ID: 1144738825

View in Genome Browser
Species Human (GRCh38)
Location 17:17569860-17569882
Sequence CAGGGCAAGCAGGGGGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 1, 2: 5, 3: 50, 4: 538}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144738813_1144738825 6 Left 1144738813 17:17569831-17569853 CCCTCGGGACAACACAGGGCATG 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG 0: 1
1: 1
2: 5
3: 50
4: 538
1144738807_1144738825 21 Left 1144738807 17:17569816-17569838 CCTCCCATGCTGGCTCCCTCGGG 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG 0: 1
1: 1
2: 5
3: 50
4: 538
1144738809_1144738825 18 Left 1144738809 17:17569819-17569841 CCCATGCTGGCTCCCTCGGGACA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG 0: 1
1: 1
2: 5
3: 50
4: 538
1144738810_1144738825 17 Left 1144738810 17:17569820-17569842 CCATGCTGGCTCCCTCGGGACAA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG 0: 1
1: 1
2: 5
3: 50
4: 538
1144738814_1144738825 5 Left 1144738814 17:17569832-17569854 CCTCGGGACAACACAGGGCATGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG 0: 1
1: 1
2: 5
3: 50
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144738825 Original CRISPR CAGGGCAAGCAGGGGGGCTC TGG Intronic
900066461 1:734064-734086 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
900105796 1:980510-980532 CAGGGCTATCGGGGGGCCTCTGG + Exonic
900477170 1:2881469-2881491 CAGGGCAGGGAGTGGGGATCCGG + Intergenic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
900673054 1:3867919-3867941 CAGGGCAGGCCAGGGGCCTCTGG - Intronic
900966602 1:5962967-5962989 CAGGGCATGCACGTGGTCTCAGG + Intronic
900987928 1:6083777-6083799 CAGGAGAAGCAAGGGGCCTCGGG - Intronic
901400962 1:9014921-9014943 CAGGGCCAGCATGGGGGCTTGGG - Intronic
901530702 1:9850831-9850853 CAGGACAAGCAAGGAGGCTGCGG + Intronic
901876112 1:12167809-12167831 CAGGGCAAGCGAGGGAGGTCTGG + Intronic
902048224 1:13541929-13541951 CAGGGGAAGCCTGGGGGCTCAGG - Intergenic
902234881 1:15050902-15050924 CAGGTCCAGCAGGGAGGCACCGG - Intronic
902242977 1:15100975-15100997 CAGGGAAATGAGGGGGGCTTAGG + Intronic
903170315 1:21548283-21548305 TGGGGCCAGCAGGGAGGCTCTGG + Intronic
903266235 1:22159771-22159793 GAGGGCAGGAAGAGGGGCTCTGG - Intergenic
903594626 1:24484650-24484672 CAGGCCAGGCAAGGTGGCTCAGG + Intergenic
903833562 1:26188950-26188972 CAAGGTCAGCTGGGGGGCTCTGG + Exonic
904398763 1:30241875-30241897 CAGGGTCAGCAGGGAGGCCCAGG + Intergenic
904443475 1:30548925-30548947 CTGGGCAAACAGGAGAGCTCTGG + Intergenic
904684461 1:32250444-32250466 CAGAGCAAACAGGGCCGCTCAGG - Intergenic
905396215 1:37668439-37668461 CAGGGGAAGATGAGGGGCTCAGG + Intergenic
905448565 1:38043264-38043286 CAGTGCATCCAGGGGGGCTTGGG + Intergenic
906144434 1:43551439-43551461 CAAGGCACGCTGGGGGGTTCTGG + Intronic
