ID: 1144726971

View in Genome Browser
Species Human (GRCh38)
Location 17:17506941-17506963
Sequence GGTCACCCCAGCCCAGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 277}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144726961_1144726971 -3 Left 1144726961 17:17506921-17506943 CCCCACGCCCAGGAGCCCCCGGT 0: 1
1: 0
2: 0
3: 19
4: 288
Right 1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG 0: 1
1: 0
2: 3
3: 34
4: 277
1144726963_1144726971 -5 Left 1144726963 17:17506923-17506945 CCACGCCCAGGAGCCCCCGGTCA 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG 0: 1
1: 0
2: 3
3: 34
4: 277
1144726962_1144726971 -4 Left 1144726962 17:17506922-17506944 CCCACGCCCAGGAGCCCCCGGTC 0: 1
1: 0
2: 1
3: 9
4: 198
Right 1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG 0: 1
1: 0
2: 3
3: 34
4: 277
1144726957_1144726971 17 Left 1144726957 17:17506901-17506923 CCCAGGTGGTGGGACAGCAGCCC 0: 1
1: 0
2: 4
3: 38
4: 307
Right 1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG 0: 1
1: 0
2: 3
3: 34
4: 277
1144726964_1144726971 -10 Left 1144726964 17:17506928-17506950 CCCAGGAGCCCCCGGTCACCCCA 0: 1
1: 0
2: 4
3: 29
4: 203
Right 1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG 0: 1
1: 0
2: 3
3: 34
4: 277
1144726958_1144726971 16 Left 1144726958 17:17506902-17506924 CCAGGTGGTGGGACAGCAGCCCC 0: 1
1: 1
2: 2
3: 21
4: 293
Right 1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG 0: 1
1: 0
2: 3
3: 34
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144726971 Original CRISPR GGTCACCCCAGCCCAGAGGA CGG Intronic
900179742 1:1305892-1305914 GGTCGCCCCAGCCCGGGAGAGGG - Intronic
901874898 1:12161860-12161882 GGTGCCCCCAGCCCACAGCATGG + Intergenic
902301850 1:15507550-15507572 GGTGGCCCCAGCACAGAGCATGG + Intronic
902481488 1:16714352-16714374 GGGGACCACAGCCCGGAGGAGGG + Intergenic
902882521 1:19382070-19382092 GGTCTTCCCAGCCTACAGGAAGG - Intronic
903216884 1:21848242-21848264 GTCCACCCCAGCCCAGAGACAGG - Intronic
904339462 1:29824756-29824778 GGCCACCCCAGGCCAGAGGCAGG + Intergenic
904501704 1:30916484-30916506 GTTCACCCCAGACCTGAGGTGGG + Intergenic
905617667 1:39412813-39412835 GCACTGCCCAGCCCAGAGGAGGG + Exonic
905824849 1:41019934-41019956 GGTCTCCCAGGCCCAGAGGCTGG + Intronic
905975776 1:42172661-42172683 GGTCACCCTACCCCAGAGGCAGG - Intergenic
906519086 1:46456744-46456766 TGTCACCCCCTCTCAGAGGAGGG - Intergenic
907784529 1:57598744-57598766 TGTCACCCCAGTCCACATGAGGG + Intronic
908127816 1:61048626-61048648 GGTCACTTGAGCCCAGAGGCTGG - Intronic
908571105 1:65411311-65411333 GGTCTCCCCAGCCCATAGTACGG - Exonic
910843479 1:91583793-91583815 TGTCAGCCAAGGCCAGAGGATGG - Intergenic
911266395 1:95749806-95749828 TATCCCCCCAGCCCAGAGAAGGG + Intergenic
911363951 1:96914249-96914271 GGACATCCCGCCCCAGAGGATGG - Intergenic
912670046 1:111617133-111617155 GGTCACATCAGCCTGGAGGAAGG - Intronic
913986011 1:143566782-143566804 TATCAGCGCAGCCCAGAGGAGGG - Intergenic
