ID: 1144730420

View in Genome Browser
Species Human (GRCh38)
Location 17:17522809-17522831
Sequence CCGCGTGCTCCTGCAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144730420_1144730427 10 Left 1144730420 17:17522809-17522831 CCCATGGCTGCAGGAGCACGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1144730427 17:17522842-17522864 ACAGGCCCAAATTTCCGCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 104
1144730420_1144730426 9 Left 1144730420 17:17522809-17522831 CCCATGGCTGCAGGAGCACGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1144730426 17:17522841-17522863 CACAGGCCCAAATTTCCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 96
1144730420_1144730428 11 Left 1144730420 17:17522809-17522831 CCCATGGCTGCAGGAGCACGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1144730428 17:17522843-17522865 CAGGCCCAAATTTCCGCTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 127
1144730420_1144730425 8 Left 1144730420 17:17522809-17522831 CCCATGGCTGCAGGAGCACGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1144730425 17:17522840-17522862 GCACAGGCCCAAATTTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144730420_1144730423 -8 Left 1144730420 17:17522809-17522831 CCCATGGCTGCAGGAGCACGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1144730423 17:17522824-17522846 GCACGCGGCCTTCAGAGCACAGG 0: 1
1: 0
2: 1
3: 12
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144730420 Original CRISPR CCGCGTGCTCCTGCAGCCAT GGG (reversed) Intronic
902455360 1:16529995-16530017 CTCCATGCTCATGCAGCCATAGG - Intergenic
902468375 1:16631586-16631608 CCGCCTGCTCCTGTAGCCGCAGG + Intergenic
902474051 1:16671313-16671335 CTCCATGCTCATGCAGCCATAGG - Intergenic
902484752 1:16736129-16736151 CTCCATGCTCATGCAGCCATAGG + Intergenic
902496811 1:16877892-16877914 CTCCATGCTCATGCAGCCATAGG + Intronic
902505766 1:16938405-16938427 CCGCCTGCTCCTGTAGCCGCAGG - Exonic
903154753 1:21436072-21436094 CCGCCTGCTCCTGTAGCCACAGG - Intergenic
907447358 1:54517141-54517163 CCGCCTGCTCCTGCAGCCTGTGG + Intergenic
922886192 1:229022808-229022830 CCGGGTACTCCTCCTGCCATGGG - Intergenic
923815033 1:237368028-237368050 CCCCATCCTCCTGCAGCCCTAGG - Intronic
1062973619 10:1666576-1666598 CAGCGTCCTCCTGCAGCCGAGGG + Intronic
1064258749 10:13767799-13767821 CCCCGTGCTCTTGCGGCCATTGG + Intronic
1066745574 10:38602544-38602566 CCTCTTGCTCCTGCTGCCCTTGG + Intergenic
1074782031 10:116809031-116809053 CCGGATGCTGCTGGAGCCATAGG - Intergenic
1075062487 10:119266630-119266652 CCGCTTCCTCCTCCAGCCACAGG - Intronic
1075444343 10:122503409-122503431 CCCGATGCTCCTGCAGCCAGTGG + Intronic
1078540499 11:12209572-12209594 CAGGGTGTTCCTGCGGCCATCGG - Exonic
1083736251 11:64683020-64683042 CCCTTTGCTTCTGCAGCCATGGG - Intronic
1085384866 11:76151810-76151832 CGCCCTGCTCCTGCAGCCCTGGG + Intergenic
1088875495 11:113932827-113932849 CCTCGTTCTCCTGCCCCCATAGG - Intronic
1090320896 11:125842730-125842752 CCCTTTGCTCCTGCAGCCCTAGG + Intergenic
1096462263 12:51828619-51828641 CCCCGTGGTCCTGCTGCCCTCGG + Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1102570781 12:113825775-113825797 CCCCATGCTCCTGCACCCCTGGG + Intronic
1113129908 13:107024122-107024144 CCTGGTGTTCCTCCAGCCATCGG + Intergenic
1122906039 14:104801942-104801964 CCTCCTGTTCCTGCAGCCAAGGG + Exonic
1127165754 15:56243741-56243763 CCCCGTGCTGCTGCAGCCCCAGG + Intergenic
1127868215 15:63048617-63048639 CCGCCTGCTCCTGCAGGCTCCGG - Intronic
