ID: 1144736413

View in Genome Browser
Species Human (GRCh38)
Location 17:17557991-17558013
Sequence CTGCAGTAGCTTCCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144736408_1144736413 0 Left 1144736408 17:17557968-17557990 CCAGAACCCCAAGAGCTTGGCAC 0: 1
1: 0
2: 0
3: 7
4: 159
Right 1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 23
4: 246
1144736411_1144736413 -8 Left 1144736411 17:17557976-17557998 CCAAGAGCTTGGCACCTGCAGTA 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 23
4: 246
1144736409_1144736413 -6 Left 1144736409 17:17557974-17557996 CCCCAAGAGCTTGGCACCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 250
Right 1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 23
4: 246
1144736410_1144736413 -7 Left 1144736410 17:17557975-17557997 CCCAAGAGCTTGGCACCTGCAGT 0: 1
1: 0
2: 1
3: 22
4: 195
Right 1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 23
4: 246
1144736406_1144736413 26 Left 1144736406 17:17557942-17557964 CCATGCTTGGCTGGCTGGGCTAA 0: 1
1: 0
2: 1
3: 22
4: 290
Right 1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 23
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144736413 Original CRISPR CTGCAGTAGCTTCCTGCTGC AGG Intronic
900177642 1:1297917-1297939 CTGCAGGAGCTGCATGCTGCAGG - Exonic
900875693 1:5340966-5340988 TGGCAGCAGCTTCCAGCTGCTGG + Intergenic
901494979 1:9615614-9615636 CATCAGGAGCTTCCTGCAGCGGG + Intergenic
901620135 1:10578230-10578252 TTTCAGTAGCTGCCTGCTGTGGG + Intronic
901659575 1:10790004-10790026 CCCCAGTGGCCTCCTGCTGCTGG + Intronic
903189509 1:21648935-21648957 CTGCAGTACCCCCCAGCTGCTGG - Intronic
903790733 1:25891216-25891238 CTGCCTTAGCCTCCTGCAGCTGG - Intronic
903928422 1:26848527-26848549 CAGCAGTAGCTTTCCCCTGCTGG + Intronic
906740804 1:48181973-48181995 CTGCACTCACTTCCTGCTGTTGG + Intergenic
907863980 1:58381019-58381041 CTGCATTAGTTTGCTGATGCCGG - Intronic
909747259 1:79113108-79113130 CTGGAGTTGGTTCCTGCTGGTGG - Intergenic
911144343 1:94538396-94538418 CAGCAGTAGTGTCCTGCGGCTGG + Intronic
912542951 1:110430821-110430843 CAGCAGTAGCTTCCTCCTCTGGG - Intergenic
915003125 1:152611831-152611853 CTGCAGAAGCCTCTTGCTGAAGG - Intergenic
915619830 1:157074418-157074440 CTCCAGTAGCTTCCTGTAGGTGG - Intergenic
916991495 1:170250302-170250324 CCGGAGTAGGTTGCTGCTGCTGG + Intergenic
917281535 1:173381681-173381703 CTGCTGTAGCTACTTCCTGCTGG - Intergenic
919420176 1:197360315-197360337 CTGCTGTAACTTTCTTCTGCGGG + Intronic
919830607 1:201538324-201538346 CTGCAGTAGGTTCTGGCTGAGGG + Intergenic
923412548 1:233724737-233724759 CTGGAGTTTCTTCCTACTGCTGG - Intergenic
924164214 1:241265178-241265200 CTGCAGTGGCCTCCTCCTGTAGG + Intronic
1064847275 10:19669100-19669122 CTCCAGTATCTTCCAGCTTCCGG - Intronic
1067087336 10:43249836-43249858 CTGCAGCAGCTTCCTGGCGTGGG - Intronic
1067814095 10:49458941-49458963 CTGCAGTATCTCCCTGGTGCTGG + Exonic
1067824882 10:49563689-49563711 CTGCAGTGGATTTCTTCTGCAGG - Intergenic