914196120 1:145448891-145448913 GGCCACCCCACCCCAGTGGAAGG + Intergenic
915569023 1:156733933-156733955 GGCCACCTCAGGCCACAGGAAGG - Intronic
915610987 1:156992486-156992508 CCTCACCCCAGCCCACAGGGTGG + Intronic
921031434 1:211338254-211338276 GGACACCTTACCCCAGAGGAAGG - Intronic
922892763 1:229074285-229074307 GGGCACCCCAGCCCACAGGAGGG + Intergenic
923840894 1:237669669-237669691 GGTCCCCACATCTCAGAGGATGG + Intronic
924234604 1:241990285-241990307 AGTCATCCCAGCCCAGGGGCTGG + Intergenic
924804393 1:247350767-247350789 GGTCACTTCAGCCCAGAAGTTGG + Intergenic
1063246711 10:4227792-4227814 GGTCCCCACAGCCAAGAGTAAGG - Intergenic
1063395064 10:5678731-5678753 GGTCATTCCTGCCCAGAGCAGGG - Intergenic
1063529651 10:6819166-6819188 GGTGACCCAATCCCACAGGATGG - Intergenic
1067294246 10:44965722-44965744 GGGCACACCATCCCAGGGGAGGG - Intronic
1067549132 10:47221160-47221182 CGTCGCCCCAGCCAAGAGCAGGG - Intergenic
1068334820 10:55621383-55621405 GGTCCCCGCACCCCAGAGCAGGG + Intronic
1070387575 10:75939739-75939761 GTTCACCCCAGCCCAAAGTCCGG - Intronic
1070655419 10:78267791-78267813 GGTCATTGCAGCTCAGAGGAGGG + Intergenic
1070783484 10:79150355-79150377 GGTCAGCGCAGGCCAGAGGCAGG - Intronic
1072272390 10:93789413-93789435 GGGCAGCCCAGGCAAGAGGAGGG + Intronic
1074307015 10:112288385-112288407 TGTCTGTCCAGCCCAGAGGATGG - Intronic
1075515105 10:123102353-123102375 GGTCACCCTATCCCAGATAACGG - Intergenic
1078022875 11:7670102-7670124 TGTAATCCCAGCCCAGAGGCGGG + Intronic
1078341692 11:10501680-10501702 AGACATCCCAGCCCAGAAGAGGG - Intronic
1079015717 11:16867051-16867073 TGTCACTGCAGCCCAGAGAATGG + Intronic
1079241856 11:18727312-18727334 GGTCACCCCAGGGCAGAAGGAGG - Intergenic
1080828684 11:35870981-35871003 GGTCACCCTGGACCAGAGGTGGG - Intergenic
1081763721 11:45594713-45594735 GCCGACCCCAGGCCAGAGGACGG - Intergenic
1081976612 11:47239419-47239441 GGAGACCCCAGCCCAGCTGAGGG + Exonic
1083457688 11:62789969-62789991 GGTCACCCCTCTCCAGAGGCCGG - Exonic
1083545149 11:63543858-63543880 GGTCAGCCCAGTGCAGTGGAAGG + Intronic
1083724745 11:64622311-64622333 TGTCACCCCTGCCCACAGCAGGG + Intronic
1084212677 11:67631128-67631150 GGTGACTCCAGCCCAGTGGCAGG - Intergenic
1084702996 11:70799732-70799754 GGCCACCCCAGCCTACAGGGTGG + Intronic
1085016492 11:73177483-73177505 GTCCACCCCAGCCCAGGGGCTGG + Intergenic
1089021909 11:115224633-115224655 ATTCACCCCAGTCCAGAGGAAGG + Intronic
1089138174 11:116266036-116266058 GGTCCCACCAGCCCAGAGAGGGG - Intergenic
1089399283 11:118155169-118155191 AGTGACCCCTGCCCAGAGCAGGG + Intergenic
1090974746 11:131671526-131671548 GGCCCTGCCAGCCCAGAGGAGGG - Intronic
1091389498 12:117494-117516 GCTCAGCCCATCCCACAGGAAGG - Intronic
1092239098 12:6826757-6826779 GGTCCTCCCAGCCCAGAGCCGGG + Exonic
1092856068 12:12674951-12674973 CCTGACCCCAGCCCAGGGGAGGG - Intronic
1092913767 12:13171527-13171549 GGACACCCCAGTCCACAGGAGGG - Intergenic
