ID: 1144732592

View in Genome Browser
Species Human (GRCh38)
Location 17:17537255-17537277
Sequence AATCCTGCCCTGCTCCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144732588_1144732592 9 Left 1144732588 17:17537223-17537245 CCAGCTCGGAGGTGGGAGCCCAG 0: 1
1: 0
2: 2
3: 23
4: 219
Right 1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG 0: 1
1: 1
2: 1
3: 16
4: 204
1144732590_1144732592 -10 Left 1144732590 17:17537242-17537264 CCAGAGCTCCTCGAATCCTGCCC 0: 1
1: 0
2: 2
3: 18
4: 230
Right 1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG 0: 1
1: 1
2: 1
3: 16
4: 204
1144732583_1144732592 25 Left 1144732583 17:17537207-17537229 CCAGCATGCTCAGAGTCCAGCTC 0: 1
1: 0
2: 2
3: 18
4: 241
Right 1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG 0: 1
1: 1
2: 1
3: 16
4: 204
1144732589_1144732592 -9 Left 1144732589 17:17537241-17537263 CCCAGAGCTCCTCGAATCCTGCC 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG 0: 1
1: 1
2: 1
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144732592 Original CRISPR AATCCTGCCCTGCTCCTGTG AGG Intronic
900630775 1:3634019-3634041 AAGCATGCTCTGCTGCTGTGTGG + Intronic
900943834 1:5818218-5818240 TCTCCTGCCCTGCTCATGTCTGG - Intergenic
900975703 1:6014930-6014952 CATGCTGTCCTGCTCCTCTGGGG - Intronic
902509412 1:16957993-16958015 TACCCCTCCCTGCTCCTGTGGGG + Intronic
902706282 1:18207425-18207447 AATTCTGCCCACCTCATGTGAGG + Intronic
902818111 1:18927486-18927508 CATCCAGCCCTGCTGCAGTGGGG - Intronic
903664462 1:24997874-24997896 AGGCCTGCCTGGCTCCTGTGGGG - Intergenic
903853407 1:26321460-26321482 CAGCCTGCCCTGCACTTGTGGGG + Intergenic
907643810 1:56220255-56220277 TATTCTGCCCTGATCCTGCGGGG - Intergenic
911103386 1:94111291-94111313 AAACCTGCTCTGCTCCTAAGAGG + Intronic
911238088 1:95433325-95433347 AATAGTGCCCTGCTCCTCTAGGG - Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
911398253 1:97338800-97338822 AAACCTGGCCTGTTCTTGTGTGG + Intronic
914995804 1:152542535-152542557 CATCCAGCCCTGCTCCTCTGTGG + Intronic
915002732 1:152608345-152608367 CATCCAGCCCTGCTCCACTGTGG - Intergenic
917613655 1:176715411-176715433 ATTTCTCCCCTGCTCCAGTGGGG - Intronic
919613642 1:199777901-199777923 CTTCCTGCCCTCCTGCTGTGTGG + Intergenic
920293228 1:204938896-204938918 CATCCAGCCTTCCTCCTGTGTGG + Intronic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
923377515 1:233379340-233379362 AAGCCTGCCATCCACCTGTGGGG + Exonic
923705934 1:236344966-236344988 CCTCCTGCCCGCCTCCTGTGAGG + Intergenic
1063193992 10:3723043-3723065 AGTCCTGCCCTCTTCCTGAGAGG - Intergenic
1063297993 10:4825961-4825983 AAACCTTCCCTGCTCCTGCGTGG + Intronic
1063410207 10:5831470-5831492 AATCCTCTCCTGCTCTTGTTAGG - Intronic
1067768697 10:49108463-49108485 TACCCTGCCCTGCTCCAGGGCGG - Intronic
