ID: 1144727972

View in Genome Browser
Species Human (GRCh38)
Location 17:17511317-17511339
Sequence CAGTTCAGTGCTTCCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144727972_1144727984 20 Left 1144727972 17:17511317-17511339 CCTGAGCAGGAAGCACTGAACTG 0: 1
1: 1
2: 1
3: 25
4: 282
Right 1144727984 17:17511360-17511382 TCCCAGAGAGGCCTGGCCATGGG 0: 1
1: 0
2: 2
3: 46
4: 276
1144727972_1144727983 19 Left 1144727972 17:17511317-17511339 CCTGAGCAGGAAGCACTGAACTG 0: 1
1: 1
2: 1
3: 25
4: 282
Right 1144727983 17:17511359-17511381 GTCCCAGAGAGGCCTGGCCATGG 0: 1
1: 0
2: 4
3: 38
4: 412
1144727972_1144727976 8 Left 1144727972 17:17511317-17511339 CCTGAGCAGGAAGCACTGAACTG 0: 1
1: 1
2: 1
3: 25
4: 282
Right 1144727976 17:17511348-17511370 TGCCCCCCACAGTCCCAGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 229
1144727972_1144727981 13 Left 1144727972 17:17511317-17511339 CCTGAGCAGGAAGCACTGAACTG 0: 1
1: 1
2: 1
3: 25
4: 282
Right 1144727981 17:17511353-17511375 CCCACAGTCCCAGAGAGGCCTGG 0: 1
1: 0
2: 5
3: 59
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144727972 Original CRISPR CAGTTCAGTGCTTCCTGCTC AGG (reversed) Intronic
900431422 1:2604860-2604882 CACTCCAGTCCCTCCTGCTCTGG + Intronic
900891916 1:5455701-5455723 GCGCTCAGTGCTTCCTGCGCTGG + Intergenic
900920898 1:5669687-5669709 GAGTTTTGTGCTTGCTGCTCAGG - Intergenic
903986635 1:27234088-27234110 CAGCCCACTCCTTCCTGCTCTGG - Intergenic
904675504 1:32196900-32196922 CAGATCAGTGGTACCTGCCCTGG - Exonic
906166394 1:43689610-43689632 CAGCTGTGTGCCTCCTGCTCTGG + Intronic
906453195 1:45970318-45970340 CAGTTCAGGTCTTCCTGCCCTGG + Intronic
906581832 1:46941311-46941333 CAGTTCAGCTCTACCTGCACAGG - Exonic
906691046 1:47792915-47792937 CAGGGCAGTGCATCCTGCTCTGG - Intronic
906816011 1:48880065-48880087 GAGTTCAGTGTATACTGCTCAGG - Intronic
909597613 1:77423641-77423663 CTGTTCAGTGTTTCCAGCCCTGG - Intronic
912148364 1:106822871-106822893 CAGCTCTGTTCTTTCTGCTCAGG + Intergenic
917219033 1:172707601-172707623 CAGTTCAGTGCGGGCTTCTCTGG + Intergenic
918735698 1:188060198-188060220 CAGTTTTGTTCTTCTTGCTCAGG + Intergenic
919096209 1:193039695-193039717 CAGTTTAGTTCTTTTTGCTCAGG - Intronic
1062970828 10:1647082-1647104 CATTACAGTGCCTGCTGCTCTGG + Intronic
1062990627 10:1811671-1811693 CATTTCTGTGCTTTCTGCTTTGG + Intergenic
1064043031 10:11985036-11985058 CAGTTTTGTGCTACCTGTTCAGG + Intronic
1064364699 10:14697122-14697144 CAGTTCTGTGCTTGGGGCTCTGG + Intronic
1066241771 10:33543575-33543597 CAGTTCACTGATTCCTTCTGTGG - Intergenic
1069728239 10:70594917-70594939 CATTTCAGTGCCTGCTTCTCAGG + Intergenic
1070724938 10:78781421-78781443 CAGCACAGTGCTTCCTGCCCTGG - Intergenic
1076932541 10:133542494-133542516 GAGTTCAGTGTATACTGCTCAGG + Intronic
1078879253 11:15431924-15431946 CAATTTAGTGCTTCCAGCCCAGG + Intergenic
1079166446 11:18048221-18048243 CAGTTTTGTGCTTTTTGCTCAGG - Intergenic