1096539090 12:52294058-52294080 GGTCACCCCAGAGAAGAGTATGG + Intronic
1096869972 12:54587094-54587116 GCTCACCCCAGGCCAGAGAGAGG + Intronic
1098333170 12:69375323-69375345 GCTCCCCACATCCCAGAGGATGG + Intronic
1100575455 12:95887958-95887980 GGGTACACCAGCCCAGAGGAAGG - Intronic
1102855637 12:116290640-116290662 GGTCACCAGACCACAGAGGAGGG + Intergenic
1104463639 12:128973607-128973629 CGTCACACAAGCCCAGAGGAAGG + Intronic
1104918931 12:132280590-132280612 CGTGCCCCCAGCCCAGAGTAGGG + Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1107060466 13:36154733-36154755 GCTCTCCCCAGCCCAGGGGCAGG + Intergenic
1112992903 13:105535445-105535467 TGTTACCACAGTCCAGAGGAAGG + Intergenic
1113049004 13:106187746-106187768 GGACAGCTCAGCTCAGAGGATGG + Intergenic
1114186226 14:20404449-20404471 GGACAACCCAGCCTAGTGGAGGG + Intronic
1118627339 14:67671777-67671799 GGTCACCCCATGGCAGAAGATGG + Intronic
1119474650 14:74920121-74920143 TGGCCCCCCACCCCAGAGGAGGG - Intronic
1119872607 14:78030043-78030065 GGACACCCCAGCCCTGGGGAGGG - Intergenic
1121338083 14:93089293-93089315 GGTCAATCCAGCCCAGAAGCCGG + Intronic
1123110185 14:105863609-105863631 GGTCACCCCAGACCAGCCGAAGG + Intergenic
1124516859 15:30374168-30374190 GCTCTTCCCTGCCCAGAGGAAGG + Intronic
1124726057 15:32156553-32156575 GCTCTTCCCTGCCCAGAGGAAGG - Intronic
1125578962 15:40772594-40772616 AGTCACCCCAGTCAAGTGGAGGG + Intronic
1125677739 15:41511697-41511719 GGCCAGCCCAGCCCAGCGCAGGG + Intronic
1126210746 15:46098219-46098241 GCTCCCCACATCCCAGAGGATGG + Intergenic
1126329870 15:47520795-47520817 GGGAACCCCAGCAAAGAGGAAGG + Intronic
1128118459 15:65128272-65128294 GGTTACCTCAGCCCAGATCAGGG + Intronic
1128450402 15:67802866-67802888 TTTCACCCAAGCCCAGGGGAGGG + Intronic
1128725177 15:69982749-69982771 GGTCACCCCAACACCTAGGAGGG - Intergenic
1128761585 15:70219742-70219764 GGGCGCCCCAGCCCACAGGGTGG - Intergenic
1129299382 15:74616453-74616475 AGCCACTCCAGCCCGGAGGATGG + Intronic
1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG + Intergenic
1130561429 15:84962522-84962544 GATCACCCGAGCCCAGGAGATGG - Intergenic
1130956725 15:88632038-88632060 TGTCAGCACAGCACAGAGGAAGG + Exonic
1132203423 15:99970557-99970579 GGTCACCCGAGCCCAGGAGTTGG - Intergenic
1132540983 16:509667-509689 GGTCACCTCAGAGCAGAGGCAGG - Intronic
1132607816 16:800815-800837 GGTCAGCCCAGCCCTGAGGAGGG - Intergenic
1132682768 16:1150158-1150180 GTTCACTCCAGCCCATCGGATGG - Intergenic
1133774744 16:8887701-8887723 GGTCACACCAGCCCCGGGGAAGG + Intergenic
1134204838 16:12228739-12228761 GGTCAGCCCAGCCCTGAGGCGGG - Intronic
1135047857 16:19168965-19168987 TGGCACCCCACCCCAGGGGAGGG + Intronic
1136065299 16:27754436-27754458 GGCCACCTCACTCCAGAGGAGGG + Intronic
1139434089 16:66926223-66926245 GGATACCCCAGCCCAGAAGAGGG + Intergenic
1139573529 16:67827665-67827687 GCTCAGCCCAGCACAGAGGAGGG + Intronic
1139598335 16:67970667-67970689 GGGCAGCCCAGTCCAGATGAGGG - Intergenic