1069814793 10:71186927-71186949 GATCCTGCACTGTGCCTGTGAGG + Intergenic
1071013900 10:80971733-80971755 AATTCTGCCCTGCTGTTCTGTGG - Intergenic
1072298082 10:94031584-94031606 AATACTGCCCTTCTGCTGTCAGG - Exonic
1074455541 10:113592512-113592534 CATTAGGCCCTGCTCCTGTGGGG + Intronic
1075538713 10:123294558-123294580 GTGCCTGCCCTGCCCCTGTGAGG + Intergenic
1077330219 11:1980893-1980915 ACTCCGGCCATGCTCCAGTGGGG + Intronic
1078896708 11:15603429-15603451 AATCCTGCTCTGCTCTTGCCAGG - Intergenic
1079078245 11:17396760-17396782 TCTCCTGCCCTGGGCCTGTGGGG - Intronic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1081660494 11:44885243-44885265 CATCCTGCCCAGCTCCCATGAGG + Intronic
1084477026 11:69394858-69394880 AATCCAGCCCTGTCCCTGCGTGG - Intergenic
1084592724 11:70099838-70099860 AATCCTGCCCTGCCCCTGTGTGG - Intronic
1084887292 11:72219087-72219109 ATTCATGTCCAGCTCCTGTGTGG - Intronic
1085383117 11:76138619-76138641 AATCCTGCTCTGCTGTTTTGTGG - Intronic
1088195019 11:107264515-107264537 AAACCTGCCCTGCTAATGGGGGG + Intergenic
1090069008 11:123527339-123527361 AGTCCAGCCCTCCTCCTGTAGGG + Intronic
1090972080 11:131652784-131652806 ATTCCTGCCCTGCTGCAGCGTGG - Intronic
1091204632 11:133811615-133811637 AAGCCTGCCCTGCGCAGGTGAGG + Intergenic
1091353525 11:134916193-134916215 CACCCTGCCCTCCTCCTGAGGGG + Intergenic
1202813196 11_KI270721v1_random:36072-36094 ACTCCGGCCATGCTCCAGTGGGG + Intergenic
1095963718 12:47852242-47852264 CATCCTTCCCTGCTCTAGTGGGG - Intronic
1096426787 12:51510728-51510750 AGTGCAGCCCTCCTCCTGTGTGG + Exonic
1096510182 12:52123505-52123527 CATCCAGCCCTGCACCTCTGGGG - Intergenic
1100408229 12:94289549-94289571 AATCGTCCCCTAGTCCTGTGAGG - Intronic
1101810360 12:108102582-108102604 AATCTTGCCCAGCTACTATGGGG + Intergenic
1102023726 12:109701232-109701254 AATGCTGCCCAGCTGCTCTGGGG - Intergenic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102474314 12:113178983-113179005 AAGACTGCCCTGATCCTGGGTGG - Exonic
1102838584 12:116092399-116092421 AAACCTGCCCTGTTCTTGAGTGG - Intronic
1103825982 12:123738708-123738730 AATTCTTCCATGTTCCTGTGAGG + Intronic
1104619437 12:130299839-130299861 CACCCGGCCCTGCTGCTGTGAGG + Intergenic
1106595190 13:31129588-31129610 CCTCCTGCCCTGCTATTGTGTGG - Intergenic
1108085092 13:46779839-46779861 ATTCCTACCCTGCTCATGTTAGG - Intronic
1108493246 13:51001457-51001479 CATCCTGCCCGGCCCCTATGTGG - Intergenic
1110498131 13:76193155-76193177 ACTTCTGCCCTGCACCTGTGAGG - Intergenic
1115749773 14:36477583-36477605 AATCCTGCCCTTAATCTGTGGGG - Intronic
1116070621 14:40039924-40039946 GAGCCTGCCCTGCTCCTGCATGG - Intergenic
1119725672 14:76920566-76920588 AATCCTACCCTCCTCGAGTGGGG - Intergenic
1120047827 14:79828227-79828249 GATCCTGTACTGCTCCTGGGAGG + Intronic
