1:71578333-71578355 CTTAATTCTTCATTGATCTGGGG + Intronic
909243351 1:73243478-73243500 TTTTATTATTGATTCAACTTTGG - Intergenic
909266517 1:73565678-73565700 TTTATTTTTGCATTCAAATTGGG - Intergenic
909345217 1:74577233-74577255 TTTTTTTTTTCTTTCAACTAAGG - Intronic
909902838 1:81159850-81159872 TTTTATTTTTTATTCAGATGGGG + Intergenic
910085970 1:83402833-83402855 TTTGTTTATTCATTCATCTGTGG - Intergenic
910355486 1:86348011-86348033 TTTAATCTTTTATTTAACTAAGG + Exonic
910774883 1:90864843-90864865 TTAAATTTTTCATACAGATGGGG - Intergenic
910971331 1:92859074-92859096 TGAAATTATTCATTCAACTCGGG - Intronic
911280882 1:95927164-95927186 GTTAATTTTAGATTAAACTGGGG - Intergenic
911584934 1:99679721-99679743 TTTAAGTTTTCTTTCTACAGTGG + Intronic
911649128 1:100367344-100367366 TTTCATTTTTCCCTCAACTCTGG + Intronic
911813868 1:102317953-102317975 TTTATGTTATCATTCAACCGAGG - Intergenic
911921828 1:103772938-103772960 TTTATTTATTCATTCTACTGTGG - Intergenic
912188652 1:107311894-107311916 TTTAGTTTTTCACTCACTTGTGG - Intronic
912216616 1:107620960-107620982 TATAATTTTCCATTCAAATCAGG + Intronic
915707951 1:157864280-157864302 TTTAATTTCTAATTCACCTTGGG - Intronic
915889182 1:159755646-159755668 TTTCATTTTTTTTTCAAATGAGG - Intergenic
915965139 1:160300425-160300447 ATTTATTTTTGATTCAACTTTGG - Intronic
916307445 1:163353823-163353845 CTTAATGTTTCATTCACTTGTGG + Intronic
916319337 1:163486091-163486113 TTTAATTTTTCCTTCCTCTCTGG + Intergenic
916420532 1:164633960-164633982 TTTAATCTTCCATTCAATTGAGG + Intronic
916876548 1:168975780-168975802 TTTGATTTTTCTTTTAATTGAGG - Intergenic
917004578 1:170398980-170399002 CTTACTTTATCATTCAACTGAGG + Intergenic
917022594 1:170605687-170605709 TCTAATTTTTCAGTCTAATGAGG + Intergenic
917240593 1:172944111-172944133 TTTAATTTTTTTTTCTACAGAGG + Intergenic
917931759 1:179827369-179827391 TTTACTTATCCATTCATCTGTGG + Intergenic
918083142 1:181222657-181222679 TTTAATTTTGTATGCTACTGGGG + Intergenic
918150205 1:181791766-181791788 TTTAAATTCTGATTCATCTGTGG + Intronic
918934451 1:190902354-190902376 TTTAATTTTCCATTCACCTAAGG - Intergenic
919255653 1:195119958-195119980 TTCAATTTCTGATTCACCTGTGG - Intergenic
919270359 1:195334656-195334678 TTAAATGCTTCATTCAACTTAGG + Intergenic
920693199 1:208162437-208162459 TTTTATATATCAGTCAACTGAGG - Intronic
920916379 1:210261361-210261383 TATAATTTATCATTTAAATGAGG - Intergenic
922554917 1:226525579-226525601 TATAATTTGTCATTCAAACGGGG + Intergenic
923152637 1:231247287-231247309 TTTATTTTTTCATTCTACAGTGG + Intronic
923396466 1:233570075-233570097 TTTAATTTTCTATTAAAGTGTGG + Intergenic
923900938 1:238325805-238325827 TTTAAGTTTTCATTCCTGTGTGG - Intergenic
924711256 1:246531730-246531752 TTTCCTTTTCCATTCATCTGTGG - Intergenic
1063181913 10:3609807-3609829 TTTCTATTTTCATTCCACTGTGG - Intergenic
1063259545 10:4370436-4370458 TCTACTTTTTCACTCATCTGGGG - Intergenic
1063431406 10:5992429-5992451 TGTTGTTTTTCATTCATCTGGGG - Intergenic
1063558542 10:7104234-7104256 TTTAATTTTTATTTCAAGTTTGG + Intergenic
1063763078 10:9103068-9103090 GTTAATGTGTCATTAAACTGGGG - Intergenic
1063935505 10:11073625-11073647 TTTTATATTTCACTCAATTGTGG + Intronic
1064168804 10:13010717-13010739 TTTATTTTTTCATGTACCTGTGG - Intronic
1064326369 10:14355044-14355066 TCAATTTTCTCATTCAACTGTGG - Intronic
1064356278 10:14621505-14621527 TTTAATTTTTCCTTGCCCTGTGG - Intronic
1064831455 10:19471880-19471902 TTTACTTTTTCTTTCAAATTTGG + Intronic
1065448978 10:25835556-25835578 TTCACTTTTTCATTTAACAGAGG + Intergenic
1065465563 10:26017149-26017171 TTTGATTTTTCATTAAATTTAGG + Intronic
1065908417 10:30280086-30280108 TTTATTTTTACATAAAACTGAGG + Intergenic
1066038250 10:31517038-31517060 TTTAAGTTTCCAATCTACTGTGG - Intronic
1066335124 10:34468812-34468834 TTAAATATTTCTTTCAACTTTGG - Intronic
1066619902 10:37336443-37336465 TTTTGTTCTTCATTCTACTGAGG + Intronic
1067455051 10:46413140-46413162 CTTAATTTTCCATTCACCTGAGG + Intergenic
1067632153 10:47971494-47971516 CTTAATTTTCCATTCACCTGAGG - Intergenic
1067818573 10:49504895-49504917 TTTAATTTTTCTCTCCATTGGGG - Intronic
1068051987 10:51961927-51961949 CTTAATTTTTTATTTAACTGGGG - Intronic
1068055546 10:52008611-52008633 TTTTATTATTGATTCAACTTTGG - Intronic
1068227227 10:54121101-54121123 TTTCTATTTTCATTCCACTGGGG - Intronic
1068268570 10:54688122-54688144 TTTATTTTTTAATTTAATTGAGG - Intronic
1068492387 10:57739956-57739978 TTAAATTTTTCATTCCTATGAGG - Intergenic
1068562777 10:58534586-58534608 ATTTATTTTTCATTTAACTGGGG - Intronic
1068941021 10:62681490-62681512 TTTTTTTTTTCATTCACTTGAGG + Intergenic
1069211888 10:65772120-65772142 TTTAATTTTTCATTCAGAATTGG - Intergenic
1069336862 10:67362107-67362129 TTTTATTATTGATTCAACTTTGG - Intronic
1069436476 10:68388660-68388682 TTTTATTTTTCATAGAGCTGGGG - Intronic
1069561520 10:69434272-69434294 TTTCTTTCTTCATTCATCTGTGG + Intergenic
1069847419 10:71382255-71382277 TTTGATCTTTCAGCCAACTGAGG - Intergenic
1069866165 10:71504439-71504461 TTTGATTATCCATTCATCTGTGG + Intronic
1070241716 10:74688741-74688763 TTTAATTTTTGATACCAATGGGG - Intronic
1070276382 10:75011788-75011810 TTTCATTAAACATTCAACTGAGG - Intronic
1070427251 10:76301105-76301127 TTAAATTTTTAATATAACTGAGG - Intronic
1070427527 10:76304118-76304140 TTTAATTACTCATTCATCAGAGG + Intronic
1071004705 10:80869323-80869345 TTAAATTTCTCATTCAAATTAGG - Intergenic
1071166482 10:82813833-82813855 TTTAATTTTTAAAGTAACTGAGG + Intronic
1071255203 10:83866098-83866120 TGTAATTTATCCTTCAGCTGTGG - Intergenic
1071931949 10:90482301-90482323 TTTACTTATGCATTCATCTGTGG + Intergenic
1072403473 10:95128306-95128328 TTTTCTTTTTCATTCATCTGTGG + Intergenic
1072463206 10:95639157-95639179 TTTAATTTTTCATAGATATGGGG - Intronic
1072849257 10:98870239-98870261 TTAAATTATACATTCAACTTTGG - Intronic
1073299929 10:102464944-102464966 TTGTATTTTTCATAGAACTGGGG - Intronic
1073387381 10:103136954-103136976 TTTATTTTTTCATTATTCTGTGG + Intronic
1073407029 10:103307269-103307291 TTTTATTTTTCATAGAAATGGGG - Intronic
1074611489 10:115026347-115026369 TTTAACTAGTCATTCATCTGGGG - Intergenic
1074719005 10:116248574-116248596 TTTTGATTTTCCTTCAACTGTGG - Intronic
1074935148 10:118170871-118170893 TTTAAATTTTATTTCAGCTGGGG + Intergenic
1075153298 10:119954147-119954169 TTTTATTTCTGATTCAACTCTGG + Intergenic
1075965106 10:126604406-126604428 TATTTTTTTTCTTTCAACTGAGG - Intronic
1076022681 10:127087257-127087279 TATAATTTTTCATGCAGCAGAGG + Intronic
1076129217 10:128001460-128001482 TTTAAATTTCCATTAAAATGGGG - Intronic
1077258503 11:1601869-1601891 TTGCATTTTTCTATCAACTGAGG - Intergenic
1079627420 11:22633206-22633228 ATTTATTTTTTATTCAAATGTGG + Intronic
1079744863 11:24112586-24112608 ATTTATTTTTCAATCAGCTGAGG + Intergenic
1079848943 11:25505076-25505098 TTTAAATTCTGATTCAATTGTGG + Intergenic
1079917920 11:26394263-26394285 TTTCAGTTCTCATTCATCTGAGG - Intronic