1068368464 10:56083262-56083284 CTGGAGCAGGTTGCTGCTGCTGG + Intergenic
1068404597 10:56573394-56573416 CTGCTGTAGCTACTTCCTGCTGG + Intergenic
1071182212 10:82999767-82999789 CTGGAGGAGTTACCTGCTGCAGG + Intergenic
1072370670 10:94763911-94763933 CTGGAGTTTCTTCCTTCTGCTGG + Intronic
1072370751 10:94764576-94764598 CTGCTGTAGCTACTTCCTGCTGG + Intronic
1075122904 10:119677201-119677223 CTGCTGTGGCTTCTGGCTGCTGG - Exonic
1075730041 10:124630609-124630631 CTGGAGTACCTTCCCGCTCCTGG - Intronic
1076881236 10:133240173-133240195 CTGCGGGAGCTTCCTGCTGCGGG + Exonic
1077542063 11:3151411-3151433 CTGCAGTTTCTTCATGCTGGTGG - Intronic
1078646001 11:13141918-13141940 CTGCTTTTGCTTCCTGCAGCTGG - Intergenic
1082796465 11:57381456-57381478 CAGGAGTAGCCTCCTGCTGGTGG + Intergenic
1083528943 11:63398671-63398693 CAGCAGTGGCTGCCTGGTGCAGG - Intronic
1084029987 11:66475717-66475739 CTGCATTTGCCTCCTGCCGCTGG - Exonic
1084577729 11:70000731-70000753 CTGCAGGAGCTTCCAGTTGCGGG - Intergenic
1084801294 11:71545898-71545920 CTGCAGTTGGTTCCTGCTGGTGG + Intronic
1087874753 11:103342403-103342425 CTGGAGCAGCTTGCTGCAGCTGG - Intronic
1089065631 11:115659883-115659905 CTGCACCAGCTTCCTGCACCCGG - Intergenic
1089665144 11:120013550-120013572 CTGCAGGAGCTTCCTGCCCGGGG + Intergenic
1093627552 12:21367262-21367284 CTGCAGTAGCTTCCTGAGAATGG - Intronic
1094254899 12:28412496-28412518 CTGGAGTTGGTTCCTGCTGGTGG + Intronic
1095952870 12:47791092-47791114 CAAAAGGAGCTTCCTGCTGCAGG + Intronic
1096024556 12:48350218-48350240 CTGCAGAAACTTCCTTTTGCAGG - Exonic
1096799392 12:54099662-54099684 CTGCAGTAGCTGCACGCTGAGGG + Intergenic
1097337775 12:58403690-58403712 CTGTGGTAGCTTACTTCTGCAGG + Intergenic
1098750983 12:74292962-74292984 CTGCATGGGCTTCCTGCTGTGGG + Intergenic
1098951733 12:76646201-76646223 CTGCACTAGGCTCATGCTGCTGG - Intergenic
1100209489 12:92387136-92387158 CTGGAGTTGGTTCCTGCTGGTGG - Intergenic
1100210549 12:92394174-92394196 CTGGAGTTGGTTCCTGCTGGTGG - Intergenic
1100277310 12:93082788-93082810 CTACAGTAGCTTCCGCTTGCTGG - Intergenic
1101787402 12:107896900-107896922 CTGCAGTTGCTTCTAGCTGAGGG + Intergenic
1102011561 12:109622275-109622297 CTGCAGTCCCTTCCTGGGGCGGG - Intergenic
1103608594 12:122106968-122106990 CTGCACTAGCTTCCGGGTGCAGG + Intronic
1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG + Intronic
1104502244 12:129297369-129297391 CCGAAGTTGCTTTCTGCTGCTGG - Intronic
1106419800 13:29576854-29576876 CTGCAGCAGGTTCCTACAGCCGG + Intronic
1107080137 13:36365985-36366007 CTGCAGTAGCTTCCTCTCTCTGG + Intronic
1107815784 13:44243278-44243300 GTGCAGGTGCTTCCTGCGGCAGG + Intergenic
1108666782 13:52640692-52640714 GTGAAGTTGCTTACTGCTGCGGG + Intergenic
1109740112 13:66542529-66542551 CTGCATGAGTTTCCAGCTGCTGG + Intronic
1110148343 13:72221280-72221302 CTGCTGTAGGTCCCTGCTGTGGG - Intergenic
1111125408 13:83907418-83907440 CTGCGTGGGCTTCCTGCTGCGGG - Intergenic
1112655974 13:101452848-101452870 CTTCAGGAACTTCTTGCTGCTGG + Exonic