1121023791 14:90599496-90599518 AATCCTGCCAGCCTCATGTGAGG - Intronic
1202918071 14_KI270723v1_random:3300-3322 TCCCCTGCCCTGCCCCTGTGGGG + Intergenic
1202926554 14_KI270724v1_random:31286-31308 TCCCCTGCCCTGCCCCTGTGGGG - Intergenic
1124139097 15:27061859-27061881 AATCCTGCTGTGCTCCCGAGAGG + Intronic
1124367787 15:29085961-29085983 AGTCCTTCCCTCCCCCTGTGTGG + Intronic
1124883604 15:33663724-33663746 GACCCTCACCTGCTCCTGTGGGG - Exonic
1131287209 15:91070116-91070138 TCTCCTGCCCTGCTCATGTCTGG + Intergenic
1132573049 16:652338-652360 AAGACTGCCCTGGTCCTGGGTGG - Intronic
1132802214 16:1760018-1760040 AAGAGTGCCCTTCTCCTGTGTGG + Intronic
1133143675 16:3767528-3767550 ACCCCTGCCCTGTGCCTGTGGGG - Intronic
1133779895 16:8929857-8929879 AATCCCTCCCCGCTCCTGTTAGG - Intronic
1137719314 16:50618682-50618704 CATCCTGCCCTGGGGCTGTGGGG - Intronic
1137730754 16:50687896-50687918 ATTCCAGCCCTGCTCCTTAGCGG - Intergenic
1138344781 16:56313593-56313615 ACTCCTTCCCTGTTCGTGTGGGG - Intronic
1138454709 16:57114587-57114609 GATCTAGTCCTGCTCCTGTGGGG - Intronic
1140305299 16:73797355-73797377 TTTCCTGACCTGCTCCTGTAGGG + Intergenic
1141004514 16:80339704-80339726 CATCCTTCCCTGCCCCTGGGAGG - Intergenic
1141661811 16:85445464-85445486 AATCTGGGCCTGCACCTGTGAGG - Intergenic
1142553993 17:760119-760141 ATTCCTGCCCAGCACCTGTGAGG - Exonic
1142576371 17:911199-911221 AATCATGCCCTGCCCCTGCTTGG + Exonic
1142996057 17:3761280-3761302 AACCCTGCCTTGCTCCACTGTGG + Intronic
1143350599 17:6285476-6285498 ACTTCTGCCCTCCTCCTTTGTGG + Intergenic
1143631340 17:8142106-8142128 AAACCTGCTCTCCTCCTGGGAGG + Intronic
1143723466 17:8829856-8829878 CATCCTGCCCAGCTCCTGTGCGG + Intronic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1145941814 17:28746718-28746740 TACCCTGCCCTGCTCCTTTGAGG - Intronic
1147121882 17:38339941-38339963 GATCCTGCCCTGTACCTGGGAGG + Intronic
1147611728 17:41805797-41805819 GATTCTGCCCTCCTCCTCTGGGG + Intronic
1147997106 17:44366225-44366247 ATTACGCCCCTGCTCCTGTGAGG - Intergenic
1150638174 17:66931163-66931185 AATACTGCCCTGCCCATGGGAGG + Intergenic
1151637644 17:75362745-75362767 CAACTTGCTCTGCTCCTGTGTGG + Intronic
1152702361 17:81825395-81825417 CAGCCTGCCCTGCTCCAGAGGGG + Exonic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1153628940 18:7050411-7050433 ATTCTTGCCCTGGTGCTGTGGGG + Intronic
1154162202 18:11989116-11989138 AAGCCTGCTCTCCTCCTGTCCGG - Intronic
1156491559 18:37499441-37499463 GACCCTGTTCTGCTCCTGTGTGG - Intronic
1158542116 18:58366643-58366665 GACCATGCCCTGCTCCTGTAAGG + Intronic
1159232826 18:65630785-65630807 CATACTGCTCTGCTCCTGTGTGG - Intergenic
1159552034 18:69905197-69905219 GATCCTGCCCTGCTGCAGGGTGG - Intronic