1079983732 11:27178511-27178533 CTTAATTTTTCATTCAGTTATGG + Intergenic
1080107941 11:28531076-28531098 TTGTACTTTTCATTCAACTGTGG + Intergenic
1080167670 11:29259373-29259395 TTTTGATTTTCATTCTACTGTGG + Intergenic
1080651251 11:34224314-34224336 TTTAATTTTTCATAGCAATGGGG + Intronic
1080728470 11:34921091-34921113 TTTGAATTCTCATTTAACTGTGG + Intronic
1081000998 11:37671353-37671375 TTTGCTTTTTCATTCTACTTGGG - Intergenic
1081468155 11:43344408-43344430 TTAAGTTTTTCATTCAAATTCGG - Intronic
1082949702 11:58799476-58799498 TTTATATTTTTATTCCACTGTGG - Intergenic
1084280780 11:68090564-68090586 CTTAATTTTTAATTAAACTGGGG + Intronic
1084407765 11:68986924-68986946 TTTAATTTTTTGTTAAACAGTGG + Intergenic
1084552668 11:69855856-69855878 TTTTAAATTTCATTCCACTGTGG + Intergenic
1084659923 11:70540629-70540651 TTTAATTTTTAACTGTACTGCGG + Intronic
1085876247 11:80409210-80409232 TTTATATTTTTATTCCACTGTGG - Intergenic
1086101737 11:83107672-83107694 TTTAATTTTTCATATAAATTTGG + Intergenic
1086117201 11:83265411-83265433 TTTCATTTTTTTTTCCACTGTGG + Intronic
1086280676 11:85183850-85183872 TTTATTTTTTCCTTCCATTGAGG - Intronic
1086472531 11:87130664-87130686 TCTAATTTTTTATTTAATTGTGG + Intronic
1087516307 11:99166775-99166797 TTTGTTTTTTCATTTCACTGTGG + Intronic
1087604280 11:100357317-100357339 TTGAATTTTTAATTAAGCTGTGG + Exonic
1087706096 11:101493585-101493607 TTTGATTTTTGAAACAACTGAGG + Intronic
1087714035 11:101586185-101586207 TATAATTTTTGAATCAACTATGG + Intronic
1087955483 11:104281635-104281657 TTTATTTATCCATTCACCTGTGG + Intergenic
1089239060 11:117059045-117059067 TTTATTTTCTCATTTCACTGAGG - Intronic
1090161723 11:124502212-124502234 TTTTTTTTTTTCTTCAACTGGGG - Intergenic
1090317796 11:125811197-125811219 TTTCTTTATTCATTCATCTGTGG + Intergenic
1090630259 11:128640113-128640135 TTTCTATTTTCATTCCACTGTGG - Intergenic
1090987405 11:131781389-131781411 TTAAAATGTTTATTCAACTGAGG - Intronic
1091595958 12:1879286-1879308 ATTAATATTTCATTTAACTTTGG - Intronic
1091956474 12:4648208-4648230 TGTAATTTTTTCTTTAACTGTGG - Intronic
1092623324 12:10298229-10298251 ATTATTTCTTTATTCAACTGTGG - Intergenic
1092647182 12:10588125-10588147 TTTATTTCTTCATTCACCTGTGG - Intergenic
1092753749 12:11743596-11743618 TTTATATTCTCATTCAAATGAGG - Intronic
1093083072 12:14836242-14836264 TTAAACTTTTCATTCAAAGGAGG + Intronic
1093083144 12:14836905-14836927 TTAAACTTTTCATTCAAAGGAGG + Intronic
1093246876 12:16749616-16749638 TATTGTTTTTCAATCAACTGAGG - Intergenic
1093891334 12:24525541-24525563 TTTAATTTTTTATTTCATTGTGG - Intergenic
1094293998 12:28883006-28883028 TGGAATTTTTCATTTAACTCAGG - Intergenic
1094418925 12:30249560-30249582 TTTATTTTATGATTCAACTATGG - Intergenic
1094665546 12:32516827-32516849 TTTAATTTATTATTTAAATGAGG + Intronic
1095150867 12:38795484-38795506 TTTGCTTATTCATTCATCTGTGG - Intronic
1095596615 12:43966378-43966400 TTTAATTTGTTATTCAAATGAGG + Intronic
1095693737 12:45120350-45120372 TTTAAGTTTACATACAAATGTGG + Intergenic
1095785766 12:46107304-46107326 CTTAATTTCTCAGTCAATTGTGG + Intergenic
1095867330 12:46986419-46986441 TTTCGATTTTCATTCCACTGTGG - Intergenic
1096455553 12:51782188-51782210 TTTAATTTTTCAAAAAACTTGGG + Intronic
1097332059 12:58342183-58342205 GTTATTTTTTAACTCAACTGTGG + Intergenic
1097503253 12:60433048-60433070 TTTAATTTTTAATTCAGTAGTGG - Intergenic
1097647256 12:62251461-62251483 TTTACTTTTTCTTTGAGCTGGGG - Intronic
1098249590 12:68555516-68555538 TTTCTTTATTCATTCACCTGTGG - Intergenic
1099482975 12:83191420-83191442 TTTTATTTTTCCTTCTCCTGGGG - Intergenic
1099680966 12:85826843-85826865 TTTAATTTTTCTTTATATTGTGG - Intronic
1099734349 12:86549396-86549418 TTTAATTATTAAGTCATCTGAGG + Intronic
1100037007 12:90264260-90264282 TTTCATTTTTCTTTCAAAGGGGG - Intergenic
1100631377 12:96393009-96393031 TTTAATTTTTCAATTAACTCAGG - Intronic
1100731540 12:97476278-97476300 TTAAAAGTTTCATTCTACTGTGG + Intergenic
1100814698 12:98375098-98375120 TTTAACATTTCTTTCAAATGTGG - Intergenic
1101116263 12:101534450-101534472 TTTATTTCTTCATTCATCAGTGG - Intergenic
1102524636 12:113503427-113503449 TTTTATTTTTCATACAGATGGGG - Intergenic
1102658405 12:114503298-114503320 TTTCAAGTTTCATTCAAGTGTGG - Intergenic
1102717118 12:114983837-114983859 TTTAATCTGTCTTTAAACTGAGG - Intergenic
1103856663 12:123974517-123974539 TTAAATTTTTAATTAACCTGCGG - Intronic
1104252791 12:127111472-127111494 TTTAATTTTTCAGTTACATGTGG - Intergenic
1104746934 12:131216493-131216515 TTTAATTTTACTTTGAAGTGTGG - Intergenic
1104785684 12:131446692-131446714 TTTAATTTTACTTTGAAGTGTGG + Intergenic
1105044471 12:132990705-132990727 CTTAATTTTTGATTCAATTTAGG + Intronic
1105932133 13:25062465-25062487 ATTAAATTTTGGTTCAACTGTGG + Intergenic
1106006592 13:25775757-25775779 TTTAATGCTTCATTCTACTATGG + Intronic
1106302054 13:28476257-28476279 TTACATTTTTCATTCAGCTTAGG + Intronic
1106353977 13:28961745-28961767 TGTACCTTTTCATTCAACTTTGG + Intronic
1106648372 13:31661929-31661951 TTTATATTTTTATTCCACTGTGG + Intergenic
1107228599 13:38081589-38081611 TTTAAGTTTTTATTCAATTTTGG - Intergenic
1108142953 13:47445238-47445260 TTTAATTATTCTTTCTAATGTGG - Intergenic
1108411393 13:50151156-50151178 TTTAATTTTTTGTACAAATGGGG + Intronic
1108468643 13:50745173-50745195 TTTGTTTATTCATTCATCTGTGG - Intronic
1108605754 13:52036811-52036833 ATTAATTTTTCTTTCAATTTAGG - Intronic
1108626906 13:52238367-52238389 TTTATATTTTTATTCAACTGTGG - Intergenic
1108659161 13:52568092-52568114 TTTATATTTTTATTCAACTGTGG + Intergenic
1109071648 13:57776685-57776707 TTTCTATTTTTATTCAACTGGGG + Intergenic
1109303316 13:60612143-60612165 TTTCATTTTTAATTCAATTAGGG - Intergenic
1110047801 13:70853534-70853556 TTTTATTTTCCAATCCACTGAGG + Intergenic
1110492028 13:76120653-76120675 TTCTATTTTTTATTCCACTGTGG - Intergenic
1110519599 13:76459451-76459473 TTAAATATTTTATTTAACTGTGG - Intergenic
1110675513 13:78238720-78238742 TTTTATTTTTCATACACTTGAGG + Intergenic
1110824918 13:79960328-79960350 TTTTATTTTTCTTTCACTTGTGG - Intergenic
1110946246 13:81422564-81422586 ATTTATTTTTTATTTAACTGGGG + Intergenic
1110967376 13:81716486-81716508 TTTAATTTTTAATTTCAGTGTGG - Intergenic
1111383149 13:87485799-87485821 TTTCTTTATTCATTCATCTGTGG - Intergenic
1111538149 13:89631126-89631148 TTTAATTTTTTATACAGATGAGG + Intergenic
1111785380 13:92779527-92779549 TTTAATTTTTAATACAGATGGGG + Intronic
1111860642 13:93700710-93700732 TTGAATTATTCATTGAACTCTGG - Intronic
1112005699 13:95251861-95251883 TTAATCTTTTCAGTCAACTGTGG - Intronic
1112376547 13:98847459-98847481 TTCTATTTTTCATTGAAATGTGG - Intronic
1112667400 13:101591358-101591380 TTTTCTTTTCCTTTCAACTGAGG + Intronic
1112873826 13:104010515-104010537 TTTAACTTTTATTTCAACTTTGG - Intergenic
1113023479 13:105915169-105915191 TTTATTTTTTCATTCTTCTGAGG + Intergenic
1113305322 13:109071935-109071957 TGAAGTTTTTCATTCAAGTGTGG - Intronic
1114392448 14:22324751-22324773 TTGAATTTTACATTCTACTTTGG + Intergenic