1139705729 16:68739032-68739054 GATCACTTGAGCCCAGAGGATGG - Intronic
1141609884 16:85175325-85175347 GGGCACCCCTGCCCCAAGGACGG + Intronic
1141617752 16:85219949-85219971 GGTGACCCCAGCCTGGAGGATGG + Intergenic
1142580095 17:936602-936624 GGGCACCCCAGACCTGAGGCAGG - Intronic
1143317547 17:6043976-6043998 GGACACCAAAGTCCAGAGGATGG + Intronic
1143473568 17:7190877-7190899 GGTTGCACCAGCCCAGAGGAAGG + Intronic
1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG + Intronic
1145798351 17:27668556-27668578 GGTCATCCCAGGGCAGAGGCTGG - Intergenic
1146488747 17:33264720-33264742 GGAAACCCAAGCCCAGAGAAGGG - Intronic
1146577442 17:34007119-34007141 GGTAACAGCAGCCCAGAGGGGGG + Intronic
1148020042 17:44547658-44547680 GGTCGCCCCAAGCCAGAGCAGGG + Intergenic
1148688710 17:49514602-49514624 GGTTCCCCCAGCCCTGTGGAAGG + Exonic
1149363357 17:55916321-55916343 GGTCCCCCGAGCACAGAGCATGG + Intergenic
1150013860 17:61533397-61533419 AGTCACATCAGCCCATAGGAAGG - Intergenic
1151479682 17:74362599-74362621 GGTGACCCCTGCCCAGAGCGGGG + Intergenic
1151786250 17:76276461-76276483 GGCCACCCCATCCCAGCTGATGG + Intronic
1151945892 17:77319670-77319692 GGCCAGCCCAGGACAGAGGAAGG + Intronic
1152223608 17:79082520-79082542 GGTCACACCAGCACAGAGGAAGG + Intronic
1154131068 18:11737751-11737773 GGACATATCAGCCCAGAGGAAGG + Intronic
1155458630 18:26050111-26050133 TGTCATCCCAGCCCCTAGGAAGG + Intronic
1156139175 18:34084224-34084246 AGTCAGGGCAGCCCAGAGGAGGG - Intronic
1156241525 18:35259276-35259298 GGTCACCTGAGCCCAGAAGGTGG - Intronic
1159948366 18:74460120-74460142 GGGGAGGCCAGCCCAGAGGAAGG + Intergenic
1160333780 18:78018637-78018659 GTTGTCCCCAGGCCAGAGGACGG + Intergenic
1160382169 18:78468151-78468173 GGTCACCCCAGGACTGGGGAAGG - Intergenic
1160696283 19:486163-486185 GGACACCGAAGCTCAGAGGAAGG + Intergenic
1160840775 19:1146251-1146273 GGTCACCCCAGCACAGACTCAGG + Intronic
1160903586 19:1441293-1441315 AGTCACCTCAGCCCAGAAGGTGG + Intergenic
1161142281 19:2654810-2654832 GATGGCCCCAGCCCAGAGAATGG - Intronic
1161207332 19:3047857-3047879 GTTCACCCCAGCCAGGAGGGCGG + Intergenic
1161551703 19:4916601-4916623 GGGCATCCCAGCACACAGGACGG - Intronic
1162311435 19:9909761-9909783 GTTCTCCCCAGTCCTGAGGAAGG + Intronic
1162514343 19:11139026-11139048 GAGCAGCCCAGCCCAGGGGAGGG - Intronic
1162910672 19:13846594-13846616 GGTCACCCCAGCTCACATGCAGG + Intergenic
1164572851 19:29386586-29386608 GCTCAGCCCAGCCCAGATGATGG - Intergenic
1165331479 19:35143112-35143134 GGGCGCCCCACCCTAGAGGAAGG + Intergenic
1166360137 19:42249578-42249600 GGCCACCACAGCCGAGAAGAGGG + Exonic
1166768911 19:45268865-45268887 GGACACCCTAGCCCAGTGGAAGG - Intronic
1166809374 19:45506692-45506714 GATCATCCCAGCCCTCAGGAGGG - Intronic
1202715528 1_KI270714v1_random:40263-40285 GGGGACCACAGCCCGGAGGAGGG + Intergenic
925854522 2:8116873-8116895 GGACAGCCCAGCCCAGTGGGAGG - Intergenic
927542766 2:23927293-23927315 GGTCGCCCCAGCCCTGCGGTCGG - Intronic