1113527242 13:110990211-110990233 CTGCAGGAACTGCATGCTGCAGG + Intergenic
1113713328 13:112485898-112485920 CTGCAGGAACTGCATGCTGCAGG - Exonic
1117437902 14:55734853-55734875 CTGCTGAAGCTTCCATCTGCAGG - Intergenic
1117662571 14:58022534-58022556 CTGCTGGAGCTCCTTGCTGCTGG - Intronic
1118303591 14:64636276-64636298 CTGCAGTAGCTCCCTACTGGAGG + Intergenic
1118392653 14:65308551-65308573 CAGCAGTGGTTTCCTGCTCCAGG - Intergenic
1118995408 14:70831215-70831237 ATTCAGTAGCCTCGTGCTGCAGG + Intergenic
1119331835 14:73800655-73800677 CTGGAGTCCTTTCCTGCTGCAGG + Intergenic
1120935700 14:89893175-89893197 ATGCAGCAGCTTCCTGACGCTGG - Intronic
1121560805 14:94873864-94873886 GTGCAGTAGCTTCCTGTTACTGG - Intergenic
1121708580 14:96019882-96019904 CTGCAGCTTCTTCCTGCTGCTGG - Intergenic
1121820568 14:96962469-96962491 CAGCAGTTCCTTCCTGCAGCCGG - Intergenic
1122024805 14:98867935-98867957 CTGGCATAGCCTCCTGCTGCAGG - Intergenic
1122160241 14:99778635-99778657 CTGCAGTAGCTTCCTGAGAAAGG + Intronic
1124635259 15:31361035-31361057 CAGCTGCAGCCTCCTGCTGCAGG + Intronic
1124817267 15:33007312-33007334 CTGCAGTAACCCCCTGCTTCAGG - Intronic
1124920225 15:34018673-34018695 CTCCAGTGGGTTGCTGCTGCTGG + Intronic
1125593593 15:40870907-40870929 CAGCTGTAGCTTCCTGCAGAGGG + Intergenic
1126655003 15:50967543-50967565 CTGTATTGGTTTCCTGCTGCAGG - Intronic
1127785348 15:62350577-62350599 CTTCATTAGCTCCCTGCCGCAGG - Intergenic
1128246479 15:66136049-66136071 CTGCATTATCTCCCTGCAGCTGG - Intronic
1129182811 15:73887640-73887662 CTGCAGGAACTTCCAGGTGCTGG + Exonic
1129394074 15:75234806-75234828 GTGCAGTGGCTTCTGGCTGCTGG - Intergenic
1130881010 15:88055984-88056006 ATGCAGTACTATCCTGCTGCCGG - Intronic
1131889506 15:96957103-96957125 TTGCAGAGGCTTCCTGCTGTTGG + Intergenic
1132058536 15:98670927-98670949 CTCCAGTAGCTTCCTGTTGTAGG + Intronic
1132307146 15:100824558-100824580 ATGCAGAAGGTTCCTGCTTCTGG + Intergenic
1132380419 15:101362347-101362369 CTGCAGCAGCCTCCTGCTTCTGG - Intronic
1132985390 16:2764041-2764063 ATGCAGTAGCATCCTCCTGAGGG - Exonic
1135648588 16:24185779-24185801 CTGCAGCTGCGTCTTGCTGCTGG + Intronic
1136223891 16:28846074-28846096 CGGCCGGACCTTCCTGCTGCAGG - Exonic
1138370161 16:56520175-56520197 CTGCAGTAATTTACTCCTGCGGG + Exonic
1139440307 16:66963420-66963442 TTGCAGGAGAATCCTGCTGCTGG + Intronic
1140118303 16:72061790-72061812 CTGCATTTGATTCCTGGTGCAGG - Intronic
1141471256 16:84240110-84240132 CTGCTGCTTCTTCCTGCTGCTGG - Intergenic
1143710321 17:8730013-8730035 CTGCTGTGCCTTCCTGCTGAGGG - Exonic
1143887743 17:10077769-10077791 CTGCAGTAGCTTCCTGAAAAAGG - Intronic
1143919407 17:10318948-10318970 CTGCTGTGGCTTCGTGCTGCAGG + Exonic
1143933113 17:10452099-10452121 CTGCCGTGGCTTCGTGCTGCAGG + Exonic
1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG + Intronic
1145722264 17:27083963-27083985 CGGCCGGACCTTCCTGCTGCAGG - Intergenic
1145930971 17:28685245-28685267 CCTCAGTAGCTTTCAGCTGCTGG - Intronic