1114704630 14:24712969-24712991 ATAATTTTTTCTTTCAACTGTGG + Intergenic
1115917578 14:38333360-38333382 TTTAATTTTTGATGCAAATGAGG - Intergenic
1115923931 14:38409884-38409906 ATTAATTTTTCATCACACTGGGG + Intergenic
1116141231 14:40996929-40996951 TTTAATTTTTTAAGCAGCTGTGG + Intergenic
1116153868 14:41178160-41178182 TTTGGTTTAGCATTCAACTGGGG - Intergenic
1116204856 14:41851507-41851529 TTTAATTTTTCAAAGAATTGTGG - Intronic
1116440647 14:44948063-44948085 TTAACTTTTTCATAAAACTGAGG - Intronic
1116508309 14:45713409-45713431 TTTACTTATTCATTCACGTGTGG + Intergenic
1116605215 14:46983549-46983571 TTTAATTTTTAATTCTCCAGTGG - Intronic
1116680474 14:47962709-47962731 TTAAATTTTTAATTCAACAATGG + Intergenic
1116750070 14:48871796-48871818 TTACATTTTTCTTACAACTGGGG - Intergenic
1116781062 14:49238099-49238121 TTTCTATTTTCATTCCACTGTGG + Intergenic
1116906113 14:50405211-50405233 TTTCTTTCTTCATTCATCTGTGG + Intronic
1116973077 14:51087834-51087856 TTGAGTTTTTCATTAATCTGTGG - Intronic
1117112112 14:52468703-52468725 TTTAATTTTTCATAGAGATGAGG - Intronic
1117604666 14:57415600-57415622 TTAAAAGTTTCATGCAACTGTGG - Exonic
1118009359 14:61593760-61593782 TATAATTTTACATTCATCTGTGG - Intronic
1118649781 14:67878458-67878480 TATAATTTATCTTTCAACTTTGG + Intronic
1119649057 14:76370881-76370903 TTTAATATATCAATCAGCTGTGG + Intronic
1119665783 14:76484162-76484184 TTTATTCTCTCAATCAACTGTGG - Intronic
1120265428 14:82243089-82243111 GTTAATTTTTCATTTCACTTAGG + Intergenic
1120918691 14:89734222-89734244 TATAGTTTTTCATTAAATTGGGG + Intergenic
1121558793 14:94858930-94858952 TTTCAGGTTTCATTCCACTGGGG + Intergenic
1122219168 14:100224752-100224774 TTTAATTTTTCCTTCTGGTGGGG + Intergenic
1122880035 14:104686609-104686631 TTTTATTTTGCATCCTACTGTGG - Intergenic
1125096238 15:35855529-35855551 TTTCAGTTTTCAATCAAATGAGG - Intergenic
1125437773 15:39666016-39666038 TTTAATTTTTAAGTTTACTGGGG - Intronic
1126916960 15:53476728-53476750 TTTTATTTTTTCTTCCACTGAGG - Intergenic
1127209762 15:56761476-56761498 TTTAATTTTTTATTCCAATTTGG - Intronic
1127238869 15:57088502-57088524 TTTTTTTTTTCTTTAAACTGTGG + Intronic
1127463579 15:59222798-59222820 TTCAATTTATCATTAACCTGGGG - Intronic
1127817431 15:62623864-62623886 GTTGATTTGTCATTCCACTGAGG + Intronic
1128160296 15:65419240-65419262 TTTAATTTTTCGTAGAAATGAGG + Intronic
1128295255 15:66513391-66513413 TTTTATTTTTCATACAGATGGGG - Intronic
1128540344 15:68524051-68524073 TTTAATTTTTTATAAAAATGAGG - Intergenic
1130780286 15:87030369-87030391 TATAATTTTTATTTCTACTGGGG + Intergenic
1131656893 15:94470401-94470423 TTTTGTATTTCATTCCACTGCGG + Exonic
1131901312 15:97090754-97090776 TTTATTTTTCCTTTCAACTCAGG + Intergenic
1133194817 16:4161670-4161692 TTTGTTTATTCATTCATCTGTGG - Intergenic
1133658795 16:7893811-7893833 TTTATTTTTTCCTTCAACTCTGG + Intergenic
1134162278 16:11901216-11901238 TTTACTTGTTCATTCTACTCTGG + Intronic
1134164612 16:11920103-11920125 TTTTTTTTTTCAATCAAATGAGG - Intergenic
1134253145 16:12588951-12588973 TTTAATTTTTCATAGAGATGGGG - Intergenic
1134783928 16:16923711-16923733 TGTAATTTTTCTTTGAGCTGAGG - Intergenic
1134826650 16:17290123-17290145 TTTTCTTTTTCTTTTAACTGAGG - Intronic
1135087825 16:19488904-19488926 TTCAATTGTTCATTCAACCATGG - Intronic
1135199672 16:20426515-20426537 TTTGTTTATTCATTCATCTGTGG - Intronic
1135219028 16:20597095-20597117 TTTGTTTATTCATTCATCTGTGG + Intergenic
1135727387 16:24867189-24867211 TTTATAATTTCATTCCACTGTGG - Intronic
1136958064 16:34806716-34806738 TTTAGTTTTTTATGAAACTGAGG + Intergenic
1137486727 16:48897454-48897476 TTGAATTTTTAGTTAAACTGAGG - Intergenic
1137636356 16:49990129-49990151 TTTAATTTTTCATAGAGATGGGG - Intergenic
1137684380 16:50375536-50375558 TTTAATTTTTTATAGAAATGGGG - Intergenic
1138776750 16:59732233-59732255 TTTATATTTTCATTGCACTGTGG - Intronic
1138979500 16:62250029-62250051 GTTACTTTTTCATTCACCTTAGG + Intergenic
1140443920 16:75008795-75008817 TTTATTTGTTTATTCAACAGAGG - Intronic
1141340312 16:83197547-83197569 CATAATTTTTCATTTAATTGAGG - Intronic
1141364542 16:83430499-83430521 TTTAATTTTGCTTTCAATTCAGG - Intronic
1141505868 16:84478045-84478067 TTTAATTTTTTTTTTAACTGAGG + Exonic
1142773547 17:2118068-2118090 TTTAATTTTTTATAGAAATGGGG - Intronic
1143561466 17:7698036-7698058 TTTAATTTTTTGTAAAACTGGGG + Intronic
1143670006 17:8390242-8390264 TTTAATTTCTTTTGCAACTGTGG + Intergenic
1143981820 17:10876560-10876582 TTTAATGTTGCATTCAAATAAGG + Intergenic
1144118897 17:12130180-12130202 TTAAATTTTTCATACAAAGGAGG - Intronic
1144128963 17:12227487-12227509 TTTCTTTATTCATTCATCTGTGG + Intergenic
1144722752 17:17483595-17483617 TTTAATTTTTCATTCAACTGCGG - Intronic
1146108462 17:30064282-30064304 TTGAATTTCTCATTCATATGAGG - Intronic
1146758057 17:35450126-35450148 TTTCATTTTTCTTTAAAATGCGG + Intergenic
1146971661 17:37077822-37077844 TTTAATTTTTTATACAGATGAGG + Intergenic
1146988648 17:37246603-37246625 TTTAATTTTTCATAGAGATGGGG + Intronic
1147292488 17:39455248-39455270 TTCACTTTTCCATTCTACTGTGG + Intergenic
1148033045 17:44635559-44635581 TTAAATTTTTCATAGAAATGAGG - Intergenic
1148623170 17:49049748-49049770 TTTTATTTTTCTTCCCACTGAGG - Exonic
1149152596 17:53586471-53586493 TTTATTTTTTCATTCCTGTGTGG - Intergenic
1149165390 17:53745331-53745353 TTTTATTTTGCATTCAAATGGGG + Intergenic
1149289950 17:55208404-55208426 TATAATTTATCATTCAAATCAGG + Intergenic
1149485246 17:57037523-57037545 TTTAATTTTTCTTTCAAGATAGG + Intergenic
1150045853 17:61912661-61912683 TTAGAGTTTTCATTCAACTTGGG - Intronic
1150096167 17:62377857-62377879 TTAATTTTTTCACTCATCTGGGG + Intronic
1150305049 17:64077639-64077661 TTTATTTTTCCACTCCACTGTGG + Intronic
1150985122 17:70187234-70187256 TATAATTTTTCTTTAATCTGTGG - Intergenic
1151250488 17:72830167-72830189 TTAAATTTTTCATTTATCAGTGG - Intronic
1152375866 17:79918768-79918790 TGTGATTATTCATTCATCTGAGG - Intergenic
1203168939 17_GL000205v2_random:128964-128986 TTTAATTTTTCATACAGACGGGG - Intergenic
1153097525 18:1424895-1424917 TTCAAATTTTTATTAAACTGTGG + Intergenic
1153444210 18:5154058-5154080 TTTAATTTTTCATAGAGATGAGG - Intronic
1153660397 18:7320691-7320713 TCTAATTTGTGATTTAACTGGGG + Intergenic
1154248946 18:12726683-12726705 CTTAATTTTGCACTCACCTGGGG - Intergenic
1155404122 18:25468975-25468997 TTTAATTTTACATTTATCTGAGG - Intergenic
1155916585 18:31563639-31563661 TTCAATTTTTAAATCCACTGGGG + Intergenic
1155996402 18:32335159-32335181 TCTAATCTTTTATTCAATTGTGG + Intronic
1156296935 18:35801115-35801137 TTTAATTTTCCAGTTAAGTGAGG + Intergenic
1156578002 18:38341539-38341561 TGATATTTTTAATTCAACTGTGG - Intergenic
1157022596 18:43804964-43804986 CTTGATTTTTGATTCTACTGTGG + Intergenic
1157634335 18:49135307-49135329 GCCAATTTTTCATACAACTGGGG - Intronic
1158788594 18:60746487-60746509 TTTAATTTTTCATTCAAATGAGG - Intergenic
1158942433 18:62417887-62417909 TTTTATTTTTAAATCAACTTTGG + Intergenic