929620452 2:43349126-43349148 TGTCAGCCCTGCCCTGAGGAGGG + Intronic
929783436 2:44972553-44972575 GGTCAGCCCACCCCACAGGCAGG - Intergenic
932285063 2:70524953-70524975 GCTCACCTGGGCCCAGAGGATGG - Intronic
932355836 2:71068015-71068037 GGTCCCGGCAGCCCTGAGGAGGG - Intronic
932435570 2:71700916-71700938 GGACAGCCCAGACCAGCGGAGGG - Intergenic
932745284 2:74329047-74329069 TGTCACTCCAGCCAAAAGGATGG + Intronic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
935179832 2:100679539-100679561 TGTCACCTCAGGCCACAGGACGG + Intergenic
937270741 2:120649980-120650002 AGTCACCACAGCTCAGAGCAGGG - Intergenic
937296746 2:120814063-120814085 GGTTATCCCATCCCAGAGAAAGG + Intronic
937338446 2:121076088-121076110 GATTCCCCAAGCCCAGAGGAGGG - Intergenic
938107824 2:128545279-128545301 GGTCCATCCAGCCCAGGGGAGGG + Intergenic
938287165 2:130128241-130128263 GGTCTCCCCAACACAGAGCATGG + Intronic
938304961 2:130247018-130247040 AGTCACCAGAGACCAGAGGAGGG - Intergenic
938428428 2:131210629-131210651 GGTCTCCCCAACACAGAGCATGG - Intronic
938469330 2:131544647-131544669 GGTCTCCCCAACACAGAGCATGG - Intergenic
941190332 2:162373574-162373596 GGTCCCCCCAGCCTACAGTATGG - Exonic
944041579 2:195361774-195361796 GGTCTTCCCAGCTCAGAGCAAGG + Intergenic
944651532 2:201835293-201835315 GCTCATCACAGCCCAGAGGAGGG + Intronic
945088758 2:206159546-206159568 GGTCGGCCCAGCCCGGAGGCGGG + Intronic
946172329 2:217902766-217902788 AGTGACCCCAGTGCAGAGGATGG + Intronic
946409224 2:219508159-219508181 GATGACCCCAGCCCAGAGTGGGG - Intergenic
947049959 2:226031124-226031146 GGTCACGCCAGCACAGTGGAGGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948450698 2:238069369-238069391 GGGCACCACAGCCCAGTGAAGGG + Exonic
948792919 2:240388527-240388549 GGCCAGCCCAGCCCTGAGCAAGG + Intergenic
1170715557 20:18828158-18828180 GCCCACCCCAGCTCAGAGGGAGG - Intronic
1172146427 20:32761712-32761734 GGTCATCCCAGGGCAGAGGTGGG + Intergenic
1172508762 20:35484590-35484612 GGTCACTACAGCCCAGAGATAGG + Intronic
1172771505 20:37384875-37384897 GGTCACCGCAGCCCCGGAGAGGG + Intronic
1172781328 20:37438506-37438528 AGCCTCCCCAGCCCAGAGCAGGG + Intergenic
1173862323 20:46292155-46292177 GGTCTCTCCAGCCAACAGGAAGG + Intronic
1174819248 20:53713056-53713078 GCTCACCCCAGCCCCCAGAAAGG - Intergenic
1175913821 20:62416537-62416559 GATGCCCCCAGCCCAGGGGAGGG + Intronic
1176087713 20:63305612-63305634 TGGGACCCCAGCCCAGAGGAGGG - Intronic
1176245866 20:64096316-64096338 GGTCACCCCAGCCCACTGGCTGG - Intronic
1178366323 21:31991837-31991859 CATCACCCCAGGCCGGAGGATGG - Intronic
1178585315 21:33866451-33866473 GCTGACACCAGCCCAGAGCAGGG + Intronic
1179242264 21:39602621-39602643 TGTCACCAATGCCCAGAGGACGG - Intronic
1180085713 21:45507137-45507159 GGCCCTCCCAGCCCACAGGAGGG - Intronic
1180085739 21:45507202-45507224 GGCCCTCCCAGCCCACAGGAGGG - Intronic
1180085826 21:45507443-45507465 GGCCCTCCCAGCCCACAGGAGGG - Intronic
1180095759 21:45554723-45554745 AGTCACCACAGCCAAGCGGAAGG - Intergenic
