ID: 1144732451

View in Genome Browser
Species Human (GRCh38)
Location 17:17536586-17536608
Sequence TCCCATGAGGTCACCTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144732451_1144732453 -8 Left 1144732451 17:17536586-17536608 CCAGCAAAGGTGACCTCATGGGA 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1144732453 17:17536601-17536623 TCATGGGAGTGTCCATGCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 137
1144732451_1144732454 -4 Left 1144732451 17:17536586-17536608 CCAGCAAAGGTGACCTCATGGGA 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1144732454 17:17536605-17536627 GGGAGTGTCCATGCCCTGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 239
1144732451_1144732456 5 Left 1144732451 17:17536586-17536608 CCAGCAAAGGTGACCTCATGGGA 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1144732456 17:17536614-17536636 CATGCCCTGGCTGGCTCCTGTGG 0: 1
1: 0
2: 1
3: 43
4: 386
1144732451_1144732463 25 Left 1144732451 17:17536586-17536608 CCAGCAAAGGTGACCTCATGGGA 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1144732463 17:17536634-17536656 TGGGTTTGAGCAGAGGGAAATGG 0: 1
1: 0
2: 2
3: 52
4: 412
1144732451_1144732457 6 Left 1144732451 17:17536586-17536608 CCAGCAAAGGTGACCTCATGGGA 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1144732457 17:17536615-17536637 ATGCCCTGGCTGGCTCCTGTGGG 0: 1
1: 0
2: 1
3: 23
4: 245
1144732451_1144732461 19 Left 1144732451 17:17536586-17536608 CCAGCAAAGGTGACCTCATGGGA 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1144732461 17:17536628-17536650 CTCCTGTGGGTTTGAGCAGAGGG 0: 1
1: 0
2: 1
3: 27
4: 305
1144732451_1144732460 18 Left 1144732451 17:17536586-17536608 CCAGCAAAGGTGACCTCATGGGA 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1144732460 17:17536627-17536649 GCTCCTGTGGGTTTGAGCAGAGG 0: 1
1: 0
2: 3
3: 21
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144732451 Original CRISPR TCCCATGAGGTCACCTTTGC TGG (reversed) Intronic
901463784 1:9407468-9407490 TCCCATGAAGACACCTTGGATGG - Intergenic
902652071 1:17843637-17843659 GCCCATGAGCTCCCCTTTACTGG + Intergenic
903608070 1:24589553-24589575 ACCCAGGAGGTCACCCCTGCAGG + Intronic
904255366 1:29251315-29251337 TCCTTGGAGGTCACCTTGGCCGG + Intronic
910790366 1:91044034-91044056 CCCCATGAGGCCATCTATGCAGG - Intergenic
910807491 1:91203480-91203502 TTCCCTGTGGTCACCATTGCTGG + Intergenic
911314614 1:96340862-96340884 TCCCATGAGGTCACATGTGTGGG - Intergenic
914451895 1:147799951-147799973 TACCATGAGGCCACGTTGGCAGG - Intergenic
917958772 1:180126189-180126211 TCCCACGAGGTAAGCTTGGCGGG - Intergenic
918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG + Intronic
919125618 1:193389338-193389360 CCCCAGGAGGTCAACATTGCAGG - Intergenic
922499214 1:226084135-226084157 GCCCCTGAGGTCACTTTCGCGGG - Intergenic
922660235 1:227423716-227423738 TTACATAAGGTCAACTTTGCGGG + Intergenic
922793494 1:228323927-228323949 TCCCTTGAGGTCCCTTTTGAAGG + Intronic