1160623699 18:80188680-80188702 AACTCTGCCCTGCATCTGTGTGG - Intronic
1161377802 19:3949229-3949251 AATCCTGCCCCGCTCCCTTGAGG + Intergenic
1165668642 19:37655679-37655701 AATCCAGGCCTGCTCCCCTGTGG + Intronic
925159757 2:1675889-1675911 ACTCCTGCGCTGCTCCTCTCTGG - Intronic
925572816 2:5330131-5330153 GATCCTGCCCTGCTCCAATCAGG - Intergenic
925852100 2:8091782-8091804 GATCCTGCCCTTCTCATGGGTGG - Intergenic
926373449 2:12203788-12203810 AATTCTGGCCTGATCCTCTGTGG - Intergenic
926622592 2:15060491-15060513 ATTCCTCCCCTGATCCTGGGAGG + Intergenic
927218010 2:20680680-20680702 ACTCCTTCCCTGGTCCTGTCAGG + Intergenic
927854017 2:26516704-26516726 CATCCTGACCTCCTCCAGTGAGG - Intronic
929603155 2:43217598-43217620 TATCCTGCCCCACTGCTGTGTGG + Intergenic
929867426 2:45730070-45730092 AGTGCTGCCCTGCTAATGTGTGG - Intronic
931904007 2:66822474-66822496 AGGCCAGCCCTGCTGCTGTGCGG - Intergenic
933275958 2:80284662-80284684 AATCCTGCCCTGCCTCTATTAGG - Intronic
933973518 2:87489495-87489517 AATCACGCCATCCTCCTGTGTGG + Intergenic
934539000 2:95159405-95159427 AGTCGGTCCCTGCTCCTGTGAGG - Exonic
935023793 2:99256895-99256917 AATCCTCCACTGGCCCTGTGAGG + Intronic
937002371 2:118479276-118479298 CAACCTGCCCTGCCACTGTGGGG + Intergenic
944538118 2:200731126-200731148 AAGCCTGCAGAGCTCCTGTGGGG + Intergenic
945421792 2:209647080-209647102 ACTCCTGCTCTGGTCATGTGAGG - Intronic
948673837 2:239585346-239585368 ATTCCTTGCCTGCTTCTGTGGGG - Exonic
1169216518 20:3797382-3797404 CACCTTGCCCTGCTCCTGAGAGG + Intronic
1169672701 20:8120897-8120919 ACTTCTGCCCTGCTCCAGTGTGG - Intergenic
1172054346 20:32143617-32143639 AAGCCGGACCAGCTCCTGTGAGG - Intronic
1172090694 20:32430011-32430033 GACCCTGCCCCGCTCCTGAGAGG + Exonic
1172502644 20:35437804-35437826 AATCCTGGCCTGGTCCCCTGGGG + Exonic
1174101767 20:48132122-48132144 AATCCAGCCCTGCCCTTTTGGGG + Intergenic
1174428476 20:50450051-50450073 CAGCCAGCCCAGCTCCTGTGTGG + Intergenic
1175458965 20:59136564-59136586 AAACCTGCCATGATCCTTTGCGG + Intergenic
1181116543 22:20635456-20635478 TACCCTGCCCTGGTGCTGTGGGG - Intergenic
1181163162 22:20969302-20969324 AATCCAGCCCTGCCCCTTTCTGG + Intronic
1182551258 22:31102005-31102027 AAGTCTGCCAGGCTCCTGTGTGG + Intronic
1183989067 22:41585991-41586013 GATCCAGTCCTGCTTCTGTGGGG - Intronic
1184445743 22:44545827-44545849 AATCCTGCCCTGATTCTCTGGGG + Intergenic
1184487162 22:44786697-44786719 AATCTTGCCCAGCTGCAGTGAGG - Intronic
953729895 3:45438385-45438407 AAAGCTGCCCAGCTCCTGGGTGG - Intronic
954708871 3:52495260-52495282 AATCCTGGCGGGTTCCTGTGGGG + Intergenic
959890490 3:111549659-111549681 AATCCACCACTGATCCTGTGGGG - Intronic
960949537 3:122990240-122990262 GATCCTGCCCTCCACCTTTGAGG + Intronic
961173705 3:124817154-124817176 ATTCCCGCCCTGCCACTGTGAGG + Intronic