1159173917 18:64810287-64810309 TTTTTTTTTTCATTTTACTGTGG + Intergenic
1159361853 18:67415515-67415537 CTTAACTTTTCATTTAATTGTGG - Intergenic
1159395432 18:67849330-67849352 TTTATTTTTTTATTGCACTGTGG - Intergenic
1160182778 18:76649803-76649825 TTTTAGTTTTCCTTCATCTGAGG + Intergenic
1161185204 19:2913618-2913640 TTTCATTTCTCATTCCATTGTGG + Intronic
1161536557 19:4822742-4822764 TTTTATTTTCCATTCCACAGAGG + Intronic
1162576710 19:11503633-11503655 TTTAATTTTTCATGGAGATGGGG - Intronic
1163169889 19:15523884-15523906 TTTCTTTATTCATTCATCTGTGG - Intronic
1164187102 19:22880037-22880059 TTTGATTTTCCATTTATCTGTGG - Intergenic
1164341951 19:24411002-24411024 TTGAATTTTTCTTTTGACTGTGG + Intergenic
1164547371 19:29179748-29179770 TTTCATTATCCATTCATCTGTGG - Intergenic
1166650246 19:44568544-44568566 TTTTATTTTTCATTGACATGTGG - Intergenic
1166822627 19:45589890-45589912 TTTATTCATTCATTCAACAGAGG - Exonic
1168033867 19:53703372-53703394 TTTAATTTTTGGTACAATTGGGG + Intergenic
925078331 2:1038810-1038832 TTTAATTTCACAGTCAAATGTGG + Intronic
925691325 2:6526330-6526352 TTCAATTTGTCATTCAATTAGGG + Intergenic
925715867 2:6783675-6783697 TTGAACTCTTCATTCAACAGAGG - Intergenic
926392258 2:12405433-12405455 TTTTATATTTCATTCAATTCTGG - Intergenic
926531086 2:14046487-14046509 TTTTATGTTTCATTCATCTCAGG + Intergenic
927316891 2:21694058-21694080 TTTAATTTGTCATGCCAGTGGGG + Intergenic
927455143 2:23242504-23242526 TTTAATTTAGTATTCAAATGGGG - Intergenic
927996001 2:27486893-27486915 TTTATTTTTTTCTCCAACTGAGG + Intronic
928683188 2:33723986-33724008 TTTAATTTTTCAGTCATCATGGG - Intergenic
928867514 2:35934987-35935009 TTCAATTTTTCAGTCTAGTGGGG - Intergenic
929482073 2:42318876-42318898 TTTAATTTTTCATAGAGCTGAGG + Intronic
930050569 2:47212676-47212698 TTTTGTTTTTTTTTCAACTGTGG - Intergenic
930240724 2:48933312-48933334 TATATTTTTTCATTAAATTGAGG - Intergenic
930318180 2:49822627-49822649 TTTAATTTTTCTTTAAATTTGGG + Intergenic
930343856 2:50152852-50152874 TTTATGTTTTCATTGAACTTGGG + Intronic
930409907 2:51012439-51012461 GCTAATTTTTGCTTCAACTGAGG + Intronic
931151851 2:59583268-59583290 TATACTTTCTCATTCTACTGAGG + Intergenic
931580556 2:63767331-63767353 TGTAAGTTTTCATTTATCTGAGG + Intronic
931839898 2:66137256-66137278 TTTGATTTTTCATTTTACTTTGG + Intergenic
932186514 2:69701173-69701195 CTTAATTTTTTTTTTAACTGTGG + Intronic
932542896 2:72675242-72675264 TTTCATTTTTTAATCAACTGTGG - Intronic
932630447 2:73338171-73338193 TTTAACTTTTTATTTAATTGTGG - Intergenic
932649007 2:73535041-73535063 TTTAATTTTTCAGTGAAATATGG + Intronic
932882990 2:75521444-75521466 TTTATTTATTCATCCATCTGTGG - Intronic
933742900 2:85548735-85548757 TTTGAATTTTCACTGAACTGAGG + Exonic
934510622 2:94938268-94938290 TTTAATATTTCATTCAGCACAGG + Intergenic
934547444 2:95229993-95230015 TTTAAATTTTCATTTTTCTGTGG + Intronic
935412345 2:102779024-102779046 TCTTAGTTTTCATTCATCTGAGG + Intronic
936135094 2:109885340-109885362 TCTAAGTTTTTATTCCACTGTGG + Intergenic
936139445 2:109926591-109926613 TTTAATTTTTTGTAGAACTGGGG - Intergenic
936205251 2:110444895-110444917 TTTAATTTTTTGTAGAACTGGGG + Intronic
936209603 2:110486145-110486167 TCTAAGTTTTTATTCCACTGTGG - Intergenic
936657160 2:114501602-114501624 TTAAATTTTCTATTCACCTGGGG - Intronic
936676378 2:114720398-114720420 TTTATTTTATCCTTCAACCGTGG - Intronic
936757299 2:115730510-115730532 ATGAAGTTTTCAGTCAACTGAGG + Intronic
936996207 2:118416773-118416795 GTTAATTTCTCATTAAACTATGG + Intergenic
937160544 2:119757252-119757274 TTTTTTTTTTCATTCAAAAGTGG - Intergenic
937373135 2:121316480-121316502 TTAAATTTTTCATACAGATGGGG + Intergenic
937387121 2:121445219-121445241 AATAATCTTTCTTTCAACTGTGG - Intronic
938853826 2:135289564-135289586 TTTATAATTTCATTCCACTGTGG + Intronic
938958669 2:136321311-136321333 TTGAATTTTTTGTTTAACTGAGG + Intergenic
939183835 2:138836917-138836939 TTTAATTTTTTTTTTAACTAGGG + Intergenic
939279494 2:140043668-140043690 TTTAATTTTTTTTCCAAATGAGG + Intergenic
939294523 2:140242922-140242944 TTTATTGTTTGATTCAACTTAGG + Intronic
939935246 2:148283877-148283899 TTTGATTTTTGAATCAAATGTGG - Intronic
940067876 2:149649992-149650014 GTTCATTTTTCCTTCAACAGGGG + Intergenic
940546102 2:155087761-155087783 TTTTATTTTTCATTATACTGTGG + Intergenic
940831515 2:158471328-158471350 TTTAATTTTTGTTTAAAATGGGG + Intronic
940939096 2:159537013-159537035 TTTATTTACTCATTCATCTGTGG - Intronic
940945433 2:159612165-159612187 TTTAATTTTTCTTTATAATGAGG - Intronic
941031563 2:160517327-160517349 TTTAATTTTTTTTTCCATTGAGG - Intergenic
941130806 2:161648954-161648976 TATAATTTTTGATGCAACTAGGG - Intronic
941250016 2:163149714-163149736 ATAAATTTTTCAGTCAACTATGG + Intergenic
941516550 2:166487222-166487244 TGTAATTTATCATCCAACTCAGG - Intronic
941562429 2:167064485-167064507 TTTAATTTTATTTTTAACTGTGG + Intronic
941587325 2:167377166-167377188 TTTATATTTTCATTCCACTGTGG + Intergenic
941858856 2:170257395-170257417 TTTCAATTTTTATTCCACTGTGG - Intronic
943036489 2:182752637-182752659 TTTAGTTCTTCCTGCAACTGAGG - Intronic
943059266 2:183021425-183021447 TTTAATTTTTTATCCAGATGTGG - Intronic
943296684 2:186149220-186149242 TTTAATTTTTAATTTATATGGGG - Intergenic
943304109 2:186238489-186238511 TACAATTTTTCACTCATCTGTGG + Intergenic
943343050 2:186704549-186704571 TTTCATTTTTCATTCCAGTGTGG + Intronic
943403370 2:187446792-187446814 TTTAAATTTTCATTATATTGAGG + Intronic
943713339 2:191122613-191122635 TTTATTTATTCATTCTTCTGTGG - Intronic
944008727 2:194944828-194944850 TTTGATTTTTCATTCATGTTGGG - Intergenic
944494513 2:200293133-200293155 TTTATTTATTCATTCACCTGTGG - Intergenic
944801574 2:203242156-203242178 TTTAATTTTTTATAGAAATGGGG + Intronic
944954219 2:204789234-204789256 TTTAATTTTTCATAGAGATGGGG + Intronic
945410755 2:209503549-209503571 TTTAAGTTTTCATTCCATTTTGG + Intronic
945708853 2:213270697-213270719 TTTAATTTTTCACTCTTCTTTGG - Intergenic
945791399 2:214310026-214310048 TTCAAATTTTCATTCTATTGAGG + Intronic
946089016 2:217204155-217204177 CTTAATTTTTCTTTGAATTGTGG + Intergenic
946151890 2:217779721-217779743 TATAATTTTTGCTTCAACTATGG - Intergenic
946656773 2:221957231-221957253 TTTAATTTCTTATTCAACATAGG - Intergenic
946776825 2:223151460-223151482 TTTAATTTTTCATCCATCTTTGG - Intronic
947197056 2:227578778-227578800 TGTAATTGTTCATTAGACTGTGG - Intergenic
947359953 2:229336598-229336620 TTTAATGTTTCAGTCAACCCAGG + Intergenic
947889001 2:233599746-233599768 TTTACTTTTTCTTTCAAATCTGG + Intergenic
948358915 2:237404245-237404267 TGCAATTTTGCACTCAACTGTGG - Intronic
948891907 2:240911162-240911184 TTTCATTTTTCTTTAAATTGTGG + Intergenic
948964945 2:241372036-241372058 TTTATTTTTCCATTCAAATTGGG - Intronic
1168960055 20:1862794-1862816 TTTAATTTTTAATTTCACAGCGG + Intergenic
1169133447 20:3180690-3180712 TTTCATTCATCATTCAACTAAGG - Intergenic
1170070004 20:12356682-12356704 TTTTATTCTTCTTTCATCTGAGG - Intergenic
