ID: 1144727458

View in Genome Browser
Species Human (GRCh38)
Location 17:17508940-17508962
Sequence AGCCCTGATGTCCCCGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144727450_1144727458 10 Left 1144727450 17:17508907-17508929 CCCTCCTGCGGGGAAGATGGGTC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
1144727449_1144727458 11 Left 1144727449 17:17508906-17508928 CCCCTCCTGCGGGGAAGATGGGT 0: 1
1: 0
2: 0
3: 2
4: 137
Right 1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
1144727442_1144727458 29 Left 1144727442 17:17508888-17508910 CCTGGCGGCTCTGGCCAACCCCT 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
1144727441_1144727458 30 Left 1144727441 17:17508887-17508909 CCCTGGCGGCTCTGGCCAACCCC 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
1144727446_1144727458 15 Left 1144727446 17:17508902-17508924 CCAACCCCTCCTGCGGGGAAGAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
1144727451_1144727458 9 Left 1144727451 17:17508908-17508930 CCTCCTGCGGGGAAGATGGGTCG 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
1144727454_1144727458 6 Left 1144727454 17:17508911-17508933 CCTGCGGGGAAGATGGGTCGGGT 0: 1
1: 0
2: 0
3: 14
4: 73
Right 1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144727458 Original CRISPR AGCCCTGATGTCCCCGCACA AGG Intronic
901140227 1:7024308-7024330 CACCCTGATGTGCCCACACATGG - Intronic
903056023 1:20636738-20636760 AGCCCTGATGACCCAGCCCATGG - Intronic
904400678 1:30254512-30254534 AGACCTGAGCTCCCCACACAGGG - Intergenic
909352741 1:74673633-74673655 AGCCCAGGTGCCCGCGCACAGGG - Exonic
914302492 1:146388968-146388990 TGCCCTGGTGCCCCTGCACAGGG + Intergenic
915315198 1:155024602-155024624 ATCCCTGATCTCCCCGCACCAGG - Exonic
916747571 1:167696138-167696160 ACCCCTGAGGTCCCTGCACCAGG + Intronic
918132586 1:181642784-181642806 AGCCTGGATGGCCCAGCACAGGG + Intronic
920305316 1:205014806-205014828 AGTCCTCATGCCCCTGCACATGG + Intronic
1062991917 10:1827256-1827278 GGCCCTGATGCCTCCACACATGG - Intergenic
1064281307 10:13954055-13954077 TGCCCTGATGTCCTAGCACAGGG - Intronic
1064783447 10:18868012-18868034 AGCACTGAGGTCCCTGCAAATGG - Intergenic
1070380420 10:75876100-75876122 AGGCCTGATGTCCTCCCACCAGG - Intronic
1076540743 10:131213208-131213230 AGCCCTGAGCTCCTGGCACACGG + Intronic
1080888487 11:36388191-36388213 AGCCCATATGTTCCTGCACAGGG + Intronic
1083234061 11:61340811-61340833 AGCTCTGATGTCTCCCCACCTGG + Intronic
1083571205 11:63763149-63763171 AGCCCTGCCCTCCCCGCGCAGGG - Exonic
1119667951 14:76498451-76498473 AGGTGTGATGGCCCCGCACACGG + Exonic
1121182366 14:91938997-91939019 AGCCCAGATTTCCCAGGACAGGG + Intronic
1122268810 14:100559128-100559150 AGCCCTGCTCTCCCAGCAGAGGG - Intronic
1122505890 14:102231531-102231553 GTCCCTGATGTCCCAACACATGG + Intronic
1122779624 14:104138279-104138301 AGCCCTGGTGTCCCGGGAGAGGG + Intergenic
1123010713 14:105348307-105348329 ACCCCAGCTGTCCCTGCACATGG - Intronic
1130676415 15:85956231-85956253 AGCCCTGATGTAACCCCAGAAGG + Intergenic
1132566553 16:626143-626165 AGCCCTGAGGTCCCCGAACCTGG + Intronic
1133237193 16:4392826-4392848 AGGCCTGCTGCCCCCGCACCAGG + Intronic