1147256278 17:39184274-39184296 CTGCCGTTGCTCTCTGCTGCTGG - Intronic
1149213265 17:54327686-54327708 CTGGAGTTGGTTCCTGCTGGTGG - Intergenic
1155535228 18:26809825-26809847 CTGCAGTAGTGTCCTGCTTCTGG - Intergenic
1156149070 18:34222703-34222725 CTGCAGGAGCTTCCTTCCCCGGG - Intronic
1156152303 18:34256436-34256458 TTGCAGAAGCTTCCTGCTAAGGG - Intergenic
1156345248 18:36251407-36251429 CTGCAGTAGGTTTCTGCTAAAGG - Intronic
1157385680 18:47258696-47258718 TTGCAGTAACTTCCTGCTTGGGG + Intergenic
1157569446 18:48702941-48702963 CAGCAGAGGCTTCCTCCTGCTGG - Intronic
1160403514 18:78628886-78628908 CTTCAGTGGCTCCCTACTGCTGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161796881 19:6392410-6392432 CTCCAGTATCTTCCTCCTCCAGG - Intronic
1163221408 19:15924137-15924159 GGGCAGTAGCTTCTAGCTGCTGG - Intronic
1163426954 19:17245357-17245379 TTGCAGCAACTTCCTGCGGCCGG + Exonic
1165511560 19:36269268-36269290 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165512111 19:36271791-36271813 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165512659 19:36274290-36274312 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165513210 19:36276833-36276855 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165513765 19:36279386-36279408 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165514314 19:36281920-36281942 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165514868 19:36284459-36284481 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165515420 19:36286990-36287012 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165515970 19:36289528-36289550 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165516521 19:36292063-36292085 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165517073 19:36294591-36294613 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165517625 19:36297114-36297136 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165518178 19:36299649-36299671 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165518729 19:36302184-36302206 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165519277 19:36304714-36304736 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165519826 19:36307229-36307251 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165520379 19:36309760-36309782 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1167869598 19:52356948-52356970 CTGCAGTGGCTACTTGCTGGGGG + Intronic
1168230034 19:55025205-55025227 CTGCAGAACCTACCTGCTACCGG + Exonic
925253868 2:2465624-2465646 CGGCCGGAGCTCCCTGCTGCAGG + Intergenic
926887360 2:17610491-17610513 TTGCAAGTGCTTCCTGCTGCTGG - Intronic
927527536 2:23760106-23760128 CTGCAGTAACTTGCTTCAGCAGG - Intronic
927764554 2:25793306-25793328 CTGCAGTAGCTTCTCGTTGCTGG + Intronic
929142353 2:38677377-38677399 CTCCATGAGCTTCCTGCTGGTGG + Intronic
932365572 2:71150881-71150903 CTGCAGAAGCTGGCTGCAGCAGG + Intergenic
