ID: 1144724326

View in Genome Browser
Species Human (GRCh38)
Location 17:17494174-17494196
Sequence CTAGAAAGAGTTCATCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144724318_1144724326 19 Left 1144724318 17:17494132-17494154 CCTTTTGTCATCTAACCCAAAGA No data
Right 1144724326 17:17494174-17494196 CTAGAAAGAGTTCATCTCCAGGG No data
1144724323_1144724326 3 Left 1144724323 17:17494148-17494170 CCAAAGAAAATTAAGCGGGTGGA No data
Right 1144724326 17:17494174-17494196 CTAGAAAGAGTTCATCTCCAGGG No data
1144724321_1144724326 4 Left 1144724321 17:17494147-17494169 CCCAAAGAAAATTAAGCGGGTGG No data
Right 1144724326 17:17494174-17494196 CTAGAAAGAGTTCATCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144724326 Original CRISPR CTAGAAAGAGTTCATCTCCA GGG Intergenic