ID: 1144729483

View in Genome Browser
Species Human (GRCh38)
Location 17:17518303-17518325
Sequence CTTTCTCGAGACCAGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144729476_1144729483 -4 Left 1144729476 17:17518284-17518306 CCTCGCCCACCCCCGTGGGCTTT 0: 1
1: 0
2: 2
3: 21
4: 258
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729478_1144729483 -10 Left 1144729478 17:17518290-17518312 CCACCCCCGTGGGCTTTCTCGAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729472_1144729483 5 Left 1144729472 17:17518275-17518297 CCATCCACGCCTCGCCCACCCCC 0: 1
1: 1
2: 1
3: 110
4: 1145
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729469_1144729483 15 Left 1144729469 17:17518265-17518287 CCCTGCCTGGCCATCCACGCCTC 0: 1
1: 0
2: 3
3: 45
4: 617
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729477_1144729483 -9 Left 1144729477 17:17518289-17518311 CCCACCCCCGTGGGCTTTCTCGA 0: 1
1: 0
2: 0
3: 8
4: 62
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729471_1144729483 10 Left 1144729471 17:17518270-17518292 CCTGGCCATCCACGCCTCGCCCA 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729467_1144729483 25 Left 1144729467 17:17518255-17518277 CCCGTTCGAGCCCTGCCTGGCCA 0: 1
1: 0
2: 35
3: 173
4: 479
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729468_1144729483 24 Left 1144729468 17:17518256-17518278 CCGTTCGAGCCCTGCCTGGCCAT 0: 1
1: 0
2: 2
3: 24
4: 162
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729470_1144729483 14 Left 1144729470 17:17518266-17518288 CCTGCCTGGCCATCCACGCCTCG 0: 1
1: 0
2: 0
3: 13
4: 213
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147
1144729473_1144729483 1 Left 1144729473 17:17518279-17518301 CCACGCCTCGCCCACCCCCGTGG 0: 1
1: 0
2: 1
3: 39
4: 357
Right 1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144729483 Original CRISPR CTTTCTCGAGACCAGCCTTG TGG Intronic
900690178 1:3976059-3976081 CTATCACGAGAACAGCATTGGGG - Intergenic
901247430 1:7743788-7743810 CTTAATCCAGACCAGCTTTGAGG + Intronic
906106776 1:43299501-43299523 CTTTCTCTAGACAAGGCTTTGGG - Intergenic
909085822 1:71169254-71169276 CTGTCACGAGAACAGCCTGGGGG + Intergenic
909231685 1:73099796-73099818 CTTTTTCCAGGCCAGCCCTGTGG - Intergenic
909664981 1:78122604-78122626 CTATCACGAGAACAGCCTGGGGG + Intronic
911748055 1:101462991-101463013 CATTCTGGACATCAGCCTTGGGG + Intergenic
912528434 1:110302724-110302746 ATTCCTCGAGAGCAGGCTTGGGG - Intergenic
915847578 1:159283912-159283934 AATTCTTGAGACCAGCCTTCAGG - Intergenic
916387918 1:164297883-164297905 TTTACTGGAGACCAGCATTGTGG - Intergenic
920256882 1:204661582-204661604 CTGTCTCAAGATCACCCTTGGGG - Intronic
922069728 1:222179770-222179792 CTTTCTGGATATCAACCTTGGGG + Intergenic
923407280 1:233674588-233674610 CTTTCTCCAAACCAGCTTTATGG + Intergenic
1064934254 10:20662431-20662453 CTTCTTAGAGACCAGCATTGGGG + Intergenic
1066531209 10:36341666-36341688 CTTTCTCCATACCAGCAATGAGG - Intergenic
1067287544 10:44917779-44917801 CTTTCTGGAAACCTGCCATGTGG + Intronic
1069054164 10:63827241-63827263 CTATCACGAGAACAGCCTGGGGG + Intergenic
1070335800 10:75454296-75454318 CTTTCTACAGACCCACCTTGGGG + Intronic
1070583102 10:77738798-77738820 CCTTCTGGAGGCCAGACTTGAGG + Intergenic