1170109231 20:12787052-12787074 TGTAATGTTTCCTGCAACTGTGG + Intergenic
1171098549 20:22358150-22358172 TTAAATATTTAATTCAACTCAGG - Intergenic
1171220448 20:23392491-23392513 TTTAATTTTTCATACAAATGAGG - Intronic
1171435956 20:25124788-25124810 TTTAATTTTTTGTTGAAATGGGG - Intergenic
1171775204 20:29359721-29359743 TTTAATTTATATGTCAACTGGGG + Intergenic
1171901142 20:30858653-30858675 TTTAATTTATATGTCAACTGGGG - Intergenic
1172250328 20:33474952-33474974 TTTAATTTTTGATACAGATGGGG - Intergenic
1173076274 20:39822862-39822884 TTCACTTTTGCATTCATCTGGGG - Intergenic
1173210437 20:41028245-41028267 TTTAATTTTTCAACCAACCAAGG - Intergenic
1173361821 20:42351372-42351394 TTTAATTATACATTCCCCTGTGG - Intronic
1173460651 20:43240551-43240573 TTAAATTTTTCATGCATCTTAGG - Intergenic
1173547252 20:43908228-43908250 TTTAATTGTTCAATTAACTTGGG - Intergenic
1174796463 20:53526725-53526747 TTTGATTTTTCCATCAAATGTGG - Intergenic
1174964420 20:55195685-55195707 TTTGATTGTTGAGTCAACTGAGG + Intergenic
1174995558 20:55564083-55564105 TTTCTATTTTCATTCCACTGTGG + Intergenic
1175351717 20:58326498-58326520 TTTTGTTTTTTATTAAACTGAGG + Intronic
1175399106 20:58690208-58690230 TTTAATCTTTTCTTCAACTTTGG + Intronic
1175449987 20:59055974-59055996 TTTAAAATTTCAATAAACTGTGG - Intergenic
1175479482 20:59301106-59301128 GTCAATTTTTCATGAAACTGGGG + Intronic
1175571828 20:60028937-60028959 TTTACTTGTTCATTTATCTGTGG - Intronic
1176853709 21:13945022-13945044 TTTAAATTTTCATATACCTGTGG + Intergenic
1177223857 21:18228198-18228220 TTTAATTTTTTAAGCTACTGGGG + Intronic
1177229198 21:18297423-18297445 TTTAATTATTTATTAATCTGAGG + Intronic
1177544487 21:22538543-22538565 TTTTATTTTTAATTCAATTTTGG - Intergenic
1177720533 21:24901343-24901365 TTTAATTTTTAATACAGCTTAGG + Intergenic
1177725347 21:24959769-24959791 TATAATTTATCATTCAAATTTGG - Intergenic
1177741702 21:25162030-25162052 TATAATTGTACATTCATCTGTGG + Intergenic
1178067947 21:28926980-28927002 TTTAAAATTTTATTTAACTGAGG - Intergenic
1178263554 21:31121648-31121670 TTTTATTTCTCATTCCAATGAGG - Intronic
1178311273 21:31531942-31531964 TTTAATTTTTCATAGAGATGGGG - Intronic
1179119958 21:38534830-38534852 TTTGTTTATTCATTCATCTGTGG - Intronic
1179341624 21:40516329-40516351 TTTCATGTTCCATTCAACAGAGG + Intronic
1179527078 21:41986421-41986443 TTTTTTTTTTCATTCTAATGAGG - Intergenic
1180320547 22:11316111-11316133 TTTAATTTATATGTCAACTGGGG + Intergenic
1180334506 22:11564606-11564628 TTTAATTTATATGTCAACTGGGG - Intergenic
1180927091 22:19563003-19563025 TTTAATTTTTTTTTAAATTGAGG + Intergenic
1182292284 22:29289682-29289704 TTTAATTTTTCCTTGAATAGTGG - Intronic
1182764395 22:32748252-32748274 TATAATTCTTCATTCAAGAGAGG + Intronic
1183077426 22:35435857-35435879 CTTCCATTTTCATTCAACTGGGG - Intergenic
1184909490 22:47518253-47518275 TTTAATTTTGCAGGCAACTCAGG - Intergenic
1203288835 22_KI270735v1_random:14881-14903 TTTAAGTTTTTATGAAACTGAGG - Intergenic
949321637 3:2817701-2817723 CTTAATTTTTCATGCAACTCTGG + Intronic
950003313 3:9674460-9674482 TACAATATTTCATTCTACTGAGG - Intronic
950381902 3:12623195-12623217 TTTTATTCTATATTCAACTGTGG + Intronic
951260838 3:20505890-20505912 TTTTATTATTGATTCAATTGTGG + Intergenic
951397101 3:22182018-22182040 TTTCATCTATCGTTCAACTGGGG - Intronic
951418926 3:22460740-22460762 TTTCTTTATTCATTCATCTGTGG - Intergenic
951875180 3:27416906-27416928 ACAAATTTCTCATTCAACTGAGG - Intronic
953565023 3:44024885-44024907 TTTAATTATTCATCAAAATGAGG - Intergenic
953739350 3:45523707-45523729 TTTAATTTTTCATAGAGATGAGG + Intronic
954948644 3:54449424-54449446 TTTAAGTTTTGTTTCAAGTGTGG + Intronic
955295511 3:57731545-57731567 TATAATTTTGCAATCAAGTGGGG - Intergenic
955772650 3:62401459-62401481 TTTATTTATTCATTCAACATTGG - Intronic
955828288 3:62972928-62972950 ATTCATTTTTATTTCAACTGGGG - Intergenic
956399766 3:68865268-68865290 TTTAATTTTTCTTTAAACACTGG + Intronic
956435270 3:69229196-69229218 TTTAATTTTTCATAGATATGGGG + Intronic
956511997 3:70004061-70004083 CTGAATTTTTCATATAACTGGGG + Intergenic
956542501 3:70357280-70357302 TTTAATATTTTATTAAACTCAGG + Intergenic
957331098 3:78765450-78765472 TGTAATTTCTTAATCAACTGAGG - Intronic
957869320 3:86067965-86067987 TTTAGGTTATTATTCAACTGTGG - Intronic
958633226 3:96708015-96708037 TTTAATTTTTCTTTCAATTATGG - Intergenic
958984083 3:100760289-100760311 TTTAATTTTTCAGTAAAGTAAGG + Intronic
959251188 3:103948147-103948169 TTAAATTTTTCAAGAAACTGTGG - Intergenic
959257577 3:104034110-104034132 TTTCAATTTTTATTCCACTGTGG - Intergenic
959615154 3:108338987-108339009 TATAATTTATCATTCAAATTGGG + Intronic
960306409 3:116066935-116066957 TTTGATATTTCAAACAACTGTGG + Intronic
960401661 3:117207483-117207505 TTTATTATTTCATTCCATTGTGG - Intergenic
960786192 3:121374573-121374595 TTGAATTTCTCATTCAGCTCAGG - Intronic
961835285 3:129653072-129653094 CTTTTTTTTTCATTCAACAGTGG + Intronic
961938108 3:130607264-130607286 TTTACATTTTCATTTAACTTTGG + Intronic
962062983 3:131951061-131951083 TAGAATTTTTCATAAAACTGAGG - Intronic
962167075 3:133060450-133060472 TTTGATTTTGCATTTCACTGGGG + Intronic
962563368 3:136631978-136632000 TTGAATTTTCCCTTTAACTGTGG - Intronic
962658851 3:137580017-137580039 TTTTATTTTTCATTGAAATGAGG + Intergenic
963343707 3:144069073-144069095 ATCATTTGTTCATTCAACTGGGG - Intergenic
963820354 3:149885109-149885131 TTTCTTTATTCATTCACCTGTGG + Intronic
964015883 3:151945935-151945957 TTTCAGTTTTCTTTCATCTGAGG + Intergenic
964050576 3:152388477-152388499 TTTATTGTTTCACTCAACTATGG - Intronic
964168369 3:153736659-153736681 TTTCATTTTTCATTCATCACCGG - Intergenic
964303627 3:155317503-155317525 TTTAATTTTTCATTCTAATGAGG + Intergenic
964517456 3:157528057-157528079 GTTAATTTTTCATGCACTTGGGG + Intronic
964656679 3:159074550-159074572 TTTCATTTTTCTTTCATCTCAGG + Intronic
964947146 3:162239778-162239800 TTTACCATTTCATTCAGCTGAGG + Intergenic
965041023 3:163507182-163507204 TTAATTTTATCATTCAACTGTGG - Intergenic
965666889 3:171104566-171104588 TATAATTTTTCATTCAACAAAGG + Intronic
966273227 3:178134076-178134098 TTATATTTTTTATTCAACTTGGG + Intergenic
966332358 3:178828233-178828255 TTTAATTGCTCCTTCAGCTGTGG + Exonic
966733095 3:183166942-183166964 ATTGATTTTTAATTCCACTGTGG + Intergenic
967365096 3:188677386-188677408 TTTAATATTTGATTTATCTGTGG + Intronic
967557840 3:190878393-190878415 ATTTATTTTTCATTCAATTGTGG + Intronic
968488749 4:878362-878384 TTTCAATTTTTATTCCACTGTGG + Intronic
969168470 4:5339021-5339043 TCTAATTTTTCATTCTATTCAGG - Intronic
970168689 4:13266624-13266646 TTTTTTTTTTCCCTCAACTGTGG - Intergenic
970190518 4:13511805-13511827 TTAAATTGTTCATTCCATTGGGG + Intergenic
970504541 4:16714184-16714206 TTTAAATCTTCATTCGAATGAGG + Intronic
970516717 4:16838926-16838948 TTTAATTTCTCATTCATCCTAGG - Intronic
970549067 4:17161252-17161274 TTTCCTTTTTTATTCCACTGTGG + Intergenic