933940357 2:87239905-87239927 CTGCCTTAGATTCCTTCTGCAGG + Intergenic
935760962 2:106320262-106320284 CTGCAGTTGGTTCCTGCTGGTGG + Intergenic
936242511 2:110800244-110800266 CTGGAGTTGGTTCCTGCTGGTGG - Intronic
936352781 2:111725871-111725893 CTGCCTTAGATTCCTTCTGCAGG - Intergenic
938225239 2:129610071-129610093 TTGCAGTAGCTTCCAGCCCCAGG - Intergenic
938548874 2:132361283-132361305 CTGCAGTGCCTTCCTGGGGCAGG - Intergenic
939400209 2:141683118-141683140 CTGTATTAGGTTCCTGTTGCTGG - Intronic
940541439 2:155025133-155025155 CTGCAGTAACTTCCCCCTCCCGG - Intergenic
941243854 2:163072655-163072677 CTGCTGTAGCTACTTCCTGCTGG - Intergenic
943661914 2:190568063-190568085 CTGCAGTAGCTTCCTGTAAAAGG - Intergenic
944530146 2:200659639-200659661 TTGCTCTAGCTTTCTGCTGCCGG + Intronic
945279342 2:208020898-208020920 CAGCAGTAGCTTGATGCTGCTGG + Intronic
946068973 2:217014848-217014870 CTGCAGCTTCTTTCTGCTGCTGG - Intergenic
946213361 2:218164827-218164849 CTACAGTGGCATCCTGCTGTTGG - Exonic
947014086 2:225598878-225598900 CTGGAGAAGCCTCATGCTGCAGG - Intronic
947504968 2:230701256-230701278 CTTCTGTAGCTTTCTGATGCAGG + Intergenic
947708960 2:232299231-232299253 CTGTAGTGGCTGCCTCCTGCAGG + Intronic
1170759308 20:19235723-19235745 CTGCAGTAGCTTTGAGATGCTGG + Intronic
1171270337 20:23812120-23812142 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1171425335 20:25045249-25045271 GTTCAGTACCATCCTGCTGCTGG - Intronic
1171797039 20:29574678-29574700 CTGCAGTAGCTGCACGCTGAGGG - Intergenic
1171851215 20:30309484-30309506 CTGCAGTAGCTGCACGCTGAGGG + Intergenic
1172023996 20:31935647-31935669 CAGCAGTCACATCCTGCTGCAGG - Intronic
1172664753 20:36591299-36591321 CTTCAGCAGCTTCCAGCTGCTGG + Exonic
1173381994 20:42553782-42553804 CTGCAACAGCCTCCTGCTTCAGG - Intronic
1174259188 20:49281188-49281210 CTGCCGTAGGGTGCTGCTGCTGG + Intergenic
1174754631 20:53145560-53145582 CAGCAGGAGCTTCCTTGTGCTGG + Intronic
1175742272 20:61428087-61428109 CAGCAGCTGCTTCCTGCTGGGGG - Intronic
1176515069 21:7777740-7777762 CTGAAGCAGCTTCCAGCTCCGGG - Intergenic
1177009761 21:15717766-15717788 TTTCAGTACCTTCCTTCTGCAGG + Intergenic
1178502709 21:33139213-33139235 CTGCTGTTGCTTTCTTCTGCGGG - Intergenic
1178649097 21:34407752-34407774 CTGAAGCAGCTTCCAGCTCCGGG - Intronic
1179243896 21:39613456-39613478 ATGCAGAAGCTGCCTGCCGCAGG - Intronic
1181351085 22:22258382-22258404 CTCCAGTTGCTGCCTTCTGCCGG + Intergenic
1181683247 22:24510661-24510683 TTGCAGTGACTTCCCGCTGCTGG + Intronic
1182045500 22:27270929-27270951 CTGCAGGAGCTTGCTTCTCCCGG - Intergenic
1182472537 22:30557308-30557330 CTTCACTAGTTTCCTGCTGCTGG - Exonic
1182587137 22:31350599-31350621 CTGCATCTGCCTCCTGCTGCTGG + Intergenic
950674451 3:14546159-14546181 CTGCAGTAACTGCCTGGAGCTGG + Intergenic
953864313 3:46571228-46571250 CTGCAGCCTCTACCTGCTGCTGG - Intronic
954280793 3:49576228-49576250 CTGCAGCAGCATCCTGCTTGGGG + Intronic
959049613 3:101512636-101512658 CAGCAGCAGCTACCTGCTGAGGG + Intronic