1072171640 10:92868843-92868865 CTTGCTAGAGACCAGGCTGGAGG + Intronic
1073255407 10:102147617-102147639 CTTCTTTGAGACCTGCCTTGGGG + Intronic
1076856848 10:133120714-133120736 CTTTCTCCACATCAGCCATGAGG + Intronic
1079088763 11:17465857-17465879 CTTTATGGAGACCAGCTTGGAGG - Intronic
1079492250 11:21001795-21001817 ATTTCTCCAGAGCATCCTTGAGG - Intronic
1080401210 11:31937699-31937721 CTATCACGAGACCAGCATGGAGG + Intronic
1080887061 11:36376923-36376945 CTTACTCGAGACCACCATGGTGG + Intronic
1082085117 11:48043824-48043846 CTTTCTCGAAACCATCCTACAGG + Intronic
1084457595 11:69277538-69277560 CCTTCTGGAGACCAGCCATGTGG - Intergenic
1085521226 11:77139981-77140003 CTTGCTCTAGGCCAGACTTGAGG - Intronic
1086131274 11:83404998-83405020 CTATCTCAAGAACAGCCTGGGGG - Intergenic
1091888687 12:4035208-4035230 CTTTCCTGAGTCCAGCCATGTGG + Intergenic
1093299746 12:17439524-17439546 ATTCCTGGAGAGCAGCCTTGGGG - Intergenic
1097959444 12:65518296-65518318 CTTTCTGGAGACAACCCATGTGG + Intergenic
1100314165 12:93428451-93428473 CTTTCCCTAAACCAACCTTGAGG + Intronic
1101632969 12:106513396-106513418 CTATCACGAGAACAGCATTGGGG - Intronic
1102260859 12:111442563-111442585 CTTGGCCCAGACCAGCCTTGGGG - Intronic
1109160923 13:58973051-58973073 CATTTTCAAGACCAGCATTGAGG + Intergenic
1109473468 13:62843965-62843987 CTATCACGAGAACAGCCTGGGGG + Intergenic
1111040378 13:82740283-82740305 CTTTCTTTGGACCAGCCCTGTGG + Intergenic
1112246927 13:97743773-97743795 CTATCTCGAGAACAGCATGGGGG + Intergenic
1112896938 13:104310978-104311000 CTGTATCCAGATCAGCCTTGAGG + Intergenic
1113235688 13:108270186-108270208 CTTCCTCCAGGCCGGCCTTGGGG - Exonic
1116734503 14:48671455-48671477 CTCTCTCTGGACCAGCCCTGTGG - Intergenic
1118505716 14:66409131-66409153 CTTTCATGAGACCAGCATGGAGG - Intergenic
1118528782 14:66677670-66677692 ATTTCTTGAGGCCAGTCTTGTGG + Intronic
1120473102 14:84951536-84951558 CTATCTTGAGACCAGCATAGAGG - Intergenic
1121243673 14:92447663-92447685 TTGTCTGGAGAGCAGCCTTGTGG - Intronic
1121437180 14:93927620-93927642 CTTAATCGAGACCTGCCTTGCGG - Intronic
1125575409 15:40752059-40752081 CTTTGTGCTGACCAGCCTTGTGG - Exonic
1125605771 15:40938888-40938910 ATTTCTGAAGACCAGCTTTGAGG - Exonic
1127509859 15:59629692-59629714 CCTTCTGGAGGCCAGCCATGGGG - Intronic
1129862266 15:78872297-78872319 TCTTCTCCAGCCCAGCCTTGCGG - Intronic
1130657019 15:85798861-85798883 GTGTCTCTAGACCAGCCTGGGGG - Intergenic
1133243939 16:4434143-4434165 CTATCGCGAGACCAGCATGGAGG + Intronic
1134423873 16:14119914-14119936 CATTCTCCAGAGCAGCTTTGAGG + Intronic
1137634624 16:49975054-49975076 CTTCCTCCACATCAGCCTTGAGG - Intergenic
1138483247 16:57318199-57318221 CTTTCTCCATACCACCCTTCAGG - Intergenic
1141882866 16:86871334-86871356 CTATCACGAGAACAGCCTGGGGG - Intergenic
1142995737 17:3759232-3759254 CTTTTTGGAGGACAGCCTTGAGG + Intronic
1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG + Intronic
1146890348 17:36502562-36502584 CTTTCTGGAGACCACTCTGGGGG - Intronic
1148793218 17:50185116-50185138 CTTTCTCCACACCCCCCTTGGGG - Exonic
1152243871 17:79175322-79175344 CCTTCTGGTGACCAGCCTGGTGG - Intronic
1154033548 18:10775748-10775770 GTTTCTAGAAATCAGCCTTGTGG - Intronic
1155922220 18:31614707-31614729 CTTTCTCAAGTGCAGTCTTGTGG + Intergenic