1180158772 21:45989979-45990001 TTTCACCCCACCCCAGAGCAGGG + Intronic
1180192444 21:46172519-46172541 GGTCCCATCTGCCCAGAGGAGGG - Intronic
1180884978 22:19236044-19236066 GATCACCTGAGCCCAGAGGTCGG - Intronic
1180966359 22:19789747-19789769 GATCACCTGAGCCCAGTGGATGG + Intronic
1180977051 22:19854284-19854306 GGTCTCCCCAGAGCAGAGAACGG - Intronic
1180981719 22:19881252-19881274 TGGCAGCCCATCCCAGAGGACGG - Intronic
1181345801 22:22219813-22219835 GGTCAGCCCAGCCTGGAAGAGGG - Intergenic
1182143745 22:27984152-27984174 GGCCAGCCCTGCTCAGAGGAAGG - Intronic
1182487051 22:30645737-30645759 GATCACTTGAGCCCAGAGGAAGG - Intronic
1182564050 22:31184336-31184358 GCTCCCCACATCCCAGAGGATGG + Intronic
1183027451 22:35076523-35076545 GGTGTCCCCAGCCTACAGGAGGG + Intronic
1183040336 22:35173043-35173065 AGGAAGCCCAGCCCAGAGGATGG + Intergenic
1183287536 22:36976970-36976992 GGTCTCCCTGGCCCAGAGGAGGG - Intergenic
1184478003 22:44731824-44731846 GGGCAGCCCAGCCCTGGGGAGGG + Intronic
1184606807 22:45579090-45579112 GGTGACCCAAGCCAAGAGGTTGG + Intronic
1185083509 22:48723118-48723140 GGACACACCAGCCAAGAAGACGG - Intronic
1185132068 22:49044906-49044928 GGTCAGCACCGCCCGGAGGATGG - Intergenic
949396083 3:3615914-3615936 GGTGACTCCAGCCCTGGGGAGGG + Intergenic
949639488 3:6019162-6019184 TGTATCCCCAGCCCAGATGAAGG - Intergenic
952901461 3:38114512-38114534 GGGCAGCCCAGCCCGGAGGCCGG - Intronic
953440197 3:42909889-42909911 GCTCCCCACATCCCAGAGGATGG + Intronic
953805294 3:46062824-46062846 AGCCACCCCAGCCCAGAGATAGG - Intergenic
953863735 3:46566046-46566068 GGTCACCAAGGCACAGAGGAAGG + Intronic
954148273 3:48645050-48645072 GGACGCCCCAGCCCAGGGCATGG + Exonic
954677265 3:52322811-52322833 GGTGAACGGAGCCCAGAGGAAGG - Intronic
954807303 3:53228096-53228118 GGTCACCCCAGCCCCGATAACGG + Exonic
955846395 3:63167620-63167642 GCACAGCCCAGCCCAGAAGAGGG - Intergenic
956699999 3:71950537-71950559 GGCCACAGCAGCCCAGAGGAAGG + Intergenic
960711033 3:120528223-120528245 GGTCAGCAAAACCCAGAGGAAGG - Intergenic
960873427 3:122273906-122273928 GGTCACCCCAACAGCGAGGAGGG + Intronic
960927948 3:122815039-122815061 TGTCATTCCAGCCCACAGGAGGG + Intronic
962265726 3:133942983-133943005 GCCCAGCCCAGCCCAGAAGATGG - Intronic
962677993 3:137770434-137770456 GCTCACCCGACCCCAGAGGCTGG - Intergenic
962775283 3:138653449-138653471 GGTCTCCTCAGCCAAAAGGAGGG - Exonic
963408843 3:144904566-144904588 TGTCACCCAACCCCAGAGGTTGG + Intergenic
966918608 3:184598134-184598156 CCCGACCCCAGCCCAGAGGACGG - Intronic
968606016 4:1536141-1536163 GGTCACGCCTGCCCAGAGCGGGG + Intergenic
969445080 4:7240123-7240145 GGTCATCACAGCCCAGAACACGG - Intronic
972563692 4:40250812-40250834 AGTCTCCCAGGCCCAGAGGAGGG - Intergenic
975170574 4:71227713-71227735 TGACACACCAGCACAGAGGATGG - Intronic
975311162 4:72905255-72905277 GTTTACTCCACCCCAGAGGATGG - Intergenic
976719884 4:88159071-88159093 GGTGACCCTAGCCCCGAGGGAGG - Intronic