959391773 3:105783774-105783796 CTGCTGTAGCTACCAGTTGCAGG - Intronic
959919161 3:111851701-111851723 TTGCACTGGCTTCTTGCTGCGGG - Intronic
960388102 3:117045335-117045357 CTGCAGCAGCTCACAGCTGCAGG + Intronic
960820668 3:121727423-121727445 CTCCAGTATCTTCCTGCTTTTGG - Intronic
964487144 3:157197775-157197797 CTTCAGTAGCTTCTTGCAGGAGG + Intergenic
966017833 3:175164989-175165011 GTGCAGTAGATACCTGCTGAAGG - Intronic
968467949 4:762375-762397 CTGCCCTGGCTTCCAGCTGCTGG - Intronic
969184763 4:5467043-5467065 CTACACAAGCTTCCTGCTGTAGG - Intronic
970657325 4:18246038-18246060 CTGGAGTTGGTTCCTGCTGGTGG + Intergenic
971216387 4:24665935-24665957 CTGAAGTAGCTCCCAGCTTCAGG - Intergenic
971323034 4:25620721-25620743 CTGTGGTAGCTCCCTCCTGCAGG - Intergenic
974972068 4:68842774-68842796 CTGGAGTTTCTTCCTGCTGGTGG + Intergenic
975008827 4:69323359-69323381 TTTCAGTAGCATCCTGCAGCTGG + Intronic
979061347 4:116066315-116066337 AGGAAGTAGCTTGCTGCTGCAGG + Intergenic
981261788 4:142729380-142729402 TTGCAGCAGATTCCAGCTGCAGG - Intronic
981424255 4:144585037-144585059 TTGCAATTGCTTCTTGCTGCAGG + Intergenic
984095597 4:175428801-175428823 CTGGAGTTGCTTCCTTCTGGTGG - Intergenic
985689256 5:1298185-1298207 CAGCCGTGCCTTCCTGCTGCAGG + Intergenic
986628711 5:9748065-9748087 CTGAAGCAGTTTCCTTCTGCTGG + Intergenic
987167899 5:15220075-15220097 CTGCAGGAGCTGACTGCTGGAGG - Intergenic
990491314 5:56305669-56305691 CAGCAGCAGCTTCCTGATCCTGG + Intergenic
991465217 5:66905337-66905359 CTGCCTTGGGTTCCTGCTGCTGG - Intronic
998712869 5:144847112-144847134 CTGGAGTGGGTTGCTGCTGCTGG + Intergenic
1002642331 5:180636073-180636095 CTGTAGGAGCTTCCTCCTGAAGG + Intronic
1002943556 6:1739448-1739470 CTGCAATAGCATCCTGCTATAGG + Intronic
1005705229 6:28444653-28444675 CTGCAGTTGCTTCTTCCTTCTGG + Intergenic
1007472958 6:42102747-42102769 CTGAAGAAGCTTGCTGCTGTTGG - Exonic
1009691028 6:67031908-67031930 CTGGAGTTTCTTCCTTCTGCGGG - Intergenic
1011284164 6:85706111-85706133 CTGCAGCTCCTTCCTGCTGCTGG + Intergenic
1012245860 6:96924890-96924912 CCGCAGTAGCTTCGCTCTGCTGG - Exonic
1012793810 6:103734752-103734774 CTGCAGTAGCAGCCTGGAGCTGG + Intergenic
1015206739 6:130649202-130649224 CTGCAGTCGGCTCCTGCTGCAGG + Intergenic
1016872379 6:148831218-148831240 TTACAGTAGCTTCCAGATGCTGG - Intronic
1017182293 6:151564927-151564949 CTGCAGTGGGGCCCTGCTGCTGG + Intronic
1019478338 7:1254856-1254878 CTGCAGAAGCCTCTGGCTGCAGG - Intergenic
1019800500 7:3084767-3084789 CTGCAGGAGAGTCCGGCTGCTGG + Intergenic
1020256622 7:6506038-6506060 CTGCAGTCTCCTCCTGCTCCGGG - Intronic
1022093982 7:27126816-27126838 ATTCATTAGCTTCATGCTGCAGG - Intronic
1022766879 7:33423146-33423168 CTACAGAAGCTACCTGCTGAGGG + Intronic
1023735496 7:43232416-43232438 CTGCATTAGCTTGCTTTTGCTGG + Intronic
1023942149 7:44776079-44776101 CTGCTTTTCCTTCCTGCTGCTGG + Intergenic
1029911425 7:104153241-104153263 CTGCAGTAGATACCTACTTCAGG - Intronic