1063345360 10:5306913-5306935 TCCGATGAGCTCTCCTTTGTTGG - Intergenic
1065249721 10:23798336-23798358 TTCCATGAGGACAGGTTTGCTGG - Intronic
1066957661 10:42188367-42188389 CCCCATGAGGTCATCAGTGCTGG - Intergenic
1069793323 10:71037151-71037173 TCCCTAGAGGTCACCTTTCCAGG - Intergenic
1074310055 10:112314504-112314526 ACCAATGAGGACAACTTTGCAGG - Intergenic
1075169644 10:120101617-120101639 TCCCCTGAGGCCACTTTTCCAGG - Intergenic
1076441386 10:130483572-130483594 TCCCATTAGCTCGCCATTGCGGG + Intergenic
1076772585 10:132674525-132674547 TCCCATGAGGCCATCGGTGCAGG + Intronic
1079159378 11:17977982-17978004 TCCCATAAGGTCACCTTGAGAGG + Intronic
1080930034 11:36800300-36800322 TTCCATGAGGTTTCCTTTGTAGG - Intergenic
1080988267 11:37497597-37497619 TCTGATGAGGCCACGTTTGCTGG - Intergenic
1081299110 11:41428642-41428664 TCATATGTTGTCACCTTTGCTGG + Intronic
1084861104 11:72018739-72018761 TCCCATGTTGTCCCCTCTGCTGG - Intronic
1085685998 11:78622478-78622500 CCCCATGAGGCCATCTGTGCAGG - Intergenic
1087610965 11:100433545-100433567 TCAAATAAGGTCACCTTTGCAGG - Intergenic
1089061263 11:115627995-115628017 TCACACGAGGACTCCTTTGCAGG - Intergenic
1093137373 12:15468390-15468412 TCCCATGATGCCACCTCTACTGG + Intronic
1096237664 12:49940645-49940667 ACCCAAGAGGTCACCTCTGGAGG + Intergenic
1096457419 12:51799148-51799170 CCCCATGAGGCCATCTCTGCAGG + Intronic
1099526400 12:83723397-83723419 TCCCATGAGGACATCGGTGCAGG - Intergenic
1099578114 12:84405680-84405702 TCCCATGAGGCCACTGGTGCAGG - Intergenic
1099735820 12:86565325-86565347 TCCCATGAGGCCATCAGTGCAGG - Intronic
1100301640 12:93313318-93313340 TCCCATCAGGCTACCTTTCCTGG + Intergenic
1102455949 12:113070842-113070864 TCCCAAGAGTTCACCTCTCCGGG + Intronic
1102487317 12:113267014-113267036 CCCCATGCCGTCACCTGTGCTGG + Intronic
1102871299 12:116416295-116416317 ACCCCTGAGGTCACCTTGGCGGG - Intergenic
1104662855 12:130624004-130624026 TCCCATGAAACCACTTTTGCTGG + Intronic
1105256706 13:18748185-18748207 GCCCATGAGGGCACCTGTGGGGG - Intergenic
1105262060 13:18786868-18786890 GCCCATGAGGGCACCTTTGGGGG - Intergenic
1108904320 13:55450259-55450281 CCCCATGAGGCCACCGGTGCAGG - Intergenic
1109498022 13:63200375-63200397 TCTCATGAGGTGACCTTGGTAGG + Intergenic
1115329971 14:32186592-32186614 TCCAATATGGTCTCCTTTGCTGG + Intergenic
1118122402 14:62859881-62859903 CCCCATGAGGCCACCGGTGCAGG + Intronic
1118128445 14:62935872-62935894 TCCCATGAAGTCACTTTTTGTGG + Intronic
1119161261 14:72454135-72454157 ACCTATGAGGTCACCTGTGTTGG + Intronic
1121600923 14:95202546-95202568 TCAAGTGAGGTCACCTTTGAGGG - Intronic
1202935441 14_KI270725v1_random:83409-83431 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1128664604 15:69529020-69529042 TACCATGAGGCCAGATTTGCAGG - Intergenic
1130553803 15:84908964-84908986 TCTCATGAGGTGAACATTGCTGG - Intronic
1131524242 15:93139937-93139959 TCTCAGAAGGTCACCTATGCTGG - Intergenic
1135872123 16:26160887-26160909 TGGCATGAGGTTACCTGTGCAGG - Intergenic
1139097432 16:63721663-63721685 TCCCATGAGGGCAGCATCGCAGG + Intergenic