1129322376 15:74782312-74782334 CCGCGGGCTCCGGCGGCCAGAGG - Exonic
1129787894 15:78321362-78321384 CCGCGTGGTGCTGCAGCTGTTGG - Intergenic
1136737491 16:32477105-32477127 CCTCTTGCTCCTGCTGCCTTCGG - Intergenic
1138555969 16:57771428-57771450 GGGCGCTCTCCTGCAGCCATTGG + Exonic
1141178566 16:81737009-81737031 CCGCCTCCTCCTGCAGCCCCTGG + Intergenic
1142004985 16:87685399-87685421 CCACGTGCCCCTGTGGCCATTGG + Intronic
1203015580 16_KI270728v1_random:352472-352494 CCTCTTGCTCCTGCTGCCTTCGG + Intergenic
1203033915 16_KI270728v1_random:625630-625652 CCTCTTGCTCCTGCTGCCTTCGG + Intergenic
1144730420 17:17522809-17522831 CCGCGTGCTCCTGCAGCCATGGG - Intronic
1146843452 17:36169551-36169573 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146864860 17:36330886-36330908 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1146871667 17:36381400-36381422 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146879026 17:36432482-36432504 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146882967 17:36453628-36453650 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1147067719 17:37931480-37931502 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147074553 17:37982024-37982046 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147079250 17:38011035-38011057 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147086076 17:38061563-38061585 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147095189 17:38134977-38134999 GCCCGGGCTCCTGCTGCCATCGG + Intergenic
1147102021 17:38185528-38185550 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1148780302 17:50117669-50117691 CAGGGGGCTCCCGCAGCCATCGG + Exonic
1149846612 17:60012038-60012060 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1150084959 17:62268613-62268635 GCCCGGGCTCCTGCCGCCATCGG - Intergenic
1155081906 18:22418821-22418843 AAGCTTGCTCCTGCAGCAATGGG + Intergenic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1161067266 19:2244805-2244827 CCTGGTGCTCCAGCAGCCGTTGG + Intronic
1163314006 19:16530659-16530681 CCGCCAGCTCCTGCAGCTCTGGG - Exonic
1165941528 19:39416895-39416917 CCTGGCGCTCCTGCAGCCACAGG - Exonic
1202706245 1_KI270713v1_random:26387-26409 CTCCATGCTCATGCAGCCATAGG - Intergenic
928082929 2:28326332-28326354 GCGCCTGCTCTTGCAGCCCTGGG + Intronic
931214205 2:60226252-60226274 ATGCATGCACCTGCAGCCATAGG - Intergenic
932104010 2:68926562-68926584 CCGCCTGCCCCTGCAATCATTGG - Intergenic
934307973 2:91841735-91841757 CCTCTTGCTCCTGCTGCCCTCGG + Intergenic
934784788 2:96997250-96997272 CTGTGTGCTCCTGCAGCCTCCGG - Intronic
946835708 2:223770403-223770425 CTGGGTCCTCCAGCAGCCATGGG + Intronic
1168812302 20:711919-711941 CCTGCTGCTCCTGAAGCCATGGG + Intergenic
1173904276 20:46614420-46614442 GAGCATGCTCCTGCAGCCAGGGG + Intronic
1175198571 20:57263385-57263407 CAGCTTGCTCCTGCCGCCATGGG + Intronic
1175916798 20:62429750-62429772 CGGCGTCCTTCTGCAGCCGTGGG + Intergenic
1176376639 21:6089953-6089975 CCGTGTGCTCCTTCTGCCCTCGG - Intergenic
1177265274 21:18775120-18775142 CCTCCTGCTCCTGGAGCAATGGG + Intergenic
1179746836 21:43448291-43448313 CCGTGTGCTCCTTCTGCCCTCGG + Intergenic
1179959078 21:44758299-44758321 CAGCATGGTCCTGCAGCCAGAGG + Intergenic
1180065463 21:45410074-45410096 AGGCGTGCTCCTGCAGGCACGGG - Intronic
1180535055 22:16388818-16388840 CCTCTTGCTCCTGCTGCCCTCGG + Intergenic
1181737222 22:24891723-24891745 CCATATGCTCCTGCAGCCCTCGG - Intronic
1183307474 22:37090287-37090309 CTGCTTTCTCCTGCAGCCATAGG + Intronic