970831217 4:20342179-20342201 TTTAAGTTTATATTCCACTGTGG + Intronic
970955337 4:21804091-21804113 TCTAATTTTCCTCTCAACTGGGG + Intronic
971612765 4:28746528-28746550 TTTTATTTTTCCTTCAACTGAGG + Intergenic
971711965 4:30124676-30124698 TTTGATTTTTCATTTAAATGGGG - Intergenic
971987203 4:33841436-33841458 TGTATTTTTTCTTTCACCTGAGG + Intergenic
972070077 4:35007994-35008016 TTTAATTTTTTTTTAATCTGTGG + Intergenic
972256330 4:37359587-37359609 TTTTTTTTTTCATTCAGCAGTGG - Intronic
972368895 4:38402476-38402498 TTTATATTTTTATTCTACTGTGG + Intergenic
973006833 4:45018488-45018510 TTTCTATTTTTATTCAACTGTGG + Intergenic
973663425 4:53132704-53132726 TTAAAATTTTCATTCAAGTGTGG + Intronic
973900034 4:55459832-55459854 TTTAATTTTTTATAGAAATGGGG + Intronic
974396958 4:61349744-61349766 ATTATTTTTCCATTAAACTGCGG + Intronic
974549472 4:63352000-63352022 TTTTAATTTTCATTAAACTCAGG - Intergenic
974721149 4:65739911-65739933 TTTCATGTTTGATTCTACTGGGG - Intergenic
974727997 4:65821451-65821473 TTTCATTATTCATTCACCTGTGG - Intergenic
975736771 4:77388948-77388970 TCTAATTTTTTATTCTGCTGAGG - Intronic
975793427 4:77981761-77981783 TTTATAATTTCATTCAATTGTGG + Intergenic
976576533 4:86678723-86678745 CTTAATTTTTCATTCACCTCTGG + Intronic
976593953 4:86876473-86876495 TTTATTTTATCATCCAAATGAGG + Intronic
977442231 4:97082760-97082782 TTTTATTTTTGATTCAATTATGG + Intergenic
977807223 4:101315368-101315390 TTTACTTTTTTATAAAACTGGGG - Intronic
977941204 4:102861257-102861279 TTGAGTTTTTCATTCTACTGGGG + Intronic
978218265 4:106235038-106235060 TTTAATGTTTCATTTAATAGTGG - Intronic
978348308 4:107795186-107795208 TTGAATTTTTCATTAAACTCTGG + Intergenic
978940460 4:114429717-114429739 TTAAATTTTTAATTCATCTTGGG - Intergenic
978940515 4:114430642-114430664 TTAAATTTTTAATTCATCTTGGG + Intergenic
979092978 4:116510513-116510535 CTTTATTTTTTTTTCAACTGGGG + Intergenic
979500645 4:121435925-121435947 TTTCATTTTTCACTTAATTGTGG - Intergenic
979761436 4:124409974-124409996 TTTAATTTCAAATTGAACTGAGG + Intergenic
979987129 4:127329062-127329084 TTTCATTTTTCTTTCAACTCTGG - Intergenic
980531912 4:134067858-134067880 TTTAATTTTTTATTGCATTGTGG + Intergenic
980569431 4:134594673-134594695 TTCAATTTTAGATTCATCTGTGG + Intergenic
980759328 4:137208588-137208610 TTTATATATTCATTCAACTTTGG + Intergenic
981852303 4:149245170-149245192 TCTTATTTTTCATCAAACTGGGG + Intergenic
982138974 4:152299370-152299392 TATAATTTATCATTCAAATTGGG - Intergenic
982502316 4:156172456-156172478 TTTAATTTTTCAGCCATGTGAGG - Intergenic
982647343 4:158040359-158040381 TTTCTCTTTTCATTCCACTGTGG - Intergenic
982703332 4:158680398-158680420 TATATTTTTTCAGTCTACTGAGG + Intronic
983235457 4:165174104-165174126 TTTAATTTTTCATTGCAGTATGG + Intronic
983461124 4:168027107-168027129 TTTCATTTTCCATTCATCTGTGG + Intergenic
983991087 4:174120831-174120853 TTTAATTTTTCATCCACCAATGG + Intergenic
984953416 4:185022933-185022955 TTTCTTTTCTCATTTAACTGTGG + Intergenic
986387773 5:7252493-7252515 AATAATTTTTCATTAAACTGTGG - Intergenic
986418795 5:7555791-7555813 TTTAAATTCTAATTCAACTCAGG + Intronic
986536929 5:8797663-8797685 TTCAATTTTTCATTGAAAGGAGG + Intergenic
987449796 5:18068689-18068711 TTTAATTTCTCTCTCAACTTTGG - Intergenic
987898495 5:23980061-23980083 TTTCAATTTTAATTCCACTGTGG - Intronic
987970365 5:24935922-24935944 TTTAATCTTTCATCTAATTGTGG - Intergenic
988335471 5:29902966-29902988 CATAATTTTTCAATAAACTGTGG - Intergenic
988862701 5:35301193-35301215 TTTATTTTTCCATTGTACTGTGG + Intergenic
988902855 5:35752466-35752488 TTTAATTTTTTATAGAAATGGGG + Intronic
989807482 5:45627479-45627501 TTTTATTTTTCACTGATCTGGGG + Intronic
990628993 5:57647111-57647133 TTTCAAGTTTCATTCCACTGTGG + Intergenic
991261466 5:64673000-64673022 TCTAATTTCTGATTAAACTGTGG - Intergenic
992232886 5:74680963-74680985 TTTCATATTTCAGTCATCTGGGG + Intronic
992300398 5:75372350-75372372 TTTTATTTTACAATCAGCTGTGG - Exonic
992449238 5:76861052-76861074 TTTATTGTTTCATACAGCTGTGG + Intronic
992516398 5:77497853-77497875 TTTATTTATCCATTCATCTGTGG - Intronic
992790294 5:80207404-80207426 TTTAAATGTTGATTCAGCTGTGG - Intronic
993662839 5:90660271-90660293 TTTAATTTTTCATTTGAATATGG + Intronic
993992767 5:94680304-94680326 TTTTCTTTTTCATTGAGCTGAGG + Intronic
994037997 5:95224680-95224702 TTTTATTTTTCATAGAAATGTGG + Intronic
994172603 5:96674411-96674433 TTTATATTTTGATTCAATTGAGG + Intronic
994402994 5:99305947-99305969 TTTATCTTTTTAGTCAACTGTGG - Intergenic
994409883 5:99393672-99393694 TTTTTATTTTCATTCCACTGTGG - Intergenic
994471949 5:100218214-100218236 TTTAATTTTTTATTCTGATGTGG - Intergenic
994628070 5:102246218-102246240 TTTAATTTTTCATTGATCATTGG - Intronic
995104151 5:108354161-108354183 TTTAATTTTTCATTGAAAGGTGG - Intronic
995417362 5:111925799-111925821 TTTACTCTTCCATTCATCTGTGG + Intronic
995737158 5:115313635-115313657 TTTATTTTATCATTCACCTTCGG + Intergenic
996082991 5:119275726-119275748 TTTAATTTATCATTCTAATAGGG + Intronic
996193718 5:120577806-120577828 TTTAATTTTCCCAGCAACTGGGG + Intronic
996241031 5:121201894-121201916 TTTATTTTTTTATTCCTCTGTGG - Intergenic
996628264 5:125597082-125597104 TTTATTTTCTCATTTAAATGTGG - Intergenic
996678195 5:126201113-126201135 TGGAATTTTTCCTGCAACTGTGG + Intergenic
996726882 5:126680364-126680386 GTTAATCTTTCAGTCATCTGAGG - Intergenic
996789388 5:127276357-127276379 TTTAATTTTTCTTTAAACCCAGG - Intergenic
997154180 5:131534499-131534521 TTTAATTTTATATTTAAATGCGG - Intronic
997298334 5:132783834-132783856 TTTAATTTTTCATAGAGATGGGG - Intronic
997457559 5:134028510-134028532 TTCAATGTTTCATTGCACTGAGG + Intergenic
998192355 5:140037596-140037618 CTTAAATTTTCTTTCAACAGAGG - Intronic
998648198 5:144088174-144088196 TTTTATTTTGCAATCACCTGAGG + Intergenic
998902282 5:146868935-146868957 TTTAACTTTTCATTTAAAGGGGG + Intronic
999069577 5:148729734-148729756 TTTGCTTTTTCATTCCTCTGGGG - Intergenic
999725783 5:154436336-154436358 TTTTTTTTTGCATTCCACTGAGG - Intergenic
1000081745 5:157854969-157854991 TTGTATTTTTCATACAGCTGAGG - Intronic
1000091535 5:157933762-157933784 TTTAACTTTTCATTTTAATGTGG - Intergenic
1000790222 5:165597522-165597544 TTTAATTTATCATACAACTAGGG - Intergenic
1000854845 5:166385207-166385229 TTTAATTTTGAATTAAACTTAGG + Intergenic
1001103956 5:168836982-168837004 TTTACTTTTTCCTTAAGCTGGGG + Intronic
1001614650 5:173032921-173032943 TTAAATTTTTCATAGAAATGGGG - Intronic
1001666029 5:173434452-173434474 TTTAATGATTAATCCAACTGGGG - Intergenic
1001991536 5:176120181-176120203 GTTAATCTTTGATTAAACTGTGG - Intronic
1002225340 5:177717944-177717966 GTTAATCTTTGATTAAACTGTGG + Intronic
1002268504 5:178053170-178053192 GTTAATCTTTGATTAAACTGTGG - Intronic
1002353947 5:178608207-178608229 AGTAATATTTCATTCAACTGTGG + Intronic
1003807641 6:9743683-9743705 TTTTATTTTTCATTTTGCTGTGG + Intronic
1004798934 6:19123607-19123629 TGCAATTTATCATTCAAATGGGG - Intergenic
1005046413 6:21646940-21646962 GTTAATTTTTCCTTATACTGGGG + Intergenic