962341672 3:134590879-134590901 AGGTCTGCCCTGCTCCTGTCTGG + Intergenic
963584264 3:147164333-147164355 AAAACTGACCTGCTCCTCTGAGG - Intergenic
964237852 3:154555052-154555074 GATGCTGCCCTGCTCCATTGGGG - Intergenic
965614208 3:170576587-170576609 AATCCAGCCATGCTCATGTGAGG - Intronic
968567143 4:1318962-1318984 CTTCCTGTCCTGTTCCTGTGTGG - Intronic
968695560 4:2024334-2024356 ATTCCTTCCCTGCTCCAATGGGG + Intronic
969463875 4:7343429-7343451 AAGCCTGCCCTGTTCCAGTGTGG - Intronic
969465782 4:7355571-7355593 AGTCCTTCACTTCTCCTGTGTGG + Intronic
969588376 4:8107537-8107559 GGTCCTGCCCGGGTCCTGTGTGG - Intronic
972283293 4:37623696-37623718 ATGCCTGCCGTACTCCTGTGTGG - Intronic
972820425 4:42695481-42695503 AATCGTGCCCAGCTTCTTTGAGG + Intergenic
972922292 4:43959180-43959202 AATCCTGCCCTTGACATGTGGGG + Intergenic
975335117 4:73167592-73167614 AAACATTCCCTGCTCCTCTGAGG + Intronic
975859478 4:78661310-78661332 AATTCTGCCCAGCTCCTCTTGGG + Intergenic
980167696 4:129249347-129249369 AATCCTTCTCATCTCCTGTGAGG + Intergenic
982341347 4:154302501-154302523 AACCCTGCCTATCTCCTGTGTGG + Intronic
982632271 4:157845782-157845804 AATTCTGCCCTCATTCTGTGAGG + Intergenic
985074210 4:186196502-186196524 GCTCCTGCCTTGCTCTTGTGGGG - Intronic
985509652 5:305614-305636 CATCCTTCCCTGCTGGTGTGTGG + Intronic
985581308 5:696525-696547 AACCCTAACCAGCTCCTGTGTGG + Intergenic
985595937 5:787857-787879 AACCCTAACCAGCTCCTGTGTGG + Intergenic
985697638 5:1349981-1350003 TCTCCTGCCCCGCTCATGTGGGG + Intergenic
986326833 5:6682132-6682154 GAGGCTGCCCTGCTCCTGTGAGG - Intergenic
990056365 5:51584766-51584788 ACCACTGCCCTGCTCCCGTGGGG - Intergenic
990678539 5:58215803-58215825 TGTCCTTCCATGCTCCTGTGGGG + Intergenic
997441052 5:133908893-133908915 CACCCAGCTCTGCTCCTGTGTGG - Intergenic
997613142 5:135229221-135229243 CCTCCTGCCCTGATCCTGTATGG + Intronic
998103171 5:139451053-139451075 AATCCTGACAGGCTCCTCTGAGG - Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999432521 5:151536511-151536533 ATTCCTGCCCTGCTGCTGCAGGG - Intronic
1001599628 5:172920460-172920482 CATCCTGTCCTCCTCCTGCGGGG - Intronic
1001700915 5:173705917-173705939 CCTCCTGCCCTGCTCCCATGGGG + Intergenic
1001707674 5:173753571-173753593 AAACCTGAGCTGCTCCTGAGAGG + Intergenic
1006387198 6:33737852-33737874 GATCCAGCTCTGCTCCAGTGTGG + Intronic
1007076635 6:39072475-39072497 AGTCCTGCTCTGCCTCTGTGAGG + Intronic
1007321631 6:41032311-41032333 CATCCTTTCCTGCTTCTGTGGGG + Intronic
1007331469 6:41113284-41113306 AATCCTGCGTTGTTTCTGTGAGG - Intergenic
1007459958 6:42010580-42010602 AACCCGGCCCTGCTGCAGTGTGG - Intronic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1008486988 6:52047236-52047258 AATCGTGCCCTGCCTCTATGAGG - Intronic