1079553426 11:21729865-21729887 AAAGTCAGTCCTTCCTGCTCAGG - Intergenic
1081053439 11:38375886-38375908 CAGCTCAGTTCTTTCTGCTTAGG + Intergenic
1082687857 11:56261180-56261202 CAGATTAGTTCTTTCTGCTCAGG - Intergenic
1082763575 11:57149040-57149062 GAGTCCAGTGCTGCCTCCTCTGG - Intergenic
1082889222 11:58120555-58120577 GAGTTCAGTGTATACTGCTCGGG - Intronic
1082994678 11:59243434-59243456 CAGTCCAATGCTTGCTTCTCTGG + Intergenic
1083147821 11:60772105-60772127 CGGTTCCGTGATACCTGCTCAGG - Intronic
1084583285 11:70037925-70037947 CAGTTCACTGCTTTCTCCTTGGG - Intergenic
1084776333 11:71379262-71379284 CACATCAGTGCTGGCTGCTCAGG - Intergenic
1084925494 11:72508153-72508175 CACTAGAGTGCTTCCTGCCCGGG + Intergenic
1085061789 11:73454059-73454081 CAGTCCAGGGCTTCTTTCTCTGG - Intronic
1087804987 11:102545668-102545690 GTGTTCAGTGCTTCCTCCTCAGG + Intergenic
1089273452 11:117316550-117316572 CAGTTAAGTGATTCCTGCCGCGG + Intronic
1089283060 11:117387946-117387968 TATGTCAGTGCTTCCTGCGCTGG - Intronic
1090559931 11:127920884-127920906 CAGTTCAGTTTTTCCTACCCCGG + Intergenic
1090831955 11:130426500-130426522 CAGGTCAGTTCTTCCTTCCCTGG + Intronic
1091704430 12:2684135-2684157 GGGTCCAGTGCTTTCTGCTCGGG + Intronic
1092820134 12:12345976-12345998 CATATCAGTGCTTCCTGGCCAGG + Intronic
1093662835 12:21776439-21776461 GAGTTCAGTGCTCCCTGGGCAGG + Intergenic
1094807760 12:34108299-34108321 CAGGTCACGGCTTCCCGCTCTGG - Intergenic
1095505583 12:42894546-42894568 GAGTTCAGTACTTCTTTCTCAGG - Intergenic
1096012307 12:48230183-48230205 AAGTGCAGTGTATCCTGCTCAGG + Intergenic
1096014174 12:48252773-48252795 GAGTTCAGTGTATACTGCTCAGG - Intergenic
1096613336 12:52817280-52817302 CCGTTCACTGCTTTCTTCTCTGG + Intergenic
1097266737 12:57750242-57750264 CATTTCAGAGCTTTCTGCTATGG + Intronic
1097770337 12:63576983-63577005 CAGTTTTGTTCTTCTTGCTCAGG - Intronic
1098150806 12:67544477-67544499 CATTTGAGAGCATCCTGCTCTGG - Intergenic
1098283450 12:68884509-68884531 CAGTGCTGAGCTTCCTGTTCTGG - Intronic
1098928799 12:76384865-76384887 TAGTTGGGTGGTTCCTGCTCAGG - Intronic
1099420823 12:82458472-82458494 CAGTTCAGGTTTTCCTACTCTGG - Intronic
1100004556 12:89878823-89878845 CACTTCAGTGCTTCCTTCCCAGG - Intergenic
1100478893 12:94959258-94959280 CATTTTAGTGCTTCCAGATCTGG + Intronic
1101196869 12:102392524-102392546 TAATTCAGTGGTTCCTGCTTAGG - Intergenic
1101591061 12:106125820-106125842 CAGTGATGTGCTTGCTGCTCTGG - Intronic
1104119533 12:125786100-125786122 GAAATCACTGCTTCCTGCTCAGG + Intergenic
1106896283 13:34306032-34306054 CAGTTTTGTTCTTCCTGCTTAGG - Intergenic
1110499084 13:76204973-76204995 CAGCTCAGGACTTCCTGCGCAGG - Intergenic
1110743022 13:79019344-79019366 CATTCCAGTGCTTACTGCTGAGG + Intergenic
1112602349 13:100868946-100868968 CACTACAGTGCGTCCTGCTCTGG - Intergenic
1115732389 14:36285470-36285492 CAGTTCAGTGCTCCATTCCCTGG + Intergenic