1183718275 22:39547054-39547076 CTGTGCTCTCCTGCAGCCATTGG - Intergenic
1184745103 22:46451568-46451590 CCGCATGCTACTGGAGCCTTTGG - Intronic
1185301084 22:50081583-50081605 GGCCTTGCTCCTGCAGCCATGGG + Intronic
950366024 3:12484722-12484744 CCTCGTGCGCCTGCAGCCCTTGG + Exonic
951034453 3:17917840-17917862 CCGTGTCCTCCTGCAGCTCTGGG + Intronic
954098171 3:48347695-48347717 CTGAGTTCTCCTGCAGCCGTAGG - Intergenic
954848901 3:53583596-53583618 CCTCGTGGTTCTGCAGCCACAGG - Intronic
961014871 3:123459947-123459969 CTGCATCCTCCTGCAGGCATGGG + Intergenic
964331569 3:155608725-155608747 CCGCCTGATCCTGCCCCCATCGG + Intronic
966857712 3:184206854-184206876 CAGCGTGAACCTGCAGCAATGGG + Intronic
968787136 4:2631013-2631035 CCGCCTGCTCCGGCAGCTGTCGG + Exonic
969259759 4:6025832-6025854 CCTCCTGCTCCTGTAGCCCTCGG + Intergenic
969488376 4:7485181-7485203 CCTGGGGCTCCTGCAGCCTTCGG + Intronic
976758448 4:88523413-88523435 CCGCGGCCTCTTGCAGCCACTGG - Intronic
984964288 4:185127540-185127562 CCGCGAGCTCCTGCAGGTAACGG + Intergenic
988891076 5:35617909-35617931 CCGCGTCCTCCTGTAGCCAAGGG - Exonic
989691666 5:44152187-44152209 CCACGTGTGCCTGCAGCCTTTGG - Intergenic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1004360720 6:14968348-14968370 CCTCCAGCTCCTGCAGCAATGGG - Intergenic
1005215200 6:23518517-23518539 CCTGGTGCTCCTGCTGCCACCGG + Intergenic
1006515864 6:34545251-34545273 CCGCATGCTCCTCCAGGCATCGG - Intronic
1006906702 6:37537819-37537841 CCATCTGCTCCTGCAGCAATTGG - Intergenic
1007792216 6:44316809-44316831 CCGGGGGCTCCACCAGCCATCGG - Intronic
1010637969 6:78283655-78283677 CCCAGGGCTCCTGCACCCATGGG + Intergenic
1023519927 7:41039766-41039788 CCACGTGGTGCTGCAGCCAGAGG - Intergenic
1024639424 7:51317052-51317074 CCCCGTGCTCCTCCACCCCTGGG + Intergenic
1025020630 7:55476724-55476746 CCAGCTGCTCCTCCAGCCATGGG + Intronic
1030616035 7:111739056-111739078 CCGCGTGTTTCTGCAGAGATAGG + Intronic
1034809973 7:154123590-154123612 CCGTGTGCTCCTTCACCCCTGGG + Intronic
1035458628 7:159025470-159025492 ACACGTGCCCCTGGAGCCATGGG + Intergenic
1037116822 8:15237338-15237360 CCGCCTGCTCCTCCCGCCAGCGG - Intronic
1038515255 8:28182692-28182714 GAGCGTGCTCCTGCAGCCAGAGG + Intronic
1039945134 8:42122452-42122474 CCACCTGCTCCTACAGCAATTGG + Intergenic
1049645193 8:143733033-143733055 CCGCGCCCTCCTGCGCCCATCGG - Intronic
1052143403 9:25017689-25017711 CCGGGTGCTGCTGCTGCTATTGG - Intergenic
1052316061 9:27117544-27117566 ACACCTGCTCCTGCAGCCTTTGG - Intronic
1052917051 9:33931440-33931462 CCCAGTGCTCCTGCACTCATGGG - Intronic
1053471435 9:38348359-38348381 CCTTGGGCTCCTGTAGCCATGGG + Intergenic
1059334921 9:113563031-113563053 CCCAGGGCTCCTCCAGCCATGGG + Intronic
1059544307 9:115160891-115160913 CCTCCTGCTCCTACTGCCATGGG + Intronic
1061391994 9:130321840-130321862 CCGCGTGCTCCTGCAATGCTCGG - Intronic
1061715384 9:132515365-132515387 CAGAGTCCTCCTGCAGCCCTGGG - Intronic
1061952325 9:133943443-133943465 CCGCTTGCTCCTGCAGCCACAGG - Intronic
1062099708 9:134721714-134721736 GCGCTAGCTCGTGCAGCCATGGG + Intronic
1186482709 X:9908175-9908197 CTGCGTGCTCCTGCATTCTTGGG - Intronic
1190430385 X:50372924-50372946 CCACTTGCTGCTCCAGCCATAGG + Intronic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic
1197038245 X:121903957-121903979 CTGCATGCTCCTGCCGCCATTGG - Intergenic
1199595879 X:149505361-149505383 GCGCGTCATCCTGCAGCAATAGG + Intronic
1200149169 X:153943025-153943047 ACGCGTCCTCCTGCACCCAGTGG + Exonic
1201306490 Y:12555147-12555169 CTGCGTGCTCCTGCATTCTTGGG - Intergenic