1134603632 16:15552678-15552700 AGCCCTGCTGTCTCGCCACATGG + Intronic
1134908088 16:17999338-17999360 AACCCTCATGTCCACGTACACGG - Intergenic
1135994237 16:27236184-27236206 GGCCCTGCTGTCCCCGGCCACGG - Intronic
1137270867 16:46901609-46901631 AGCCCTGATGTTCCCGAAAGTGG + Intronic
1140229915 16:73109022-73109044 ATCCCTGTTGTTCCAGCACAAGG + Intergenic
1141098068 16:81177022-81177044 AGCCCTGATCTCCACCCACTGGG - Intergenic
1142073799 16:88105904-88105926 GGCCCTGCTGTCCACACACAAGG - Intronic
1142247790 16:88977680-88977702 AGCCCTGCTGTCTCCACAGAGGG - Intergenic
1143642470 17:8206974-8206996 AGCCCTGGTGTCCCCGGCCTGGG - Intronic
1143742534 17:8965210-8965232 AGCCCTGATGCCCACGCTCACGG + Intronic
1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG + Intronic
1148051096 17:44770236-44770258 GGCCCTGAAGTCCCCTCACTTGG + Intronic
1148783230 17:50133223-50133245 AGGCCTGCTGGCCCAGCACAGGG + Intergenic
1150652627 17:67019865-67019887 AGCCCAGAGGTCACCCCACATGG + Intronic
1152689260 17:81710571-81710593 AGCCTGGATGGCCCCGGACAAGG + Intergenic
1157485006 18:48080613-48080635 AGCTCTGAAGTGCCCTCACATGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1158842236 18:61400141-61400163 AGCCCTATTGTCCCCTCACTTGG - Intronic
1158939843 18:62397354-62397376 AGTCCTGCTGTACCCTCACATGG + Intergenic
1160778144 19:866139-866161 AGCTCTGCTGTCCCCGCCCCCGG - Intergenic
1160820121 19:1053987-1054009 ACCCCTGATGGCCCTGCAGATGG + Exonic
1162108937 19:8389905-8389927 AGCGCTGAGGTCCCCGGAAATGG + Intronic
1162528690 19:11222848-11222870 AGCCCTGCTGACCCTGCGCATGG - Exonic
1162619086 19:11826225-11826247 ATCCCTGAGTTCCCAGCACATGG + Intronic
1162627804 19:11899536-11899558 ATCCCTGAGTTCCCAGCACACGG + Intronic
1162964732 19:14150517-14150539 AGCCCTCATTTCCCTTCACAGGG + Exonic
1165473710 19:36017591-36017613 AGCCCTGATCCCCCCTCAGATGG - Intronic
1167037625 19:47003424-47003446 AGGGCTGCTGTCCCCTCACACGG - Exonic
925859243 2:8159277-8159299 AGCCCTGTTTTCCCAGCACAAGG + Intergenic
935129286 2:100249367-100249389 CTCCCTGCTGCCCCCGCACAGGG + Intergenic
937345312 2:121121789-121121811 AGCCCTCATGACCCCCTACAGGG + Intergenic
942059710 2:172216905-172216927 AGAACTGATGTCCCAGCTCAAGG + Intergenic
948503633 2:238412557-238412579 TGCCCTGATGGCCCAGCACGTGG + Intergenic
948894696 2:240922652-240922674 AGCCCTGACTGCCCCGCACCTGG - Intronic
1169048950 20:2560089-2560111 AACCCTGATGGCCCAGCACCCGG - Intronic
1169674714 20:8140737-8140759 TACCATGATGTCCCCGAACAGGG + Intronic
1175766713 20:61597525-61597547 CGCCCTGATGCCCCAGGACAGGG - Intronic
1175897615 20:62346334-62346356 AGCCCTCATGTCCCCCCAGGGGG - Intronic
1176167737 20:63682807-63682829 AGCCCTGACTTCCGAGCACACGG - Intronic
1178820700 21:35972567-35972589 AGCCCTGCTGCCCCCTCCCAGGG + Intronic
1179176670 21:39012559-39012581 AGCCCGGAGCTCACCGCACAGGG + Intergenic
1181027002 22:20132260-20132282 CGCACTGGTGTCCCCACACAAGG - Intronic
1183685203 22:39357641-39357663 AGCCCTGCTGGCCCCGGACCCGG + Intronic
1184698204 22:46151041-46151063 AGTCCCGATGTCCCCGCCCGTGG - Intronic
1185341828 22:50294416-50294438 AGCCCTGATGTCCCAGAACCCGG + Intronic