1115957060 14:38793369-38793391 CTGATCAGAGCTTCCTTCTCTGG - Intergenic
1116353732 14:43900580-43900602 CAGTTTTCTGCTTCCTGCCCTGG + Intergenic
1116379817 14:44251477-44251499 CACTTCAGTGCTTAGTGGTCTGG + Intergenic
1116391621 14:44398612-44398634 CAGTTTTGTTCTTTCTGCTCAGG - Intergenic
1116845937 14:49865058-49865080 CAGTACTGTGCTTCCTTCACCGG - Intergenic
1120446734 14:84607624-84607646 AAGTTCAGTACCTCCTTCTCTGG + Intergenic
1126378134 15:48017322-48017344 AACTTCAGTGCTTACTTCTCAGG - Intergenic
1127573550 15:60267525-60267547 CAGTTGAGTGCTGTGTGCTCTGG - Intergenic
1130441461 15:83958489-83958511 CTGTTAAGAGCTTCCTCCTCTGG - Intronic
1131446224 15:92499916-92499938 AAGCTCAGTGCTCCTTGCTCTGG - Intronic
1132116122 15:99137691-99137713 CAGTTCAGTGCGCCCTGTGCAGG - Exonic
1132258475 15:100400058-100400080 CACTTCAGTGGTTCCTGCACAGG + Intergenic
1133116791 16:3582163-3582185 CAATCCAGGGCTTCCTCCTCTGG - Exonic
1134448953 16:14351850-14351872 CATGTCAGAGCTTCCTTCTCTGG + Intergenic
1135174212 16:20213791-20213813 CACTAAAGTGCTTCCAGCTCTGG + Intergenic
1136186116 16:28590020-28590042 CAGCTCAGTGCAGCATGCTCGGG + Intronic
1137632682 16:49958035-49958057 CAGCTCAGTGCTTCCCCCTAGGG - Intergenic
1139004662 16:62555565-62555587 TAGTTCTGTTCTTTCTGCTCAGG + Intergenic
1140847287 16:78902686-78902708 CAGCTCAGTATTTCCTGCTCAGG + Intronic
1141221795 16:82077215-82077237 CAGTTTTGTTCTTTCTGCTCAGG - Intronic
1144244050 17:13345732-13345754 CAGTTCACTGCTTCCAGTTCTGG - Intergenic
1144717666 17:17445677-17445699 CAGGTCTCTGCCTCCTGCTCCGG + Intergenic
1144727972 17:17511317-17511339 CAGTTCAGTGCTTCCTGCTCAGG - Intronic
1145838342 17:27971990-27972012 CAGGTAAGAGCTCCCTGCTCTGG + Intergenic
1146400053 17:32494858-32494880 CAGTACAGTGCAGCCTGCACGGG - Exonic
1150028155 17:61700515-61700537 CAATTAACTGCTTCCTGGTCTGG + Intronic
1150600690 17:66648332-66648354 CTATTCAGTGCTTCCTCCACAGG + Intronic
1151240545 17:72754334-72754356 GGGTTCAGTGCATACTGCTCGGG + Intronic
1151266695 17:72962099-72962121 CATTTCTCTGCTTCCTGCTGTGG + Intronic
1151699733 17:75736886-75736908 GGGTTCTGTGCCTCCTGCTCAGG - Intronic
1152267548 17:79305093-79305115 CAGAGCTGTGCTTCCTGCCCTGG - Intronic
1152392296 17:80010087-80010109 CAGGTGAGTGCTTCCTGCCCAGG + Intronic
1153560457 18:6367446-6367468 CACATCAGTGCTGCCTCCTCAGG + Intronic
1153927573 18:9847549-9847571 TAGTACAGTACTTCCTACTCAGG - Intronic
1154038389 18:10829994-10830016 CAGTTTTGTACTTCTTGCTCAGG - Intronic
1155282754 18:24257177-24257199 CAGTTTAGTTCTTTTTGCTCAGG - Intronic
1156021311 18:32602434-32602456 CAGTTTTGTTCTTCATGCTCAGG + Intergenic
1165177044 19:33938108-33938130 AAGTTCAGTGTATACTGCTCAGG + Intergenic
1165380343 19:35474932-35474954 CAGTTCAATGCTGACTCCTCTGG - Intergenic
1166004554 19:39898006-39898028 CAGTTTGGTCCTTCCAGCTCTGG + Intronic