976738083 4:88331029-88331051 GGGCCCCCCAGCAAAGAGGATGG + Intergenic
979559136 4:122082266-122082288 GGTCAGACCAGCCAAGAGTAAGG + Intergenic
981488416 4:145313429-145313451 GGTTACACTAGCCCAGAGGAAGG + Intergenic
981752090 4:148102470-148102492 GGTAGCACCTGCCCAGAGGAGGG - Intronic
982744266 4:159090306-159090328 GGTCACCTGAGCCCAGAAGGTGG - Intergenic
983350192 4:166577016-166577038 GAGCACTTCAGCCCAGAGGAAGG - Intergenic
985587375 5:747757-747779 GGCCACCACTGCCCAGAGAATGG + Intronic
985601927 5:839849-839871 GGCCACCACTGCCCAGAGAATGG + Intronic
986468668 5:8052260-8052282 GGACACCAAGGCCCAGAGGAAGG + Intergenic
987710266 5:21495387-21495409 TGTCACCCCAGCCCTCTGGAAGG - Intergenic
988684389 5:33513605-33513627 GGGCGCCCCAGGCCAGAGAAGGG + Intergenic
990218861 5:53564623-53564645 GATCACCTGAGCCCAGAGGGTGG - Intronic
992973547 5:82087709-82087731 GCTCACCCTGGGCCAGAGGAAGG - Intronic
996402951 5:123083175-123083197 TGACACCCCAGCTCAGAGGAGGG + Intergenic
998039692 5:138944468-138944490 GGTCAGCCCAGCCCAGGAGCAGG + Intergenic
999382983 5:151134740-151134762 GGTGTCCCCAGCCCAGAGGTAGG + Intronic
999459567 5:151746293-151746315 GGTCCCCACAGCCCACAGGATGG - Exonic
1000599492 5:163254607-163254629 GCTCACCCTAGCACAGAGAAAGG + Intergenic
1001711498 5:173782301-173782323 GGGCACCCCAGCCAACAGGCTGG - Intergenic
1002565709 5:180112165-180112187 GGTGACACCAGCCCAGAGCCAGG - Intronic
1004576920 6:16905474-16905496 GGTCTACACAGCCCAGAGTAAGG - Intergenic
1004947876 6:20635678-20635700 GGTCTCCCCAGCCCTTAGGCTGG + Intronic
1005835543 6:29705948-29705970 GGACTCCCCAGCTCAGAGAAAGG - Intergenic
1006448086 6:34091041-34091063 GCTCACCCCAGCCCAGGTGGAGG + Intronic
1007622115 6:43221633-43221655 GCACACCCCTGCCCAGAGGCAGG + Intronic
1007711070 6:43824660-43824682 TGTCACCCCAGCCCAGGAGAGGG + Intergenic
1008439338 6:51514564-51514586 GGACACCTCAGCACTGAGGAGGG + Intergenic
1008534967 6:52500602-52500624 GGTCCCACCAGCCCAGTGGCCGG - Exonic
1009427682 6:63532454-63532476 GGTCAGCACAGCACAGTGGATGG + Intronic
1013348757 6:109287540-109287562 GACCACACCTGCCCAGAGGAAGG - Intergenic
1014498285 6:122155294-122155316 GGTCAGCCCAGAGCACAGGAAGG - Intergenic
1018064647 6:160116658-160116680 ACACTCCCCAGCCCAGAGGAAGG - Intergenic
1018569128 6:165188266-165188288 GGACACCCCAGCCCAGTGCCTGG - Intergenic
1018999791 6:168740618-168740640 GGACCCCACAGCCCAGATGAAGG + Intergenic
1019149782 6:169997490-169997512 GGTCACCCCAGGCCATGAGAGGG - Intergenic
1019294615 7:267145-267167 GGTCCCTCCAGCTCACAGGATGG - Intergenic
1019295027 7:269482-269504 GGTGACCCCAGATGAGAGGAGGG - Intergenic
1019531024 7:1503619-1503641 GGTCTCCCCAGCCAGGAGGCGGG - Intronic
1021420183 7:20438033-20438055 CGTCACCCCAGCCCCTAGGAAGG - Intergenic
1022271136 7:28809230-28809252 AGCCACCCCAGCCCACAGGGGGG + Exonic
1022612167 7:31886690-31886712 GGTCAGCCAGGCACAGAGGATGG + Intronic
1023888689 7:44377779-44377801 GGTCACCCAAGTCCAGAGCCTGG - Intergenic
1029416285 7:100445147-100445169 GGTCAGCTCAGCCTGGAGGATGG + Intergenic