949752603 3:7372010-7372032 GGCCCTGCTGTCTCTGCACATGG - Intronic
951872149 3:27374774-27374796 ACCCCTGATGTCCAGACACAAGG + Exonic
954806521 3:53224047-53224069 AGCCTTGATGTCCCCGGACTGGG + Intergenic
959068166 3:101678235-101678257 AGAGCTCATGTCCCCGCACCTGG - Intergenic
961585013 3:127915260-127915282 AGCCCCGGTGTCGCTGCACAGGG - Exonic
962139480 3:132773219-132773241 AGACCTGATGTCCCAGTTCAAGG + Intergenic
962398765 3:135039685-135039707 AGCCCTGCTGGCCCCGAGCAAGG - Intronic
964812203 3:160677807-160677829 AACCCTGCTGTGCCCTCACAGGG + Exonic
968523651 4:1045794-1045816 GGCCCCCATGTCCCCGCAGAGGG - Intergenic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
977666832 4:99652852-99652874 CGCCCGGATGGCCCCGCACCTGG + Exonic
985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG + Intergenic
990753033 5:59039075-59039097 AGCCCTCATGTGCCGGCACCGGG - Intronic
997476239 5:134144214-134144236 AGCCGTGCTGTCCCCACACAGGG + Intronic
997982216 5:138475428-138475450 AGCCCAGATGTCCCTCCACAGGG - Intergenic
1001288129 5:170438349-170438371 TGCCCTGCTGTCCCCACACGAGG - Intronic
1002060185 5:176621195-176621217 AGCCCTGCTGCCCCCTCACCTGG + Exonic
1002064966 5:176647400-176647422 AGCCCTGCTGTCCCCGCCTCTGG - Exonic
1003092446 6:3115374-3115396 AGCACTGCTGTCCCCGCGCCTGG + Intergenic
1016261717 6:142179464-142179486 AACCCTGATGTCCACCAACAGGG + Intronic
1017043763 6:150328237-150328259 AACACTGATGTCCCAGCTCAAGG + Intergenic
1017065436 6:150524463-150524485 AGCCCTCAAGTCCCCACACAAGG + Intergenic
1017764383 6:157594694-157594716 AACCCTGGTGTGCCCCCACATGG - Intronic
1019184515 6:170213319-170213341 AGCGCTGAAGTCTCCACACAAGG + Intergenic
1019412177 7:911456-911478 AACCCTGAGGCCCCCACACAGGG + Intronic
1019511875 7:1421777-1421799 TGCCCTGGTGCCCCTGCACAAGG + Intergenic
1025982664 7:66419486-66419508 AGCCCTAAAGTCCAAGCACAGGG + Intronic
1026033108 7:66812500-66812522 AGCCCTAAAGTCCAAGCACAGGG - Intergenic
1031890996 7:127293512-127293534 AGCCCTGATCTCCCTGATCAGGG + Intergenic
1032002261 7:128273012-128273034 AGCCCTGTTGGCCCTGCACTAGG + Intergenic
1032121901 7:129162655-129162677 AGCCCGGGTGACCCAGCACAGGG + Intronic
1033589433 7:142797367-142797389 AGCCCAGGTCTCCCAGCACAGGG - Intergenic
1034968000 7:155403420-155403442 AGCCCAAATGGCCTCGCACAGGG + Intergenic
1036141904 8:6216633-6216655 AGTCCCAATGTCCCCACACATGG + Intergenic
1044875624 8:96663107-96663129 AGGACTGATGTCTCCTCACAAGG + Intronic
1049299137 8:141860617-141860639 AGCCCTGATGGCTCTGCTCAGGG - Intergenic
1049761817 8:144335105-144335127 AGCCCTTGTGTGCCCTCACAGGG + Intronic
1052290411 9:26833863-26833885 TGTGTTGATGTCCCCGCACAAGG - Intergenic
1060627193 9:125124518-125124540 AACACTGATGTCCCAGCTCAAGG + Intronic
1061544926 9:131299004-131299026 AGCCCTGGTGTCCTCTGACATGG + Intronic
1061561414 9:131406268-131406290 AGCCCTGATGCACCTGCCCATGG - Intronic
1062480097 9:136747136-136747158 AGCCCAGATGACCCAGGACAGGG + Intronic
1186624304 X:11275883-11275905 AGCCCTGTCGTCCCCCTACAGGG + Intronic
1188212462 X:27441938-27441960 ACCTCTGTTGTCTCCGCACACGG - Intergenic
1192584179 X:72306839-72306861 AGCCCTGACGCACACGCACACGG + Intronic