1167304333 19:48698319-48698341 CAGTGCCCAGCTTCCTGCTCTGG + Intronic
1167708525 19:51096377-51096399 CAGTGCAGTGTATACTGCTCAGG + Intergenic
925079462 2:1051829-1051851 CAGCTGAGTGCTTCTGGCTCCGG - Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925479750 2:4256791-4256813 CAGTTCTGTGCTTCCTGCTCAGG + Intergenic
925618118 2:5763271-5763293 AAGTTTACCGCTTCCTGCTCGGG + Intergenic
926359700 2:12074626-12074648 CATTTCAGGGCTTCTTGGTCTGG + Intergenic
926430572 2:12781079-12781101 CTGTTCAGTGCTGTCTGTTCTGG - Intergenic
927862689 2:26570077-26570099 CTGTTCAGGGCTTACTGCTCAGG - Intronic
928314094 2:30232517-30232539 CAGTTTCTTCCTTCCTGCTCTGG + Intronic
928824277 2:35400316-35400338 GAGTTCAGTGTATACTGCTCGGG - Intergenic
929973173 2:46603408-46603430 CAGTTCTGTTCTTTTTGCTCAGG - Intronic
930849535 2:55944066-55944088 AAGTTCAGTGTATACTGCTCCGG - Intergenic
931086077 2:58831829-58831851 CAGTTCAGTGCTTCTTTCAGTGG + Intergenic
931131598 2:59342452-59342474 CTGTTCAGTGATTCCTCATCAGG - Intergenic
931736889 2:65203468-65203490 CAGTTTTGTTCTTTCTGCTCAGG - Intergenic
932025542 2:68128426-68128448 AGGTTCAGTGTTTACTGCTCGGG - Intronic
932396125 2:71449674-71449696 CAGAACTGTGCTTCATGCTCAGG + Intergenic
932517892 2:72372367-72372389 CAGTTCTGTTCTTTTTGCTCAGG - Intronic
933440921 2:82312726-82312748 GAGTTCAGTGTATACTGCTCAGG + Intergenic
934939233 2:98488418-98488440 CAGTTCTGTGTTTCCTTCTTGGG + Intronic
935519113 2:104082148-104082170 CAGTTTAGTTTTTCCTACTCTGG + Intergenic
935947438 2:108299163-108299185 CAGTTCAGTGACCTCTGCTCAGG - Intronic
936490680 2:112969513-112969535 AAGCTTAGTGCTTCCTGCTAAGG + Intergenic
937033428 2:118760818-118760840 CAGTTTAGTCCTTTTTGCTCAGG - Intergenic
937739875 2:125338557-125338579 CAGTTTTGTTCTTTCTGCTCAGG - Intergenic
937751664 2:125482727-125482749 AGGTTCAGTGCATACTGCTCAGG - Intergenic
938118313 2:128617119-128617141 CTGTTCTGTGCTTCCTGCTCAGG + Intergenic
938969730 2:136421133-136421155 CAGTTAAGTGCTGGCTGCTGAGG + Intergenic
940162910 2:150733030-150733052 CATGTCAGTGCTTCCTGATAAGG - Intergenic
942751022 2:179287470-179287492 AAGTTCAGGGGTTCATGCTCAGG - Intergenic
943071981 2:183152385-183152407 GGGTTCAGTGCCTACTGCTCAGG - Intronic
943445970 2:187988419-187988441 CATATCAATGCTTGCTGCTCCGG - Intergenic
944164255 2:196701594-196701616 CAGTTGCAGGCTTCCTGCTCTGG - Intronic
946347039 2:219119001-219119023 CAGTGCTCTGCTTCCTTCTCAGG + Intronic
947700301 2:232228638-232228660 CAATTTACTGCCTCCTGCTCAGG + Intronic
947876462 2:233471006-233471028 CTGTTCACTGCCGCCTGCTCAGG - Exonic
948522322 2:238547843-238547865 CAGTGCAGTGCTCCCACCTCAGG + Intergenic
949006276 2:241650426-241650448 CAGCTCAGTGTTTCTTGCCCCGG + Intronic
1169507226 20:6224478-6224500 CAGTGCAGTGTATACTGCTCGGG + Intergenic
1169909417 20:10635354-10635376 GAGTTCAGAGGTTCCTGGTCTGG - Intronic
1169991552 20:11509558-11509580 CAGTTTTGTTCTTCTTGCTCAGG - Intergenic
