ID: 1144723609

View in Genome Browser
Species Human (GRCh38)
Location 17:17489297-17489319
Sequence CTGAAAACCCCCAAATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144723609 Original CRISPR CTGAAAACCCCCAAATAGCA AGG (reversed) Intronic
901789511 1:11646991-11647013 CTGAAATCCCCCAGACAGGACGG + Intergenic
902381550 1:16055154-16055176 CTGAGATCCCCCACATTGCAAGG - Intronic
903208645 1:21802309-21802331 CTAAAAACACAAAAATAGCAGGG + Intergenic
906218236 1:44057081-44057103 CTGTAAACCACCAAACACCAGGG - Intergenic
909061277 1:70881960-70881982 CTGGAAACACCCAGATGGCAGGG - Intronic
911745644 1:101439068-101439090 AAGCAAACCCCCAAATAGCCAGG - Intergenic
912939980 1:114036327-114036349 CTCCAAATCTCCAAATAGCAGGG - Intergenic
913370802 1:118096822-118096844 CTGCAAACTCCTCAATAGCAGGG + Intronic
916629155 1:166593246-166593268 CTGAAATCCCACAAAGAGCTGGG + Intergenic
918492932 1:185101874-185101896 TTGAAAACCACCAAAAATCAAGG + Exonic
918589862 1:186228854-186228876 CTGAACACACCCAAATCCCAAGG - Intergenic
919186508 1:194158169-194158191 CTGAAAACCAACAAACAGAAAGG + Intergenic
920819310 1:209365511-209365533 ATGAAAACCCCCAAAAAGGAAGG - Intergenic
922354527 1:224763417-224763439 CTGAAAAGCCCAGAATAGAAGGG + Intergenic
1067258267 10:44664140-44664162 CTGAAAAGGCCAAAATAGGAAGG + Intergenic
1067974364 10:51007303-51007325 CTGAAGACCATTAAATAGCAAGG + Intronic
1069975424 10:72209047-72209069 CTTAAACCCCCCAAATAGCTGGG - Intronic
1071039340 10:81287266-81287288 CTGGAAACACGCAAATGGCAGGG + Intergenic
1071892734 10:90029533-90029555 CTTAAAACCCCAAAATTACATGG + Intergenic
1072728869 10:97831444-97831466 CTGAACACCCTCCAATTGCAGGG + Intergenic
1073351042 10:102820050-102820072 CTGAAAAGCACAAAAAAGCATGG + Intergenic
1076910267 10:133384399-133384421 CTGACAACCCGCATACAGCAGGG - Intronic
1077752189 11:4984833-4984855 CAGAGAACCCCCATAGAGCATGG - Intronic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1078946271 11:16071539-16071561 TTGAAAACACCCTGATAGCAGGG + Intronic
1080315156 11:30939094-30939116 CTGAAAATGCCCAACTACCAAGG + Intronic
1087777703 11:102271712-102271734 TTGAAAACACCCAAATAGCTGGG - Intergenic
1090752506 11:129759844-129759866 GTGAAAACCCCTCAATTGCATGG - Intergenic
1090946450 11:131433754-131433776 AAGAAAACTCCAAAATAGCAGGG - Intronic
1091031541 11:132193354-132193376 CTGAAAACCATAAAATTGCATGG + Intronic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1095234386 12:39778954-39778976 CTGAAAAACCACTAATTGCAGGG + Intronic
1099802300 12:87472856-87472878 CTGTAAAACCCCAAAATGCAAGG - Intergenic
1102013601 12:109633821-109633843 CTGTAAGCCCCGAAATACCAAGG + Intergenic
1110797105 13:79652361-79652383 CTCAAAACCTCTAAATATCAAGG + Intergenic
1114492526 14:23112419-23112441 CTATAAACCCCCAAAGGGCAGGG + Intergenic
1115392150 14:32866053-32866075 CTGGAAACACCCAGAGAGCAGGG - Intergenic
1116211843 14:41956951-41956973 ATGAAAACCCCCAAATTTTAAGG + Intergenic
1117679917 14:58193337-58193359 CTGAAAATCCTGAAATAGAATGG - Intronic
1122347557 14:101069989-101070011 CAGAGAACCCCCAAATGTCAGGG + Intergenic
1125690330 15:41591043-41591065 CTGTGAACCACCAAAGAGCAAGG + Intergenic
1130186952 15:81692181-81692203 TTGTACACCCCCAAAGAGCAGGG - Intergenic