1029626399 7:101722692-101722714 GGGCAACCCTGCCCAGAGGCAGG + Intergenic
1029736618 7:102468992-102469014 GGTCATCCGAGCCCACAAGAAGG + Exonic
1031972179 7:128072964-128072986 GGTCAGCCCAGCCCAGAATTGGG + Intronic
1032252863 7:130272795-130272817 GGCGACCCCAGCCCTGAGGTGGG - Intronic
1032589023 7:133175297-133175319 GGGAACCCCAGCCCAGTGAAAGG + Intergenic
1032876761 7:136046201-136046223 TGTCTCCACAACCCAGAGGATGG - Intergenic
1036699555 8:11002953-11002975 GGGCACCAAAGCCCAGAGAAGGG + Intronic
1037628213 8:20627388-20627410 GGTATTCCCAGCCCTGAGGAGGG - Intergenic
1041658422 8:60376885-60376907 GGTGGCCCCAGCACAGAGGCAGG + Intergenic
1046497831 8:115037052-115037074 GATCACCCCAGGGCTGAGGAGGG + Intergenic
1048313491 8:133344513-133344535 GGTCTCCCCAGAGCTGAGGAGGG - Intergenic
1048586168 8:135776151-135776173 GGTTACCAGAGGCCAGAGGAGGG + Intergenic
1048586386 8:135777935-135777957 GGTTACCAGAGGCCAGAGGATGG + Intergenic
1049286895 8:141780758-141780780 TGTCACCACAGCCAGGAGGATGG + Intergenic
1049467074 8:142756461-142756483 GGCCACCTCATCCCAGGGGAGGG + Intergenic
1051265775 9:15307198-15307220 GCTCAGCCCAGCGCAAAGGAGGG + Exonic
1052274771 9:26664190-26664212 GCTCCCCACATCCCAGAGGATGG - Intergenic
1052414352 9:28158124-28158146 GGTCTCCCCAGCCATGTGGAAGG - Intronic
1058531899 9:105914397-105914419 TGTCTCCCCAGCCATGAGGAGGG + Intergenic
1061079310 9:128360698-128360720 GGCCTGCCCAGCCCAGAAGACGG - Exonic
1061128324 9:128690100-128690122 CGGCACCCCCGCCCAGAGGCTGG + Intronic
1061871133 9:133521330-133521352 GGTCAGCCCAGCTCAGCGGGAGG + Intronic
1061941618 9:133887072-133887094 GCTCAGCCCAACTCAGAGGAGGG + Intronic
1062274892 9:135726018-135726040 GGCCACCCCACCCAGGAGGAGGG + Intronic
1062440905 9:136568819-136568841 GCCCGCCCCAGCTCAGAGGAGGG - Intergenic
1062595373 9:137296751-137296773 GGACACAGCAGGCCAGAGGAGGG - Intergenic
1062698612 9:137887944-137887966 GGCCACCCCACCCCAGTGGAAGG - Intronic
1185431665 X:14824-14846 GAGCATCCCAGCCCAGTGGAGGG + Intergenic
1185440989 X:227543-227565 GAGCATCCCAGCCCAGTGGAGGG + Intergenic
1186283015 X:8014506-8014528 GGCAACCCCACCACAGAGGATGG - Intergenic
1188860664 X:35251721-35251743 GGTCAGGGCAGCCCAGATGATGG + Intergenic
1189251236 X:39601900-39601922 GGCCACACCAGCCCAGCGCAGGG + Intergenic
1189629339 X:42934772-42934794 GGTCCCCTCAGCCCACAGTAGGG - Intergenic
1192446492 X:71215185-71215207 TGTCAGCCCAGCCCAGGGGAGGG - Intronic
1192500194 X:71645328-71645350 GCTCCCCACATCCCAGAGGATGG + Intergenic
1195377173 X:104239136-104239158 TTTCAGCCCAGCCCAGAGGAAGG + Intergenic
1195888920 X:109671200-109671222 GCTCCCCACATCCCAGAGGATGG - Intronic
1195958070 X:110355311-110355333 GATCACCTGAGCCCAGAGGCTGG + Intronic
1196385773 X:115147963-115147985 GATCACGTGAGCCCAGAGGATGG + Intronic
1196818705 X:119685996-119686018 GGTCACCCCTGGCCTGAGGTGGG - Intronic
1199681841 X:150230113-150230135 GGACACCCCAGCAGAGAAGATGG - Intergenic