1170486828 20:16826402-16826424 CAGTTCTGTTCTTTCTGCTTAGG + Intergenic
1171191523 20:23162729-23162751 CAGTTCAGAGGGTCCTGCTTGGG + Intergenic
1172826511 20:37792271-37792293 GATTTCAGTGATTTCTGCTCTGG + Intronic
1173229448 20:41182772-41182794 AAGTACAGTGCTGCCTGCCCTGG - Exonic
1173520995 20:43700312-43700334 CAGTTCAGTGCCACCTCCTCTGG - Intronic
1174721081 20:52813047-52813069 TAGTTCAGTGCTCTGTGCTCAGG - Intergenic
1177838098 21:26208043-26208065 CAGTTAAATGCTTCTTCCTCTGG - Intergenic
1178624752 21:34205160-34205182 CAGCCCTGTGCTTCCAGCTCTGG + Intergenic
1178812307 21:35895435-35895457 TAGTTCAGTGTATACTGCTCAGG + Intronic
1179214149 21:39351479-39351501 CAGGTTAGTGCTTCCTGGTTGGG + Intergenic
1179909163 21:44438844-44438866 CAGCCCAGTGCCCCCTGCTCGGG + Intronic
1182944813 22:34312025-34312047 CAGTTGAGGGCTGCCTGCTGAGG + Intergenic
1184802692 22:46771429-46771451 CTGTTCAGTGTATACTGCTCAGG - Intronic
950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG + Intronic
950323951 3:12087409-12087431 CAGTTTTGTTCTTCTTGCTCAGG - Intronic
951241916 3:20296301-20296323 CTGGTCAGTCCTTCATGCTCTGG - Intergenic
951353499 3:21635658-21635680 CGGTTCAGTGTATACTGCTCAGG - Intronic
951928568 3:27937811-27937833 GAGTTCAGTGTTACCTTCTCTGG + Intergenic
953079563 3:39603224-39603246 CTATTCATTGCTTCCAGCTCTGG + Intergenic
954731820 3:52670068-52670090 CAGTCCAGTGCTCCTTGCTGAGG + Intronic
955023957 3:55149086-55149108 CTGTTCACTGCTTCCTTCTATGG - Intergenic
955954288 3:64272605-64272627 CAGTTCAGTGCTTCTTCCAAAGG - Intronic
956123785 3:65992443-65992465 CAGTTCACTGTTTTTTGCTCAGG - Intronic
959583998 3:108008995-108009017 CATTTGAGAGCATCCTGCTCAGG - Intergenic
959817279 3:110689432-110689454 CAATTTACTGCTTCCTGCTCTGG + Intergenic
962758631 3:138487805-138487827 CAGTTTTGTTCTTTCTGCTCAGG + Intergenic
962870285 3:139483352-139483374 CAGTTTTGTTCTTTCTGCTCAGG + Intergenic
963319258 3:143795357-143795379 CAGTTCCTTGCTTCCCTCTCAGG - Intronic
964443813 3:156739748-156739770 CAGTTCACTTTCTCCTGCTCAGG + Intergenic
965232940 3:166076688-166076710 CAGTGCAGTGTGTACTGCTCGGG - Intergenic
965799224 3:172474575-172474597 GAGTTCAGTGTATACTGCTCAGG - Intergenic
966020793 3:175206598-175206620 CAGTTCAGTGTATACTGCTCGGG + Intronic
967363461 3:188658688-188658710 CTGTTTAGAGCTTCCTACTCTGG + Intronic
967703543 3:192622355-192622377 TAGTTTAGTGGTTTCTGCTCAGG - Intronic
967873846 3:194252971-194252993 CATTTCTGTGTTTCCTCCTCAGG - Intergenic
968834223 4:2951245-2951267 CATCTCATTCCTTCCTGCTCAGG - Exonic
968966160 4:3770007-3770029 CAGTTCAGGACTCCCTGCCCAGG - Intergenic
969343860 4:6559105-6559127 CTGTTCTGTGATTCCTTCTCAGG - Intronic
970279890 4:14443489-14443511 CAGATTAGGGCTTCTTGCTCTGG + Intergenic
973797998 4:54448653-54448675 CAGTTGATGGCTCCCTGCTCGGG - Intergenic
974217892 4:58923201-58923223 CAGTGCAGTGTATACTGCTCAGG + Intergenic