1133028014 16:2997049-2997071 TTCATAACCCCCAAATAGCCTGG - Intergenic
1134020838 16:10920406-10920428 CTGAAAACACAAAAATAGCCTGG - Intronic
1135116503 16:19728197-19728219 CTGACAACCACAAGATAGCAAGG + Intronic
1138624984 16:58244414-58244436 CTGAAAACCTCCATATCCCAGGG - Intronic
1139759370 16:69172078-69172100 CTAAAAACCCCCAAATTTGATGG - Intronic
1140919356 16:79522568-79522590 GTGTAAACTCCCAAAGAGCAGGG - Intergenic
1142832286 17:2558144-2558166 CAGAAAAACTCCAAATAACAGGG - Intergenic
1144651299 17:17008887-17008909 CTGAAAACGCCCAAATAAGCAGG - Intergenic
1144723609 17:17489297-17489319 CTGAAAACCCCCAAATAGCAAGG - Intronic
1145395165 17:22488764-22488786 CTGAACACACCCAGATAGCTGGG + Intergenic
1146511768 17:33455763-33455785 CTCAAAAGCCCCAGATAGCCGGG + Intronic
1146768808 17:35549259-35549281 CTGGATAACCCCAAAGAGCAAGG - Intronic
1147050623 17:37791759-37791781 CTCACAGCCCACAAATAGCATGG - Intergenic
1148674728 17:49438724-49438746 CTGACGGCCCCCAAAGAGCAGGG + Intronic
1149787128 17:59445131-59445153 CTAAATAGCCCCAAATAGAAAGG - Intergenic
1152696366 17:81799147-81799169 CTGAGAACACCCAATTAGGAGGG - Intergenic
1154253481 18:12763867-12763889 AAGAAAAAACCCAAATAGCACGG - Intergenic
1156234664 18:35190560-35190582 CTGAGAACCTCCAAATACCAGGG - Intergenic
1157514459 18:48300936-48300958 CTGAAAACCTCCTAAAAGCCAGG - Intronic
1157564751 18:48672495-48672517 CTGAAGGCCCCCAAATGGGAGGG + Intronic
1159797283 18:72860228-72860250 CTGAAAAGGGCCAAGTAGCAGGG - Intronic
1159810783 18:73015997-73016019 CTGGAAACCCTCATATAGAAAGG + Intergenic
1161145674 19:2676710-2676732 CTGAAAACCACCAAAGAGGCTGG - Intronic
1161480535 19:4508133-4508155 CTGCAAAGCCCCCAAAAGCAGGG - Intronic
1164646809 19:29864148-29864170 CTGAAAAACCTCAATTAGCCAGG + Intergenic
1165579328 19:36848790-36848812 CAAAAAACCCCCAAAAAACAAGG - Intronic
1167822019 19:51936982-51937004 ATAAAAACCCCTAAACAGCAGGG + Intronic
925064090 2:915434-915456 GTAAAAACCCCCAAATGGCAAGG - Intergenic
925255348 2:2481043-2481065 CAGAAAGCCCCAAAACAGCAAGG - Intergenic
927565125 2:24105047-24105069 CTGGAAACACCCAGACAGCAGGG + Intronic
928309535 2:30197920-30197942 CAGAAATCCCCCAGATAGGAAGG + Intergenic
928938279 2:36702866-36702888 CTGTAAACCCCCAGACAGAACGG - Intronic
929346274 2:40888211-40888233 CTGAAAGCCCCTAAATGGCCTGG - Intergenic
930064802 2:47319725-47319747 CTGAAAACCTCTAAATAGCTAGG - Intergenic
930159640 2:48141529-48141551 CTGTAATTCCCAAAATAGCATGG - Intergenic
930709681 2:54538868-54538890 CTGAGAACCCGCAAATGGCCCGG - Intronic
932065293 2:68551338-68551360 CAGTGAACCCCCAAATAGGATGG - Intronic
936407771 2:112222410-112222432 CTGGAAACACCCAGACAGCAGGG - Intronic
940414717 2:153406149-153406171 CTGAAATTCCCCAAATCACAGGG - Intergenic
941783875 2:169477946-169477968 CTAAAAACCCCAAATTAGCTGGG - Intergenic
942582612 2:177435825-177435847 GTGAAAAGCACCTAATAGCATGG - Intronic
942655936 2:178214069-178214091 CTGTAAACTCCCTAAGAGCAGGG + Intronic
943627172 2:190214257-190214279 CTGAAAATGCCCCAATACCAAGG - Intronic
943953956 2:194162443-194162465 CTGAAAATGCCCAACTACCAAGG + Intergenic
947064360 2:226204832-226204854 CTGATAGCCCCCAAATCCCAAGG - Intergenic
