ID: 1144725515

View in Genome Browser
Species Human (GRCh38)
Location 17:17499987-17500009
Sequence CTGTGCAAGCAGGAGCAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144725505_1144725515 23 Left 1144725505 17:17499941-17499963 CCTCAAAGGCCGTGTGTGCAGAG No data
Right 1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG No data
1144725508_1144725515 14 Left 1144725508 17:17499950-17499972 CCGTGTGTGCAGAGGTGCTGGCG No data
Right 1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144725515 Original CRISPR CTGTGCAAGCAGGAGCAGGA CGG Intergenic
No off target data available for this crispr