975088570 4:70373209-70373231 GAGTTCAGTGTATACTGCTCGGG - Intronic
975835167 4:78415256-78415278 GAGTTCAGTGCATACTGCTTTGG + Intronic
978426074 4:108583942-108583964 GGGTTCAGTGTTTACTGCTCAGG + Intergenic
979280493 4:118861784-118861806 CAGTTTTGTTCTTTCTGCTCAGG + Intronic
979391341 4:120131380-120131402 CAGTTCCCTGCTTCCTGTTGTGG + Intergenic
981203345 4:142009927-142009949 CAGTTTTGTTCTTTCTGCTCAGG + Intergenic
981896829 4:149811675-149811697 CACTTCAGTGCTCTCAGCTCAGG + Intergenic
982871821 4:160589021-160589043 CAGTTTAGAGATTACTGCTCTGG - Intergenic
983422710 4:167540182-167540204 CAGTGCAGTGTATACTGCTCAGG + Intergenic
983721757 4:170862825-170862847 GAGTTCAGTGTATACTGCTCAGG - Intergenic
984384001 4:179031921-179031943 ATGTTCAGTGCTTCCTGCAGGGG - Intergenic
985180579 4:187257094-187257116 CAGTCCAGTGCTTCCTCCTGGGG + Intergenic
985209179 4:187573453-187573475 GTGTACAGTGTTTCCTGCTCAGG - Intergenic
985771313 5:1813438-1813460 CTGTTCAGTGCTTTCTCCTTTGG + Intronic
986857110 5:11882749-11882771 CAGCTCTGTTCTTCTTGCTCAGG + Intronic
988639947 5:33030806-33030828 CAGTTCAGTACTTCATGAACAGG + Intergenic
990122200 5:52469061-52469083 CAGTAAAGTGCTTCTTGCCCTGG - Intergenic
990965550 5:61443141-61443163 CAGTCCAGTGCTTGCTTCTTTGG - Intronic
991018383 5:61955679-61955701 CAGTTCTGTTCTTTTTGCTCAGG + Intergenic
991572200 5:68066819-68066841 CAGTTCAGGTTTTCCTACTCAGG + Intergenic
991745570 5:69737226-69737248 GAGTTCAGTGTATACTGCTCGGG + Intergenic
991752136 5:69818007-69818029 GAGTTCAGTGTATACTGCTCGGG - Intergenic
991797137 5:70316979-70317001 GAGTTCAGTGTATACTGCTCGGG + Intergenic
991824948 5:70612540-70612562 GAGTTCAGTGTATACTGCTCGGG + Intergenic
991831456 5:70693112-70693134 GAGTTCAGTGTATACTGCTCGGG - Intergenic
991889516 5:71316512-71316534 GAGTTCAGTGTATACTGCTCGGG + Intergenic
992222932 5:74590593-74590615 CAGTATAGTCCTTGCTGCTCTGG + Intergenic
994248349 5:97507163-97507185 CAGTTCTGTTCTTTTTGCTCAGG + Intergenic
994683663 5:102922313-102922335 CAGTTCAAGCCTTCCTCCTCAGG - Intronic
994754743 5:103779875-103779897 CAGCTCAGTACTTTCTTCTCTGG - Intergenic
996258713 5:121438966-121438988 CAGTTTTGTGCTTTTTGCTCAGG + Intergenic
997445340 5:133935929-133935951 CAGTTCTGTGGCTCCTCCTCTGG + Intergenic
997445369 5:133936089-133936111 CAGTTCTGTGGCTCCTCCTCTGG + Intergenic
997445399 5:133936269-133936291 CAGTTCTGTGCCTCCTCCTCTGG + Intergenic
997445444 5:133936469-133936491 CAGTTCTGTGACTCCTCCTCTGG + Intergenic
999038853 5:148384460-148384482 GTGTTCACTGCTTCCTGCTCAGG - Intronic
999480217 5:151941256-151941278 AAATTCATAGCTTCCTGCTCTGG - Intergenic
1000583852 5:163070028-163070050 CAGTTCTGTTCTTCTTGCTTAGG + Intergenic
1000879996 5:166686260-166686282 CAGTGCAGTGTATACTGCTCAGG - Intergenic
1001787081 5:174423039-174423061 CAGTGCAATGCTTTCTGCTTTGG - Intergenic
1003163046 6:3652216-3652238 CAGCTCTGTGCCTCCTGCCCTGG + Intergenic
