ID: 1144722757

View in Genome Browser
Species Human (GRCh38)
Location 17:17483640-17483662
Sequence AAGAATGAGGAAAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3252
Summary {0: 1, 1: 1, 2: 20, 3: 284, 4: 2946}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144722752_1144722757 22 Left 1144722752 17:17483595-17483617 CCGCAGTTGAATGAAAAATTAAA 0: 1
1: 1
2: 3
3: 64
4: 723
Right 1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG 0: 1
1: 1
2: 20
3: 284
4: 2946
1144722751_1144722757 23 Left 1144722751 17:17483594-17483616 CCCGCAGTTGAATGAAAAATTAA 0: 1
1: 0
2: 1
3: 27
4: 372
Right 1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG 0: 1
1: 1
2: 20
3: 284
4: 2946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144722757 Original CRISPR AAGAATGAGGAAAGGGAGGC TGG Intronic
Too many off-targets to display for this crispr