1142473948 17:179215-179237 TCACATGAGGTCAGCAGTGCAGG - Intronic
1143029743 17:3961337-3961359 TCCTGTGAGCCCACCTTTGCAGG - Intronic
1144446318 17:15332820-15332842 TCTGAGGAGTTCACCTTTGCGGG - Intronic
1144732451 17:17536586-17536608 TCCCATGAGGTCACCTTTGCTGG - Intronic
1146731097 17:35194365-35194387 TCCAATGAGGTCACAATGGCTGG - Exonic
1147185766 17:38712396-38712418 TCCCAGGTGGACACCCTTGCAGG + Intronic
1153828116 18:8896015-8896037 TCCCTGGAGGTCATCTTTGTAGG - Intergenic
1154115404 18:11609516-11609538 TCCAATGAGGTCACAGTGGCTGG + Intergenic
1154171703 18:12057156-12057178 TCCATCGAGGTCACCTTTGCTGG - Intergenic
1154426629 18:14277250-14277272 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1154429371 18:14296842-14296864 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1154431646 18:14313190-14313212 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1154434339 18:14332493-14332515 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1156492840 18:37506466-37506488 GCCCATGAGGTCACTTGTCCTGG - Intronic
1166342098 19:42144345-42144367 TCCCATTAGCTCCCTTTTGCAGG - Intronic
1167230856 19:48282242-48282264 ACAAATCAGGTCACCTTTGCAGG + Intronic
1168282837 19:55314714-55314736 GACCATTAGGTCTCCTTTGCAGG - Intronic
1168539296 19:57197116-57197138 TCCCATGAGGCCATCGGTGCAGG + Intronic
925921290 2:8639533-8639555 TCTCCTGAAGTCACCTGTGCAGG + Intergenic
926323884 2:11767698-11767720 CCCCATGAGGTCTCCTGTCCTGG + Intronic
927323129 2:21771469-21771491 TCTCATTAGAACACCTTTGCTGG - Intergenic
927371356 2:22358821-22358843 AACCATGAGTTCACTTTTGCAGG - Intergenic
928007024 2:27571797-27571819 TGCCATGGGGTCAACTTTACAGG - Intergenic
928444618 2:31322098-31322120 TCCAATGAGGTTACTTTTGGTGG + Intergenic
929810362 2:45184530-45184552 TTCCATGAAGTCATCCTTGCTGG - Intergenic
930536571 2:52651977-52651999 CCCCATGAGGCCACCAGTGCAGG + Intergenic
932891556 2:75601224-75601246 TCAAATGAGGTCACATTTACAGG - Intergenic
934305781 2:91820881-91820903 CCCCATGAGGTCATCAGTGCAGG - Intergenic
934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG + Intergenic
934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG + Intergenic
934680769 2:96282424-96282446 TCCCTTGAGCTCACTCTTGCTGG - Intronic
936646303 2:114376459-114376481 TCCCTTGAGATCACCTATGGGGG + Intergenic
937093687 2:119223006-119223028 TCACCTGTGGTCACATTTGCCGG - Intergenic
937340364 2:121087148-121087170 CCCCAAGAGGTCACCTCTGTGGG + Intergenic
938618044 2:133020157-133020179 TCCCATGATGTCGTCTTTGGTGG - Intronic
940462788 2:153988372-153988394 TTCCATGAGTTCACCTTTTTTGG + Intronic
942111138 2:172683781-172683803 TCCCATTCAGTCACTTTTGCTGG - Intergenic
942260645 2:174158254-174158276 TCCCCTGTGGTCAGCTGTGCAGG + Intronic
943517555 2:188906957-188906979 TGCCATGAGGCCACCAGTGCAGG + Intergenic
944240389 2:197480334-197480356 TACCATGAGGTCAAGGTTGCAGG + Intergenic
948747929 2:240109378-240109400 TCCAAGGTCGTCACCTTTGCAGG + Intergenic