948507954 2:238443413-238443435 CTGAAAAGCCCTAAATAATATGG - Intronic
1172004283 20:31807369-31807391 CTGAAGAGACCCACATAGCATGG + Intergenic
1172808113 20:37627700-37627722 CTGAAAACCTCCAAATGGGGAGG - Intergenic
1172885951 20:38231014-38231036 CTGACAACCCCCCGATGGCAGGG + Intronic
1174186597 20:48710615-48710637 CTGAAAAGTCGTAAATAGCACGG - Intronic
1174673641 20:52332227-52332249 CAAACAAGCCCCAAATAGCAGGG + Intergenic
1174719952 20:52801082-52801104 CTGGAAACCACCAAGTAGAAGGG - Intergenic
1175340507 20:58226391-58226413 ATGAAGACCCCCAAATCTCAGGG - Intronic
1176871880 21:14089936-14089958 CAGAAAACCACCAAATTACAAGG - Intergenic
1179558075 21:42193357-42193379 CTGAGAACCACAAAACAGCAAGG - Intergenic
1184488844 22:44797470-44797492 CTGAAAACTCCCACTTGGCAAGG + Intronic
951037142 3:17945898-17945920 CTGAAAACCCCTAATTAACTTGG - Intronic
951320825 3:21243101-21243123 CAGAAAACGCCCAAATTGGAGGG - Intergenic
952644125 3:35635724-35635746 GAGAAAACCCCCAAATATTAAGG + Intergenic
952840719 3:37643097-37643119 CTGAAATCCCCCAGTTTGCACGG - Intronic
952911568 3:38193222-38193244 CTGAAAAGCATCAAATAACAAGG - Intronic
953041869 3:39262694-39262716 TTGAAAAATCCAAAATAGCAAGG - Intergenic
953917559 3:46930426-46930448 CAGAAAGCCCCAAAAAAGCATGG - Intronic
955824036 3:62926268-62926290 CTGAAAACCCAACAACAGCATGG + Intergenic
957806953 3:85160164-85160186 CTGAAAACCCTCATTTAGAAAGG - Intronic
962188471 3:133285409-133285431 CTGAAAACCACTAAATAGGAAGG - Intronic
966983533 3:185159387-185159409 CTGAAAATTCACAAATAGGATGG + Intergenic
969115598 4:4869018-4869040 CTGGAAACTCCCAAAGAGTAAGG + Intergenic
973290172 4:48463228-48463250 CTGAAGACCCCCTAATAAAATGG - Intergenic
973533226 4:51853694-51853716 CTGAAAAACACCAAATACCAGGG - Intronic
975413297 4:74080126-74080148 CATAAATCACCCAAATAGCAGGG - Intergenic
976327218 4:83785495-83785517 TTTAAACCCCCCAAATACCATGG + Intergenic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
979097496 4:116569476-116569498 ATGAAAACCATCAGATAGCATGG + Intergenic
984104988 4:175534131-175534153 CTCAAAACCGCTCAATAGCACGG + Intergenic
986949678 5:13068226-13068248 TTCAAAACCACCAAATAGCTGGG + Intergenic
987053517 5:14168341-14168363 CTGAAATCCCCCAAATAGGGAGG + Intronic
988027110 5:25709459-25709481 ATGAAAACATCCAATTAGCATGG + Intergenic
989116145 5:37954825-37954847 CTGAAAACCACAAAACAGGAAGG - Intergenic
991489604 5:67169806-67169828 CTTAAGACTCCCAAATAGCTAGG - Intergenic
993221578 5:85105001-85105023 TTGAATAGCCCCAAATAGTAAGG + Intergenic
997558124 5:134819644-134819666 CTCAACACCCCCAAGTAGCTGGG + Intronic
1000065767 5:157691792-157691814 CTTAAAATCCCCAAATGGCTTGG + Intergenic
1000101415 5:158020744-158020766 CTGAAAACACACAGATAGCAAGG - Intergenic
1000233192 5:159334492-159334514 TTGAAAACCCCCACAAAGAAAGG + Intergenic
1000656873 5:163889863-163889885 ATGAAGACCCCCAAATATCCAGG - Intergenic
1002453458 5:179332324-179332346 ATGAAAACCCCTAAATGACAAGG - Intronic
1003425076 6:5993794-5993816 CTGCAAACCCCCAACTAGAGTGG - Intergenic
1003683463 6:8278254-8278276 TTGAAAACCTCAAAATAACAGGG + Intergenic
1005367371 6:25092578-25092600 TTTAATACCCCCAAATAGAAAGG + Intergenic
1005722728 6:28618685-28618707 CTGCAGCCCCCCAAATAGCTGGG - Intergenic