1015634920 6:135265573-135265595 AATCCTGCACTGATCATGTGAGG - Intergenic
1015820660 6:137257210-137257232 GTTCCTGCCCTGCTGCAGTGTGG + Intergenic
1017886874 6:158606980-158607002 TCTCCTTTCCTGCTCCTGTGAGG + Intronic
1019451705 7:1102036-1102058 CATGCTGCCCAGCCCCTGTGGGG - Intronic
1022415293 7:30172075-30172097 GAACCTGCCCTACTCCTTTGGGG - Intergenic
1022592509 7:31679138-31679160 ACTCCTGGGCTGCTCCTATGTGG + Intergenic
1022818917 7:33939462-33939484 AATCCTGCCCTGCTCTAAGGTGG + Intronic
1023585033 7:41720264-41720286 AAATCTCCACTGCTCCTGTGAGG + Intergenic
1024517791 7:50274568-50274590 ACTCCTGCCTTGCTGCTGAGGGG - Intergenic
1029471828 7:100759558-100759580 AGTCGTGGTCTGCTCCTGTGTGG + Intronic
1034538658 7:151742004-151742026 ATACCTGCCCTGCTCATGTGTGG - Intronic
1036289520 8:7475118-7475140 ACACCTGCCCTGCTCCTGCCTGG - Intergenic
1036331954 8:7836413-7836435 ACACCTGCCCTGCTCCTGCCTGG + Intergenic
1038881443 8:31618074-31618096 AATCCTGCCCTCTTCCTGGAAGG + Intergenic
1042910860 8:73824794-73824816 AATGCTGCTCACCTCCTGTGTGG + Intronic
1043403179 8:79903662-79903684 AAGCCTGTCCTGGTCCTGAGAGG + Intergenic
1044719266 8:95130090-95130112 AATCCTGTGTGGCTCCTGTGTGG + Intergenic
1045545312 8:103123092-103123114 GATCCTGCCCCTCTCCTGTATGG + Intergenic
1046393078 8:113602390-113602412 ATTCCTGCACTCCTCCTTTGAGG + Intronic
1049581207 8:143411877-143411899 ACTCCCTCCCTGCTCCTGCGGGG - Intergenic
1050566507 9:6889733-6889755 AATCCTTCTCTGTTCCTTTGGGG + Intronic
1052264414 9:26554691-26554713 TTCCCTTCCCTGCTCCTGTGTGG + Intergenic
1056487520 9:87073746-87073768 GCTCCAGCCCTGCTCCTGTCTGG - Intergenic
1056555826 9:87686387-87686409 ACTGCTGCCCTGCACGTGTGAGG + Intronic
1057818582 9:98314211-98314233 AATGCAGCCCAGCTCCTGGGTGG - Intronic
1057962744 9:99472192-99472214 AATCCTGCTCTGCTAGTGTGAGG - Intergenic
1060235313 9:121858611-121858633 AATCCTGCCCTACACCCATGTGG - Intronic
1061240044 9:129364677-129364699 ATTCCTGTCCTGATCGTGTGTGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062085312 9:134645185-134645207 ACTCCTGGGCTGCTCCTGCGGGG + Intronic
1185465309 X:350983-351005 ACTCCCGCCCTGCACCTGTCAGG - Intronic
1186126782 X:6422858-6422880 TGTCCTGCCCTTCTCCTGAGAGG - Intergenic
1188284558 X:28312077-28312099 TCTCCTGCCCTGCTCGTGTCTGG + Intergenic
1191802014 X:65092093-65092115 CATCCTGCTCTGGTCTTGTGAGG + Intergenic
1194696062 X:97052550-97052572 AATACAGCTCTGCTCCTGTCTGG - Intronic
1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG + Intronic
1199715990 X:150507736-150507758 AAGCCTGCCCTGCCCCGGCGTGG + Intronic
1200009283 X:153109103-153109125 AAGCCTGGCCTGCTCCTGGACGG + Intergenic
1200030317 X:153290819-153290841 AAGCCTGGCCTGCTCCTGGACGG - Intergenic
1201608379 Y:15813108-15813130 TGTCCTGCCCTTCTCCTGAGAGG - Intergenic