1161915526 19:7225343-7225365 CTTTCTCCAGATCAGCTTAGGGG + Intronic
1162965360 19:14152972-14152994 CTGTCTTGTGACCAGCCCTGTGG - Intronic
1165393273 19:35550370-35550392 CTTTCCCGAGGCCAGCCCAGAGG + Exonic
1167677859 19:50899361-50899383 CTTCCTGGAGATCAGACTTGTGG - Intergenic
925699066 2:6614420-6614442 TTTCCTCGACAGCAGCCTTGTGG - Intergenic
927887798 2:26729131-26729153 CTTTCTGGGGACCAGCTTTAGGG - Exonic
930993285 2:57685714-57685736 CTCTTTCCAGACCAGTCTTGTGG - Intergenic
934609442 2:95723619-95723641 CTTTCTCCAGCCCAGGCTTCAGG - Intergenic
937548360 2:123053515-123053537 CTATCACGAGAACAGCCTGGGGG - Intergenic
939200579 2:139029707-139029729 ATTTCTTGAGACAAGCTTTGTGG + Intergenic
941360259 2:164542321-164542343 CATTCTGGACAACAGCCTTGAGG + Intronic
941683831 2:168427702-168427724 CTTTCTCCAGACCAACAATGTGG - Intergenic
942803704 2:179904551-179904573 CATTCTGGACATCAGCCTTGGGG - Intergenic
943010574 2:182443473-182443495 CTATCTCGAGACCAGCAAGGGGG - Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945818113 2:214630508-214630530 CTATCTCTAGACCAGCATGGGGG + Intergenic
946085684 2:217168902-217168924 CTTTCCCCAGAACAGCCTTCGGG - Intergenic
948789661 2:240370660-240370682 CTCTCCCGAGCCCAGCGTTGGGG - Intergenic
1169266126 20:4168213-4168235 CTTGCCCCCGACCAGCCTTGGGG - Intronic
1169299079 20:4426570-4426592 CCTTCTTGAGCTCAGCCTTGAGG + Intergenic
1172841842 20:37906695-37906717 CCTCCTCCAGAACAGCCTTGAGG + Intronic
1175619874 20:60434456-60434478 CTGTCACGAGAACAGCATTGGGG - Intergenic
1175668771 20:60882970-60882992 ATTTCTCATGACCAGGCTTGAGG + Intergenic
1176239234 20:64068260-64068282 CATGCTGGACACCAGCCTTGTGG + Intronic
1178406331 21:32326256-32326278 CTATCTCGAGAACATCATTGTGG - Intronic
1178960352 21:37059356-37059378 CTTTCAGGAGAACAGCTTTGGGG + Intronic
1179310585 21:40192366-40192388 CTATCACGAGACCAGCATGGAGG - Intronic
1184881456 22:47306975-47306997 CTCTCACGAGAACAGCCATGGGG - Intergenic
950966033 3:17146323-17146345 CTGTCACGAGAACAGCCTGGAGG - Intergenic
952471332 3:33655790-33655812 CTTTCTAGAGACCAGCCTTCTGG - Intronic
953224763 3:41008567-41008589 CTTTCTGGAGGACAGACTTGAGG + Intergenic
953262196 3:41350834-41350856 CCTTCTGGAGACCAACCTTCAGG + Intronic
953612930 3:44462636-44462658 CTTTCTCTAAACCACCCTGGGGG + Intronic
953808348 3:46090984-46091006 CTTGCTCCAGCCCACCCTTGGGG + Intergenic
953883409 3:46702799-46702821 CTGACTCTAGCCCAGCCTTGTGG - Intronic
958637343 3:96762421-96762443 CTATCACGAGACCAGCCTAGAGG - Intergenic
960583740 3:119301959-119301981 GTTCCTTCAGACCAGCCTTGAGG + Intronic
962461368 3:135616452-135616474 CTTTCTCCAGACCAGGAATGAGG + Intergenic
966106527 3:176342159-176342181 CTTTCACGAGAACAGCATGGGGG + Intergenic
967457918 3:189711216-189711238 CTTTTCAGAAACCAGCCTTGTGG + Intronic
968980335 4:3845245-3845267 CTATCACGAGAACAGCCTGGGGG + Intergenic
970038578 4:11770026-11770048 ATTTCTCGACACCAGCATTGAGG - Intergenic
970960404 4:21864676-21864698 TTTTCTCGATACCAGACATGTGG - Intronic
971460112 4:26886628-26886650 CTTACTCTACACCAGCCCTGTGG - Intronic
974786640 4:66626203-66626225 CTATCACGAGAACAGCATTGGGG - Intergenic
976088289 4:81429141-81429163 CTCTCTCGTTACCAGCCATGTGG - Intronic