1004519221 6:16346553-16346575 CAACTATGTGCTTCCTGCTCAGG - Intronic
1005556236 6:26987691-26987713 GAGTTCAGTGTATACTGCTCGGG + Intergenic
1005770922 6:29070225-29070247 GAGTTCAGTGTATACTGCTCAGG + Intronic
1005854854 6:29853004-29853026 CAGTTAGGAGCTGCCTGCTCAGG - Intergenic
1005891732 6:30146008-30146030 CCTTTCTGAGCTTCCTGCTCCGG - Exonic
1006005238 6:30996694-30996716 CTGTTCAAAGCTTCCTGCTGTGG - Intergenic
1006060396 6:31414525-31414547 CAGTTAGGAGCTGCCTGCTCAGG + Intronic
1006072839 6:31509297-31509319 CAGTTAGGAGCTGCCTGCTCAGG + Intronic
1006985648 6:38173827-38173849 CATTCCAGTGCTGCCTGCCCTGG - Exonic
1007815209 6:44518074-44518096 CAGTTTTGTTCTTTCTGCTCAGG + Intergenic
1009926376 6:70125857-70125879 CACTTCATTGTTTCCAGCTCTGG + Intronic
1011627099 6:89291529-89291551 CACTTCGCTGCTTCCTGCTCCGG + Intronic
1012141338 6:95630398-95630420 CAGCTAAATGCTTCCTGCTGGGG + Intergenic
1012806778 6:103904381-103904403 CAGTTTTGTTCTTCTTGCTCAGG + Intergenic
1012843807 6:104364095-104364117 CTGTCCACTGCTTCCTGCTAGGG - Intergenic
1013052412 6:106549173-106549195 CATAGCAGTGCTCCCTGCTCTGG + Intronic
1015857958 6:137645926-137645948 CAGTAGACTGCATCCTGCTCTGG - Intergenic
1015911140 6:138168771-138168793 GAGGTCAGGGCTTCCTGCTGGGG - Intronic
1016905921 6:149150851-149150873 CAGCTCTGTCCTTGCTGCTCAGG - Intergenic
1017047931 6:150364706-150364728 CAGTGAAGTGCTTCCTTCCCAGG - Intergenic
1017055418 6:150431640-150431662 GAGCTCAGGGCTTCCTGCCCTGG + Intergenic
1018292565 6:162307541-162307563 CAGTTCAGGTCTTCCTTCTGTGG - Intronic
1018530231 6:164755228-164755250 GTGTTCAATGCTTCCTGCCCTGG + Intergenic
1019015813 6:168878789-168878811 CAGGTCAGAGCTTCCTCCCCAGG + Intergenic
1019281732 7:203763-203785 CAGTTCAGTCCTTCTTCGTCTGG - Intronic
1021215673 7:17912880-17912902 AATTTCAGTGCTTGCTGCTTGGG - Intronic
1022366577 7:29725882-29725904 CAGTTTTGTTCTTCTTGCTCAGG + Intergenic
1022740651 7:33117460-33117482 CAGTTTTGTTCTTCTTGCTCTGG + Intergenic
1023060967 7:36326439-36326461 TAGGCCAGTGCTTACTGCTCAGG + Exonic
1023209211 7:37784960-37784982 CATTTCAGTGCTTTCCACTCAGG - Intronic
1023770856 7:43555434-43555456 CTCTTCAGTGCTTCCTGATCAGG - Intronic
1023888627 7:44377419-44377441 CAGTTGAGTGCATGCTTCTCAGG + Intergenic
1024978203 7:55133244-55133266 CAGCTCAGTGCTGCCTGCCAGGG - Intronic
1027150993 7:75733561-75733583 CAGGTCAGTGGTGCCTCCTCTGG + Intronic
1028434482 7:90786027-90786049 CAGTGCAGTTCTTCCTGGTACGG + Intronic
1029825703 7:103191663-103191685 CAGTTATGTTCTTCTTGCTCAGG - Intergenic
1031148289 7:118022145-118022167 GAGTTCAGTGTGTGCTGCTCAGG + Intergenic
1031611422 7:123832384-123832406 GGGTTCAGTGATTACTGCTCGGG - Intronic
1033770965 7:144551097-144551119 CATTTCACAGGTTCCTGCTCTGG + Intronic
1034161073 7:148994712-148994734 CACTTGGCTGCTTCCTGCTCAGG + Intergenic
1034689871 7:153005813-153005835 CCGTTCACTCCTTCCTGCTGTGG + Intergenic