1005284659 6:24312323-24312345 TTTTAATTTTCATTCCACTGAGG - Intronic
1008099227 6:47373227-47373249 TTTTATTTTTCATACAGATGGGG - Intergenic
1008318567 6:50078366-50078388 TTTAATTTTTTTTACTACTGGGG - Intergenic
1008601225 6:53097603-53097625 TTTTATTTTTAATTCATCTTAGG - Intronic
1008743751 6:54643024-54643046 TTTATTTTTTTCTTCAACAGTGG + Intergenic
1009190933 6:60629025-60629047 TTTACTTGTTCATTCAACAACGG + Intergenic
1009375913 6:62968811-62968833 TTTAATTTTTCAGACAATTAAGG - Intergenic
1009505928 6:64478275-64478297 TAAAATTTTACATTCAAATGGGG - Intronic
1010607888 6:77914423-77914445 TTTTATATTTTATTCCACTGTGG + Intronic
1010623193 6:78102406-78102428 TTTTAGATTCCATTCAACTGTGG - Intergenic
1010793843 6:80096067-80096089 TTTAATTCTTTATTCCATTGTGG + Intergenic
1010850342 6:80768037-80768059 TTCAACTTGTCATTAAACTGGGG + Intergenic
1010968203 6:82236220-82236242 TTTAAGTTTTTATTCTACTAGGG - Intronic
1011934724 6:92761726-92761748 ATTAGTTTTTCATTCCATTGAGG + Intergenic
1012071431 6:94623446-94623468 TTCACTTTTTCATTCAATTAAGG - Intergenic
1012900970 6:105005964-105005986 TATAATCTTTCATCCAGCTGAGG + Intronic
1013135995 6:107283144-107283166 TTTCATTTTTCATTGAGATGAGG - Intronic
1013254992 6:108375965-108375987 TTTAATTATTGATTCAATTTTGG + Intronic
1013938153 6:115625024-115625046 TGTAATTTATCATTCAACACAGG + Intergenic
1013988113 6:116221041-116221063 TTTTATTTTTCAGAAAACTGTGG + Exonic
1014098855 6:117487803-117487825 TTTTTTTTTTCATTAGACTGAGG + Intronic
1014316553 6:119872983-119873005 TTTAAACTTTGATTCCACTGGGG + Intergenic
1015819391 6:137244525-137244547 GTTAATTTTACATTCACATGGGG + Intergenic
1016107999 6:140186871-140186893 TTTCTTTTTTTATTGAACTGTGG - Intergenic
1016678064 6:146794603-146794625 TTTAATTTTGCATGTAAATGTGG - Intronic
1017616880 6:156255424-156255446 TTTTATTTTTCATATCACTGGGG - Intergenic
1017797266 6:157857149-157857171 TTTAATGTTTCAGTCCATTGTGG + Intronic
1018948067 6:168359682-168359704 TAGAATTTTTCTTTCAACAGGGG + Intergenic
1019820565 7:3239706-3239728 TTTGTTTTTCCATTCATCTGTGG - Intergenic
1020178315 7:5900298-5900320 TTTATTTTATCATCCAAATGAGG + Exonic
1020304612 7:6824701-6824723 TTTATTTTATCATCCAAATGAGG - Exonic
1021000556 7:15324979-15325001 TTTAATTTTTAATTTTACTTTGG - Intronic
1021081636 7:16371549-16371571 TTTATTTTTTGATTGGACTGTGG - Intronic
1021220161 7:17966476-17966498 TTTAATTTTTTGTTGAAATGGGG - Intergenic
1022018344 7:26375025-26375047 TTTAATTATTCAATAAAATGTGG - Intergenic
1022813089 7:33888102-33888124 TTTTACTTTTCAATAAACTGTGG + Intergenic
1023041512 7:36176909-36176931 TATTATTTTTCCTTCCACTGAGG - Intronic
1023669043 7:42556739-42556761 AATAATTTTTCATACAACTTTGG - Intergenic
1024432572 7:49306305-49306327 TTTAATTTTTCAGTTTATTGAGG + Intergenic
1024450676 7:49539284-49539306 TTTATTTATTCATTCATCAGTGG - Intergenic
1024520498 7:50301827-50301849 TTAAATTTTTAATACAAATGGGG + Intergenic
1024987471 7:55207879-55207901 TTTCATTATTCATTCACCTCAGG + Exonic
1026464843 7:70645164-70645186 TTTTATCTTCCATTCAAATGAGG + Intronic
1027302856 7:76859303-76859325 TTTGTTTATTCATTCATCTGTGG - Intergenic
1027428729 7:78088056-78088078 GTTTATTTTTCAGTCAACTAGGG - Intronic
1028023101 7:85803212-85803234 TTTGATTTTTTTTTCAACTTAGG + Intergenic
1028424244 7:90668713-90668735 TTTTTTTTTTTTTTCAACTGGGG + Intronic
1028431567 7:90752980-90753002 TTTTATTATTAATTCAATTGTGG - Intronic
1028502569 7:91535351-91535373 TTTATTTATTCATTCAAATTTGG - Intergenic
1028612713 7:92730217-92730239 TTTAATTTTTAAATAAACTGAGG - Intronic
1028903431 7:96126320-96126342 TTTATTTTTTCCTGCATCTGTGG + Intronic
1028925513 7:96353481-96353503 TTTCATTTTCCATTAAACTGTGG + Intergenic
1028951438 7:96640334-96640356 GTTTATTTTTCATTCATCTACGG - Intronic
1029080549 7:97970694-97970716 TTTATTTTATCATCCAAATGAGG - Intergenic
1029221905 7:98996529-98996551 TTTAATCTTTCTTTCATCTCTGG - Intronic
1030624356 7:111827993-111828015 TATAACTTTTCATAGAACTGTGG - Intronic
1030712195 7:112762723-112762745 TTTCAATTTTCAGTCAACTTTGG + Exonic
1030806112 7:113921669-113921691 TATAATATTGCATTCATCTGGGG - Intronic
1030877164 7:114828249-114828271 TTTATTTATTCATTCACCTTTGG - Intergenic
1031896838 7:127359907-127359929 TTTTTTTTTTCATTTAAGTGTGG - Intronic
1032362685 7:131270862-131270884 TTTTTTTTTTCTTTTAACTGGGG + Intronic
1033175696 7:139121578-139121600 TTTTATTTTTCATAGAGCTGGGG + Intergenic
1033849066 7:145472274-145472296 TTTCATCTTTCATTCAGCAGAGG + Intergenic
1033993087 7:147312153-147312175 TTTAATTTCTCTTTCTACTTTGG + Intronic
1034295713 7:149970578-149970600 TATAATTTTTTATCCAAATGGGG - Intergenic
1034810341 7:154126327-154126349 TATAATTTTTTATCCAAATGGGG + Intronic
1034840682 7:154392657-154392679 TTTAATTTTCTAATTAACTGAGG - Intronic
1035009860 7:155705437-155705459 ATTAAATTTTCTTTCAAATGGGG + Intronic
1035970768 8:4245663-4245685 TTTAAATTGTCATTCATATGGGG - Intronic
1035973491 8:4280485-4280507 TTTAATTTTTCTGTGAAATGTGG - Intronic
1036432074 8:8701349-8701371 TTTAATTTTACAGTGTACTGTGG - Intergenic
1036821676 8:11945075-11945097 CTTATATTTACATTCAACTGGGG - Intergenic
1037600531 8:20390173-20390195 TTTATTTTTTCATGGAAATGGGG + Intergenic
1037668052 8:20988260-20988282 ATTCATTTTTCATTTATCTGTGG - Intergenic
1038838064 8:31150740-31150762 TATAATTTTACATTCAAATGTGG + Intronic
1039121666 8:34154864-34154886 TGTAATTTTTCTTACAACTCAGG - Intergenic
1039321121 8:36432863-36432885 TTTATTTGTTCATTCACCTAGGG - Intergenic
1039911316 8:41829005-41829027 TTTATTAATTCTTTCAACTGCGG - Intronic
1040446006 8:47494159-47494181 TTAAATTTTTCATGGAAATGGGG + Intronic
1041218540 8:55625961-55625983 TATGATTTTTTTTTCAACTGTGG - Intergenic
1041302083 8:56422287-56422309 TTTAATTTTTCTTTTATCTCTGG + Intergenic
1042789400 8:72586979-72587001 TTTAATTTTTTATTAAAATACGG + Intronic
1042991304 8:74643340-74643362 TTTTTTTTTTAATTCTACTGAGG - Intronic
1043124350 8:76370851-76370873 TGTTATTTTTCTTTCAGCTGTGG + Intergenic
1043778376 8:84299621-84299643 TTTAATTATTGATTCAACTTTGG + Intronic
1045291774 8:100839629-100839651 TTTGTTTCTTCATTCATCTGTGG - Intergenic
1045302618 8:100926917-100926939 TTGTATTATTCATTCAACTATGG + Intronic
1045453159 8:102348931-102348953 TTTATTTTTTCATTTTACTGAGG - Intronic
1046219908 8:111200764-111200786 TTTTTTTTTTCATTCCACAGTGG + Intergenic
1046540716 8:115578609-115578631 TTTAATTTTTCAGTGTATTGTGG - Intronic
1046644755 8:116773986-116774008 TTTATTTTTTCATACAACTTGGG + Exonic
1047572245 8:126111702-126111724 TTTAATTTTTCTTTAAATTTTGG - Intergenic
1047768277 8:128008056-128008078 TCTAATTTTTCATTTCTCTGGGG - Intergenic
1047893178 8:129335537-129335559 TTTGATTTTTCCAGCAACTGTGG + Intergenic
1048007224 8:130429184-130429206 TTTAATTTTTGTTTCCTCTGTGG + Intronic
1048113953 8:131499322-131499344 TTTAATTTTTCATAGATATGGGG + Intergenic
1048379238 8:133849786-133849808 GTCAATTTCTCATTCAACAGGGG + Intergenic