1169200541 20:3707066-3707088 TCCCAGCAGGTAAGCTTTGCGGG - Exonic
1174147840 20:48464479-48464501 TCCCATGTGGTCACCTGGTCTGG - Intergenic
1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1176842700 21:13853225-13853247 GCCCATGAGGTCACCTGTGGGGG - Intergenic
1176848119 21:13892129-13892151 GCCCATGAGGGCACCTGTGGGGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1179580230 21:42338761-42338783 ACCCATGAGGCCACCATTTCAGG - Intergenic
1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1181311066 22:21945204-21945226 TCACATGAGGTCACATTGGCTGG + Intronic
1182062502 22:27407955-27407977 TCCCCTGGGGTCACCCTGGCAGG + Intergenic
1184316667 22:43698564-43698586 TTCTATGATGTCACCTATGCTGG - Intronic
1185225141 22:49647885-49647907 GCCCATGAGGACACCTTTCCAGG + Intronic
949125625 3:442860-442882 CCCCATGAGGCCACCAGTGCAGG + Intergenic
949652925 3:6181842-6181864 CCCCAGGAGCTCACCTTGGCTGG + Intergenic
951554534 3:23907481-23907503 TCTCATGAGGTCTCCTTTCAGGG + Intronic
953906599 3:46871588-46871610 TCCCATCAGGTCAGCCTTGAGGG + Intronic
959203618 3:103278960-103278982 CCCCATGAGGTTATCTTTGGAGG + Intergenic
962345333 3:134614540-134614562 TCCCATCAGGCCACATTTGGTGG - Intronic
968455796 4:699037-699059 TCCCATGAGGCCTCCTCTGCAGG + Intergenic
969302188 4:6303699-6303721 TCCCATGGGGTCATCACTGCAGG - Intergenic
970310820 4:14780506-14780528 TCCAATGAGGTCACATTCACAGG - Intergenic
971313257 4:25545219-25545241 TACCATGAGTTTATCTTTGCGGG + Intergenic
971510580 4:27418248-27418270 TCTCATGAGATCACTTGTGCAGG + Intergenic
974262330 4:59541994-59542016 CCCCATGAGGCCACCTGGGCAGG + Intergenic
974289608 4:59913027-59913049 CCCCATGAGGTCATCAGTGCAGG - Intergenic
974636545 4:64570801-64570823 TCTCATGAGATCACCTCTTCAGG + Intergenic
981462849 4:145032080-145032102 TCCCATGAGGCCATCGGTGCAGG - Intronic
981907787 4:149942622-149942644 TCTAATGAGGTGACTTTTGCTGG + Intergenic
982428808 4:155298364-155298386 ACCCATGAGATCACCTGTGGAGG - Intergenic
985968864 5:3359619-3359641 TCCCAGGATATCACATTTGCTGG + Intergenic
986680849 5:10231590-10231612 ACCTCAGAGGTCACCTTTGCAGG + Intronic
987338714 5:16920528-16920550 TCCCTTGGGCTCACCTTTGGTGG - Intronic
987544689 5:19298127-19298149 TCCCATGAGGTCACCTTTTCTGG - Intergenic
988192827 5:27962134-27962156 TCTGATGAGGTTACCTTTGTAGG + Intergenic
988562169 5:32291126-32291148 CCCCATGAGGTCATCGGTGCAGG - Intronic
990625237 5:57603224-57603246 CCAAATGAGGTCACATTTGCAGG + Intergenic
993412538 5:87591521-87591543 TCCCATGAGGCCACTGGTGCAGG + Intergenic
995684152 5:114752914-114752936 TACCATGTGGTCACCATTTCTGG + Intergenic
1007263987 6:40583818-40583840 TCCTCTGAGGTCACCCTTGGGGG + Intronic
1008970238 6:57358816-57358838 TCCCAGGAGATCATCTTAGCTGG + Intronic
1009159205 6:60260640-60260662 TCCCAGGAGATCATCTTAGCTGG + Intergenic
1009817860 6:68759048-68759070 TCCGATGAGGTGATCTTTGAAGG - Intronic
1010818667 6:80388695-80388717 CCCCATGAGGTCACTGGTGCAGG - Intergenic
1013636550 6:112034329-112034351 TCCCATGATGCCACTTCTGCTGG - Intergenic