1030420178 7:109299515-109299537 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1031941344 7:127792808-127792830 CTGAACTCGCTTGCTGCTGCTGG + Intronic
1033303696 7:140208989-140209011 CTGCACTGGCTCCCTGCTTCTGG - Intergenic
1034579307 7:152028731-152028753 CTGCTGTAGCTACTTCCTGCTGG + Intronic
1034912789 7:155011310-155011332 CTGGAGTAACTTCCTGTGGCAGG - Intergenic
1036799728 8:11781378-11781400 CTGCAGTAGCCTCTTGCTGCTGG - Intronic
1040559064 8:48507723-48507745 CTGGAGTTGCTTCCTTCTGGTGG - Intergenic
1040999487 8:53436824-53436846 CTGGAGTTTCTTCCTTCTGCTGG + Intergenic
1040999569 8:53437493-53437515 CTGCTGTAGCTACTTCCTGCTGG + Intergenic
1041000259 8:53442539-53442561 CTGGAGTTTCTTCCTTCTGCTGG + Intergenic
1041002811 8:53468373-53468395 CTGCTGTAGCTACTTCCTGCTGG - Intergenic
1042498853 8:69487112-69487134 CTGCAGTAGCTTCCTAATTATGG - Intronic
1043741017 8:83811460-83811482 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1044004569 8:86925790-86925812 CTGGAGTTGGTTCCTGCTGGTGG + Intronic
1044036322 8:87308000-87308022 TTGCATTAGCTTCCTTCTCCAGG + Intronic
1046122966 8:109867856-109867878 CTGCAGAGATTTCCTGCTGCAGG + Intergenic
1046797436 8:118388199-118388221 CAGCAGTAACTCCTTGCTGCGGG - Intronic
1047734103 8:127750705-127750727 CTGCAGTATCTTCTCCCTGCAGG + Intergenic
1047911706 8:129536841-129536863 CTGAAGTACGTTCCTGCTTCTGG - Intergenic
1053788989 9:41672766-41672788 CTGCAGTAGCTGCTCGCTGAGGG + Intergenic
1054177271 9:61884111-61884133 CTGCAGTAGCTGCTCGCTGAGGG + Intergenic
1054475921 9:65573002-65573024 CTGCAGTAGCTGCTCGCTGAGGG - Intergenic
1054660262 9:67696694-67696716 CTGCAGTAGCTGCTCGCTGAGGG - Intergenic
1056369851 9:85942639-85942661 GTCCAGTGGCTTCCTGTTGCAGG + Intronic
1056801561 9:89695573-89695595 CTGCAGCTGCTTCCTGCTGCAGG + Intergenic
1057207164 9:93180551-93180573 CTGCAGTGTCTTCCTGCTGTGGG - Intergenic
1057275588 9:93674546-93674568 CTGCTGTAGCTTCCTCCAGGTGG + Intronic
1060246241 9:121948834-121948856 CTGCACTAGCTTCCTGCAGTGGG - Intronic
1060677360 9:125527697-125527719 CTACAGTAACTTCCTCCTGCTGG + Intronic
1062128170 9:134877593-134877615 CAGCAGTGGCTTCATGTTGCCGG - Intergenic
1062206567 9:135340957-135340979 CTGCAAGAGCTTTCTGCTGATGG - Intergenic
1194155962 X:90389349-90389371 CTGGAGTTGGTTCCTGCTGGTGG + Intergenic
1195950232 X:110263425-110263447 ATGCAGTAGCTCACAGCTGCAGG - Intronic
1196668983 X:118346135-118346157 CTGCTGTAAATTGCTGCTGCGGG + Exonic
1197078862 X:122388306-122388328 CTGCAGTTTCTTCCTTCTGGTGG + Intergenic
1197821196 X:130542531-130542553 CTGAAATAGCTTCCTGCTATGGG - Intergenic
1197863759 X:130996993-130997015 CTGCATTTGTTTCCTGCGGCTGG - Intergenic
1199615118 X:149649952-149649974 CTGGAGGGGCTGCCTGCTGCTGG - Intergenic
1199635499 X:149808361-149808383 CTGGAGGAGGTGCCTGCTGCTGG + Intergenic
1200921265 Y:8615511-8615533 CTGTAGTCGTGTCCTGCTGCAGG - Intergenic
1201263860 Y:12187175-12187197 CTGGAGTTGGTTCCTGCTGGTGG - Intergenic
1201711099 Y:16993047-16993069 CTGGAGTTGGTTCCTGCTGGTGG - Intergenic