976560199 4:86492211-86492233 CCTTCTCGAGACCTACCTTCTGG - Intronic
977527117 4:98158892-98158914 CTTTCTCTAAACTACCCTTGGGG + Intergenic
980321810 4:131289570-131289592 CTTTCTCTAAACTACCCTTGGGG - Intergenic
983348451 4:166557323-166557345 CTTTGTCCAGACCAGCATTCTGG + Intergenic
983504370 4:168536676-168536698 CTATCACGAGACCAGCATGGGGG + Intronic
984897662 4:184556273-184556295 CATTCTGGACATCAGCCTTGCGG + Intergenic
987727251 5:21718100-21718122 CTTTCACAAGAACAGCATTGGGG + Intergenic
988083784 5:26446777-26446799 ATATCACGAGAACAGCCTTGGGG + Intergenic
988157552 5:27474720-27474742 CTTTCTTGATACCAGACTTTTGG + Intergenic
990026896 5:51203149-51203171 CTGTCACGAGAACAGCATTGGGG - Intergenic
991060465 5:62369436-62369458 CTATCACGAGAACAGCCTGGAGG + Intronic
992214617 5:74514060-74514082 CTTGCTTCAAACCAGCCTTGTGG + Intergenic
993613512 5:90083377-90083399 CTTTCTTGAAAAAAGCCTTGAGG - Intergenic
994134432 5:96268912-96268934 CTCTCACGAGAACAGCATTGGGG - Intergenic
998630131 5:143888855-143888877 GTTTCTCTGGGCCAGCCTTGAGG + Intergenic
1000010649 5:157228537-157228559 CTTTCTGGAGAAAAGGCTTGGGG + Intronic
1001430234 5:171655092-171655114 CTTTCTCCACACCAGCCTTGTGG - Intergenic
1002660333 5:180787239-180787261 TTTCCTGGAGACCAGCCTGGTGG - Intergenic
1003577338 6:7309614-7309636 CTTTCACGAGAACAGCATGGAGG - Intronic
1003876399 6:10441446-10441468 CTTTCTCCTGACACGCCTTGTGG - Intergenic
1006902983 6:37515003-37515025 CTTTCTCCCGGCCAGCCTGGAGG + Intergenic
1012038225 6:94170226-94170248 CTATCACGAGAACAGCCTGGGGG + Intergenic
1017120571 6:151020171-151020193 CTTTCTCCACCCCAGTCTTGTGG + Intronic
1020522836 7:9215896-9215918 CTCTCAAGAGACCAGCCTTAGGG + Intergenic
1026536551 7:71243103-71243125 CTATCACAAGAACAGCCTTGAGG - Intronic
1030746645 7:113173651-113173673 CTATCACGAGAACAGCATTGGGG - Intergenic
1038676641 8:29628750-29628772 CTTTCTAGAAACCAGTCCTGGGG - Intergenic
1039206307 8:35159424-35159446 CTATCACGAGAACAGCATTGAGG + Intergenic
1041887453 8:62827098-62827120 CTTTATTGATACCAGCCTTTTGG - Intronic
1043678208 8:82988240-82988262 CTTTCATGAGACTAGCCTGGGGG - Intergenic
1043678282 8:82989031-82989053 CTTTCACGAGACTAGCATGGGGG - Intergenic
1047853649 8:128886092-128886114 CATTCTGGACATCAGCCTTGGGG + Intergenic
1052688745 9:31787810-31787832 CTTTCTCCATACCAGCATTAAGG - Intergenic
1055697907 9:78907997-78908019 CTTGCTCTAAATCAGCCTTGGGG + Intergenic
1057949471 9:99358537-99358559 CTTTTTCGAGGCCAGGCTTGTGG - Intergenic
1058116806 9:101093734-101093756 TTTTCACTAGATCAGCCTTGGGG + Intronic
1058441320 9:105010664-105010686 CATTCTGGACACCAGCCTTGGGG - Intergenic
1060894285 9:127207790-127207812 CTTTCTCCAGGCCAGCCTTTAGG - Intronic
1061759818 9:132842878-132842900 GTTCCTAGAGACCAGCCATGTGG + Intronic
1186714148 X:12232446-12232468 CTATCTCGAGAACAGCATGGGGG + Intronic
1190526556 X:51333863-51333885 CATTTTTGATACCAGCCTTGTGG + Intronic
1190542697 X:51495502-51495524 CATTTTTGATACCAGCCTTGTGG - Intronic
1194447421 X:94005881-94005903 CTTTCTCTAAACTACCCTTGGGG - Intergenic
1196575669 X:117315697-117315719 CATTCTAGACATCAGCCTTGGGG - Intergenic
1197535035 X:127676971-127676993 CTATCATGAGACCAGCATTGGGG + Intergenic
1200308205 X:155050307-155050329 GTTTCTTGAGTCCTGCCTTGAGG + Intronic