1014519322 6:122420905-122420927 TTTCATCATGTCACCTTTGCTGG + Intronic
1016103342 6:140130164-140130186 TCTGATGAGGTCTCCTTTGTAGG - Intergenic
1018534990 6:164810206-164810228 TCCCATGAGGCCATCAATGCAGG + Intergenic
1019870036 7:3751749-3751771 TGCCCTGAGGTCACCTTGCCTGG + Intronic
1019998687 7:4742141-4742163 TCCACTGGGGTGACCTTTGCTGG - Intronic
1023328604 7:39088282-39088304 TCTCATAAGGTTTCCTTTGCAGG + Intronic
1024486796 7:49928596-49928618 TCCCATGAGGTCACAGGTGCAGG + Intronic
1027675712 7:81155212-81155234 TCAAATAAGGTCACCTTTTCAGG + Intergenic
1030066865 7:105666452-105666474 TCTCATTAGGGCACCTTTCCTGG + Intronic
1030281319 7:107778491-107778513 TCCCAAGAGGTCATTTCTGCTGG + Intronic
1032580356 7:133098173-133098195 TCCCTTTGGGTCAGCTTTGCAGG - Intergenic
1033228050 7:139576285-139576307 GACCATGAGGTCACCTCTGGAGG - Intronic
1033515088 7:142097454-142097476 TCCCAGGAGGTCACCTATTGAGG - Intronic
1033858893 7:145600136-145600158 TGGCATGAGGTTACCTTTGTAGG - Intergenic
1034542403 7:151766952-151766974 CCACATGAGGTCACGTTTGGAGG - Intronic
1036737437 8:11331027-11331049 TCCAATGAGGTCACAATGGCTGG + Exonic
1037893779 8:22638199-22638221 TCTCATCAGGTCAGCGTTGCTGG - Intronic
1040588861 8:48770496-48770518 TGCCATGAGGCTACCTTAGCAGG - Intergenic
1040911982 8:52528704-52528726 TCCCATGAGGCCATCGGTGCAGG - Intergenic
1041024263 8:53667843-53667865 TCTCAGGAGGTGACCCTTGCAGG - Intergenic
1045251706 8:100488018-100488040 TCCACTGAGTTCACCTTTGCAGG - Intergenic
1045376568 8:101580472-101580494 TCACTTGAGGTCACCCTGGCTGG - Intronic
1046109929 8:109710389-109710411 TTTCATGAGGTCACATTTCCAGG + Intergenic
1046585748 8:116147457-116147479 TCCCATGAGGCCATCGGTGCAGG + Intergenic
1048163476 8:132041475-132041497 TCCCATGAGCTCACTTTTTTTGG + Intronic
1048219907 8:132531639-132531661 TCCCAGGAGGTGGCATTTGCTGG - Intergenic
1048293964 8:133200702-133200724 TCCCATGAGGTCAGCATTGATGG - Intronic
1050675992 9:8053649-8053671 TTCCATGGGGTCTGCTTTGCTGG + Intergenic
1052442227 9:28511996-28512018 CCCCATGAGGTCATCAGTGCAGG + Intronic
1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054490882 9:65774025-65774047 CCCCATGAGGTCATCAGTGCAGG - Intergenic
1056974655 9:91240780-91240802 TCCCATGAGCTCCCTTTTGGTGG + Intronic
1057022825 9:91713842-91713864 TCCCACGATGCCACCTTCGCAGG + Intronic
1058836646 9:108863368-108863390 CCCCATGAGGTCCCGTTTGAGGG - Exonic
1059424594 9:114212846-114212868 GCCAATGACTTCACCTTTGCTGG + Intronic
1061844077 9:133376709-133376731 ACCCAGGAGGTCACCGTTGGAGG - Intronic
1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1186735297 X:12456929-12456951 TCCCTTCAGGTCAGTTTTGCTGG + Intronic
1190255366 X:48758411-48758433 CCCCATGAGGCCACAGTTGCAGG - Intergenic
1191631333 X:63325165-63325187 TCCCATGAGGCCATCGGTGCAGG - Intergenic
1192332793 X:70191118-70191140 TTCCATGATGTCATGTTTGCTGG - Intronic
1196135926 X:112209557-112209579 CCCCATGAGGCCATCGTTGCAGG + Intergenic
1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG + Intergenic