1006392039 6:33764223-33764245 CTGAGATCCCCCAAAGTGCAGGG - Intergenic
1007238332 6:40406912-40406934 CTGAGAACCCCCAAAGAGAAGGG - Intronic
1007354970 6:41307972-41307994 CAGAAAAACTCCAAATAACAGGG + Intergenic
1008133102 6:47740429-47740451 CTCAAAAGCCCCAAACTGCAAGG - Intergenic
1008327282 6:50198368-50198390 CTGAAAAGACCCAAACAGCAGGG + Intergenic
1013577507 6:111499196-111499218 CTGAAAACTCCCTCATGGCAAGG - Intergenic
1014132175 6:117846806-117846828 CTGGAAACACCCAGACAGCAGGG + Intergenic
1014361655 6:120484346-120484368 CTGACAACCCCCAAACAAGAAGG + Intergenic
1017091973 6:150767296-150767318 ATTAAAATCCCCAAATAGCTTGG - Intronic
1018239672 6:161760831-161760853 CTGAAAACGCACAAATATTAGGG - Intronic
1018557701 6:165065595-165065617 CTGAAAATGCCCAACTACCAAGG + Intergenic
1019861479 7:3662482-3662504 TTGAAAAGCCCCATTTAGCAAGG + Intronic
1021076463 7:16310307-16310329 CAGAGATCCCCCAAAAAGCAAGG + Intronic
1021226152 7:18028780-18028802 CTGAAAGCATCCAATTAGCATGG + Intergenic
1022588550 7:31639189-31639211 CTGAAAAATCCCAAAGAGGAGGG - Intronic
1023237392 7:38104743-38104765 CTTAAAACCACAAAATAGGATGG + Intergenic
1026923514 7:74173749-74173771 CTCAAAACCCCCCAATACCCAGG + Intergenic
1027858408 7:83542766-83542788 CTGTAAACTCCTGAATAGCAGGG + Intronic
1029475043 7:100778189-100778211 CTGAAGCCTCCCAAATAGCTGGG - Intronic
1030640490 7:112000493-112000515 CTTAAAAAACCCAAATATCAAGG - Exonic
1033097533 7:138443834-138443856 CTGTGAACCACCAAAGAGCAAGG - Intergenic
1033356778 7:140606749-140606771 CTTAAACCCCCCAAATAGCAAGG + Intronic
1034709846 7:153181755-153181777 CTGAAAGCCCACAAATCTCATGG - Intergenic
1035340592 7:158158330-158158352 CTGAAAACCCTCACAGAGAAGGG - Intronic
1038504119 8:28069840-28069862 CTGAAAATCTCCAAAGAGCCAGG + Intronic
1038560650 8:28576337-28576359 CTGAGAACACCCAATTAGGAGGG - Intergenic
1039210317 8:35205750-35205772 CTGAAAAACCACAATTGGCATGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1041813715 8:61942007-61942029 TTGAAAAGACCCAAACAGCAGGG + Intergenic
1042316569 8:67432299-67432321 ATGAATACCCCTAAACAGCAGGG + Intronic
1046813288 8:118555946-118555968 CTGGAAAGCACCAAATACCAAGG - Intronic
1051213748 9:14774345-14774367 CTGAAGCCCCCCAAAAAGGAAGG + Intronic
1051488303 9:17632800-17632822 CAGGGAAGCCCCAAATAGCAGGG - Intronic
1051891375 9:21945628-21945650 CTGGAAACACCCAGAGAGCAGGG + Intronic
1055230091 9:74052762-74052784 GTGAAACCCCGCAAATACCAGGG + Intergenic
1061886690 9:133594656-133594678 CTGAAAACTCCACAAAAGCAGGG - Intergenic
1186770171 X:12810674-12810696 CTGGAAACCCCCATAAAGAAGGG + Intronic
1190640195 X:52476950-52476972 CTGAAACCTCCCAAGTAGCTGGG - Intergenic
1190647477 X:52535915-52535937 CTGAAACCTCCCAAGTAGCTGGG + Intergenic
1193479494 X:82010250-82010272 CTGGAAACACCTGAATAGCAGGG - Intergenic
1193637631 X:83971885-83971907 TTGAAAACCAGCAAAAAGCAAGG + Intergenic
1193770121 X:85578226-85578248 AAGAAAACCCCCAAAAAGCAGGG + Intergenic
1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG + Intergenic
1195795644 X:108643820-108643842 ATAAAAACCCCAAAATACCAAGG + Intronic
1199395233 X:147329718-147329740 CAGAAAACCCCAAAATATCATGG + Intergenic