1048425827 8:134322557-134322579 TTTAATTTTTTGTTGAAGTGGGG + Intergenic
1048592204 8:135831228-135831250 TTAATTTTGTAATTCAACTGTGG + Intergenic
1048864461 8:138749433-138749455 TTTCATTTTGCATTGAACTTGGG - Intronic
1049021942 8:139963157-139963179 TTTAATTTTTCATAGACCTTTGG + Intronic
1049092644 8:140528104-140528126 TGTAATTTTACATTGATCTGCGG - Intergenic
1049996350 9:1037817-1037839 TTTTTTTCTTAATTCAACTGTGG - Intergenic
1050505553 9:6345092-6345114 TTTTCTTTTTCATACAAATGGGG - Intergenic
1050949452 9:11569532-11569554 TTTAAATTATAACTCAACTGTGG - Intergenic
1051106250 9:13584206-13584228 TTTCATTATCCATTCATCTGTGG + Intergenic
1051177164 9:14372505-14372527 TTTCATTTTTCATTTAGCTGTGG + Intronic
1051272659 9:15370714-15370736 TTTAATTTCTGATGCAAATGTGG - Intergenic
1051920091 9:22254662-22254684 TTTCTATTTTCATTCCACTGTGG + Intergenic
1051964241 9:22807386-22807408 TTTAGTTTTACATTAAATTGGGG + Intergenic
1052129537 9:24825606-24825628 TTTCAATTTTTATTCCACTGTGG - Intergenic
1052277826 9:26698019-26698041 TTTCTGTTTTCATTCCACTGTGG - Intergenic
1052310632 9:27064702-27064724 TTTAAATTTGCTTTCAAATGAGG - Intergenic
1052500534 9:29283927-29283949 TTTCATTTTTTATTCCACTATGG + Intergenic
1052590393 9:30485568-30485590 ATTAATTTTTCATTAAAATTTGG + Intergenic
1055168254 9:73223182-73223204 TTTAACTTATTTTTCAACTGAGG - Intergenic
1055255868 9:74370391-74370413 TTTATTATTTCATACTACTGTGG + Intergenic
1055596212 9:77867286-77867308 TATAATTTTTCATTTAGTTGAGG - Intronic
1055641555 9:78322671-78322693 TATCCTTTTTCATTCATCTGTGG - Intronic
1055828643 9:80356420-80356442 TTTGCTCTTTGATTCAACTGTGG - Intergenic
1056853691 9:90106471-90106493 TTTAATTAGTCATTGAAATGAGG - Intergenic
1056962585 9:91139355-91139377 TTTAATTTTTTAATGAACAGTGG + Intergenic
1057349428 9:94282817-94282839 TTTAAGTTTTAATTCCAATGAGG - Intronic
1057624414 9:96664925-96664947 TTTTATTTTATTTTCAACTGAGG + Intergenic
1058048757 9:100385383-100385405 TTTAATTTTTTATTTATCTTGGG - Intergenic
1058075011 9:100642081-100642103 TTCATTTATTCATTCAACTATGG + Intergenic
1058240694 9:102554312-102554334 TTTAATTGTTTATTCAATTTTGG - Intergenic
1058474930 9:105323345-105323367 TAAGATTTTTCATGCAACTGGGG + Intronic
1058693369 9:107538192-107538214 TTTATGTATTCATTCTACTGTGG - Intergenic
1058860392 9:109112595-109112617 TTTCATTTATCATTGTACTGTGG - Intronic
1058893764 9:109382755-109382777 TTTTTTTTTTTTTTCAACTGTGG + Intronic
1059003951 9:110381524-110381546 TCTAATTTTTGATTGAGCTGTGG + Intronic
1059051463 9:110931100-110931122 TTGAATATTTCATTCAATTCAGG + Intronic
1059127272 9:111702349-111702371 TTTAATTTTTCCATGAAATGGGG - Intronic
1059462194 9:114439366-114439388 TTTATTTTGTCCTTAAACTGAGG - Intronic
1059802064 9:117760167-117760189 TGTAATTTATCATCCAAATGGGG + Intergenic
1059813192 9:117880262-117880284 TTTGTTTATTCATTCACCTGTGG + Intergenic
1059839924 9:118203044-118203066 TTTTATTACTCATTCAATTGTGG - Intergenic
1060001932 9:119966726-119966748 TATAATTTTTCATTCAAACTGGG + Intergenic
1060605271 9:124908510-124908532 TGTAAATATTTATTCAACTGAGG - Intronic
1203437195 Un_GL000195v1:149728-149750 TTTAATTTTTCATACAGACGGGG + Intergenic
1203417774 Un_KI270364v1:2704-2726 TTGAATTTTTCTTTTGACTGTGG - Intergenic
1203368763 Un_KI270442v1:281857-281879 TTTAATTTATATGTCAACTGGGG + Intergenic
1185818669 X:3181076-3181098 TTTAATTTTTCATAGAGATGAGG - Intergenic
1185958878 X:4524593-4524615 CTTATTTCTTCATTAAACTGGGG + Intergenic
1186629769 X:11336022-11336044 CTTCATTTTTCACTCCACTGTGG - Intronic
1186738635 X:12494090-12494112 TTTTATGTTTTATTCAACTAAGG + Intronic
1187021746 X:15390030-15390052 TTTAATTTTTCTGTCATCAGAGG - Intronic
1187692674 X:21886451-21886473 TTTAATTTTCCATTAAAGGGAGG + Intergenic
1187793269 X:22974051-22974073 TTTCTTTTTTCAATGAACTGTGG + Intergenic
1188062935 X:25623092-25623114 TTTTATTTTTCAATCACCAGAGG + Intergenic
1188105370 X:26142196-26142218 CTTTGTGTTTCATTCAACTGGGG + Intergenic
1188308684 X:28589624-28589646 TTTAACTTTCCATTCAGTTGGGG - Intronic
1188814982 X:34701828-34701850 TTTATTTATCCATTCATCTGTGG - Intergenic
1188838869 X:34990669-34990691 TTTAACTTTTTATTCCCCTGTGG - Intergenic
1189654221 X:43224941-43224963 TATAATTTTTCATTTATCTCTGG - Intergenic
1189727204 X:43979391-43979413 TTTATTTATTCATTCACCTATGG - Intergenic
1190166041 X:48073556-48073578 CTTAATTTTACCTTGAACTGGGG - Intergenic
1190358618 X:49628257-49628279 TTTGATTTTTCAATCAAAAGTGG + Intergenic
1192038722 X:67594164-67594186 TTTAATTTTTCATAGAAATGGGG + Intronic
1192492221 X:71586142-71586164 TTTTTTTTTTTTTTCAACTGAGG + Intronic
1192581042 X:72281674-72281696 TTTAATTTTTTATTAACTTGGGG + Intronic
1192727027 X:73764483-73764505 ATTACTTTTTAATTCTACTGTGG + Intergenic
1193471890 X:81915650-81915672 TTTGCTTATTCATTCACCTGTGG - Intergenic
1193496803 X:82223220-82223242 TTTATTTTTTCAATTAACTTTGG + Intergenic
1193659664 X:84241623-84241645 TTTAATTTTTTAAAAAACTGTGG - Intergenic
1193681495 X:84525019-84525041 TTTTATTATTCATTCATTTGTGG - Intergenic
1193994561 X:88348783-88348805 TTTATTATTTTATTCCACTGTGG - Intergenic
1194001545 X:88435572-88435594 ATTAATTTTTCATACTACAGTGG - Intergenic
1194123034 X:89983107-89983129 TTTTAAATTTCATTCAATTGTGG - Intergenic
1194482528 X:94444420-94444442 TTTATTTTTTAATTTAACTTTGG + Intergenic
1194646227 X:96461689-96461711 TTACATTTTTCATTCAATTGGGG - Intergenic
1195497283 X:105551441-105551463 TGTTATTTTTCTTTCACCTGTGG + Intronic
1195791509 X:108592731-108592753 TTTTTTTTTTCATTCCTCTGTGG + Intronic
1196477383 X:116104465-116104487 TTAAGTTTTTCATTCAAATTCGG + Intergenic
1196616033 X:117768532-117768554 TTTAATTTTACATTCATCAGGGG + Intergenic
1196670382 X:118360355-118360377 TTTAATTTTTGGTTCAACCTAGG + Intronic
1197311502 X:124911086-124911108 TTTAATTTTTTATACAGATGGGG + Intronic
1197500769 X:127239554-127239576 TTCAATTTTACATTCTACTGAGG + Intergenic
1197525362 X:127555698-127555720 TTTAATTTTTACTTGAATTGCGG + Intergenic
1197830733 X:130639521-130639543 TGTAATTTTTCATTAAAATCTGG - Intronic
1198308714 X:135407803-135407825 TTTAATTTTTCATTTTTCTATGG + Intergenic
1198429985 X:136555705-136555727 TCTATTTTCTCAATCAACTGTGG + Intronic
1199229556 X:145420771-145420793 TTTAATTGTTCAGACAATTGTGG + Intergenic
1199474588 X:148231455-148231477 TTTAATTTTTCATAGAGATGAGG + Intergenic
1199556952 X:149119970-149119992 ATTAATTTCTAATTCAACTTGGG - Intergenic
1200475894 Y:3640543-3640565 TTTTAAATTTCATTCAATTGTGG - Intergenic
1200743344 Y:6878856-6878878 TGTAATTTTGCATTAAAATGAGG + Intergenic
1200853463 Y:7910767-7910789 TTGGATTTTTCATTAACCTGAGG - Intergenic
1200872590 Y:8119670-8119692 TTCATTTTTTAATTCAATTGTGG - Intergenic
1201069812 Y:10136615-10136637 TTTAATTTATATGTCAACTGGGG - Intergenic
1201747389 Y:17392420-17392442 TTTATTTCTTCATTAAACTAGGG + Intergenic
1201787593 Y:17802859-17802881 TGTAATTTTTCATTCAATTTTGG + Intergenic
1201813960 Y:18103129-18103151 TGTAATTTTTCATTCAATTTTGG - Intergenic