1034945608 7:155259910-155259932 CAGCTCAGTACTTCCTGCACTGG - Intergenic
1035048986 7:155987609-155987631 CAGTTCAAAGCTTCCTGTGCTGG + Intergenic
1035582526 8:748493-748515 CAGGTAAGGGCTTCCTCCTCGGG - Intergenic
1038694758 8:29796779-29796801 CAGCTCAGCGCTACTTGCTCAGG - Intergenic
1039990198 8:42481355-42481377 CATTTCAGTGCCTCCTACCCTGG - Intronic
1040905644 8:52467365-52467387 GTGGTCAGTGCTTCCTGTTCAGG - Intergenic
1043192381 8:77241882-77241904 CAGTGCTATGCTTCCTGTTCAGG + Intergenic
1043924295 8:86019632-86019654 CAGTCCAGGGCTTTCTTCTCTGG + Intronic
1047656839 8:126986478-126986500 CAGTTCTGTTCTTTTTGCTCAGG + Intergenic
1049252191 8:141595260-141595282 CAAAGCAGTGCTTACTGCTCAGG - Intergenic
1049437242 8:142592351-142592373 CAGTCCAGTCCTGCCTGCCCAGG - Intergenic
1049795440 8:144495227-144495249 CAGTCAGGTCCTTCCTGCTCAGG - Intronic
1051451060 9:17198175-17198197 CAGTTTAGTTCTTTTTGCTCAGG + Intronic
1052348064 9:27429947-27429969 CAGATCAGTGCCTGCAGCTCAGG + Intronic
1052545651 9:29874402-29874424 CAGTTTAGGGCTTCCCCCTCTGG + Intergenic
1055033499 9:71793926-71793948 CAGTTCAGTGCATTCTTCCCAGG - Intronic
1055990719 9:82102515-82102537 CAATTCAGTGCCTCCAGCACAGG - Intergenic
1056139691 9:83663932-83663954 AGGTTCAGTGGTTCCTGCTGTGG + Exonic
1056491713 9:87114868-87114890 CAGTTCACTGCTTGATGCTAGGG - Intergenic
1056794441 9:89647953-89647975 CAGGACAGTCCATCCTGCTCTGG - Intergenic
1057982785 9:99679225-99679247 CACTTCATTGGTTCCTACTCTGG + Intergenic
1058797210 9:108510495-108510517 CAGCTGAGTGCTTCCTGCTTTGG + Intergenic
1059591937 9:115671297-115671319 CAGATCATTGCCTCCTTCTCAGG - Intergenic
1062441718 9:136572656-136572678 CAGCTCAGTGCAGCCTCCTCTGG + Intergenic
1187291526 X:17958884-17958906 CAGTTTAAAGCTTCCTCCTCTGG + Intergenic
1187645011 X:21337966-21337988 CAGTTCAGTTCTTTTTGCTCTGG - Intergenic
1188107111 X:26159228-26159250 CAGCTCAGTACTTCCTACTCAGG + Intergenic
1188710512 X:33391588-33391610 CAGTTCTCTCCTTCCTACTCTGG - Intergenic
1188853838 X:35167022-35167044 CAGTTTTGTTCTTTCTGCTCAGG + Intergenic
1189592410 X:42529159-42529181 CAGCTCAGTGCTTTCTGCCCTGG + Intergenic
1191613552 X:63142777-63142799 CAGTGCAGTGCTACCTGCGGTGG + Intergenic
1191622745 X:63236150-63236172 CAGTGCAGTGCTACCTGCGGTGG - Intergenic
1194511243 X:94797831-94797853 CAGTTATGTTCTTCTTGCTCAGG + Intergenic
1195314735 X:103666378-103666400 CTGTTCCGTGCTTTCTGCTCTGG - Intergenic
1196264349 X:113624577-113624599 CAGTTTAGTTCTTCTTGCTTAGG + Intergenic
1197165454 X:123372315-123372337 CAGTTCTGTTCTTCTTTCTCAGG + Intronic
1198920062 X:141715397-141715419 TAATACAGTGCATCCTGCTCTGG + Intergenic
1199243053 X:145570668-145570690 CAGTTCAGTGGTTTCTGCAGTGG - Intergenic
1199882612 X:151986529-151986551 CTGCTCACTGCTTCCTGCTGAGG - Intergenic
1201737016 Y:17278265-17278287 TAGTTCAGTGTATACTGCTCAGG + Intergenic