906318434 1:44802630-44802652 CAGGACAAGCAGGAGTTCTCTGG + Intronic
906447432 1:45914613-45914635 CAGGGCAAGCAGTTTGACTCAGG - Intronic
907407093 1:54260348-54260370 CAGGGCGAGCAGTGGGGCTCTGG + Intronic
907455277 1:54571789-54571811 CTGGGCAGGCAGGAGGGCCCTGG + Intronic
907848261 1:58229248-58229270 TAGGCCAAGCATGGTGGCTCAGG - Intronic
909415400 1:75400700-75400722 AAAGCCAAGCAGGTGGGCTCAGG - Intronic
910408437 1:86914706-86914728 GCGGGCAAGCAGGCGGGCGCGGG + Exonic
910644933 1:89504198-89504220 AAGGGCATGCATGGGAGCTCTGG - Intergenic
911636599 1:100242982-100243004 CAGGCCAGGCATGGTGGCTCTGG + Intronic
912866742 1:113264425-113264447 CAGGCCAAGCGAGGTGGCTCAGG + Intergenic
914446318 1:147753414-147753436 GAGGGGAGGCAGGGGTGCTCGGG - Intergenic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915465887 1:156097717-156097739 CAGGGCAGGCAGGGAGGCTAGGG - Intronic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915565711 1:156711488-156711510 CCGGGCAGGCTGGGGGGCCCTGG - Intergenic
915604099 1:156940013-156940035 CAGGTGAAGCTGGAGGGCTCTGG + Intronic
915899585 1:159836755-159836777 CAGGCCAGGCAGGGAGGATCTGG - Exonic
916029576 1:160864044-160864066 CAGAGGCAGCAGCGGGGCTCTGG + Intergenic
918223675 1:182458752-182458774 CAGGCCAGGCACGGTGGCTCAGG - Intronic
919298773 1:195734825-195734847 GAGGGCAACCAGGAGGGCGCTGG - Intergenic
919739787 1:200974635-200974657 CAGGGGAGGCTGGGAGGCTCAGG - Intronic
919881936 1:201906597-201906619 CAGGGCAGGCAGCAGGGCCCAGG + Intronic
920052091 1:203170491-203170513 CAGGGTAAGCAGGGAGGGTGAGG - Intronic
920215365 1:204358816-204358838 CAGGGCAGGGAAGGGGGCTGTGG - Intronic
920966276 1:210704060-210704082 CAGGGCAAGGAGAGGTGCCCTGG + Intronic
921145577 1:212352729-212352751 CAGGCCAGGCATGGTGGCTCAGG - Intronic
921355622 1:214281634-214281656 CAGGGCGTGCAGCGGGGCACCGG - Intronic
922179572 1:223223447-223223469 CGGGGTATGCTGGGGGGCTCTGG + Exonic
922336550 1:224623117-224623139 CAGGGCAGGTCAGGGGGCTCAGG - Intronic
922551365 1:226496971-226496993 GAGGGCAGGCAGGGGAGCTGTGG + Intergenic
922633612 1:227140949-227140971 CAGGGAAATCAGGAGGGATCAGG + Intronic
922699579 1:227750961-227750983 CATAGCAAACATGGGGGCTCTGG - Intronic
922711657 1:227838439-227838461 CAGAGCCAGCATGGGCGCTCTGG + Intronic
922751819 1:228073615-228073637 CGGGGCAGGCCGGGGTGCTCTGG + Intergenic
923059330 1:230456035-230456057 CAGGCCAGGCATGGTGGCTCAGG - Intergenic
1063145888 10:3294871-3294893 CAGGCCAGGCACGGTGGCTCAGG + Intergenic
1064635580 10:17362989-17363011 CAGGCCAGGCACGGTGGCTCAGG - Intronic
1065435659 10:25701832-25701854 CAGGCCACGCAGGGCTGCTCGGG - Intergenic
1065603858 10:27395590-27395612 TAGGCCAGGCAGGGTGGCTCAGG - Intergenic
1065745685 10:28839546-28839568 CTGGCCCAGCAGGGGAGCTCAGG - Intergenic
1065971617 10:30810297-30810319 CAGGGCAAGAAGAGGAGCCCTGG + Intergenic
1066462001 10:35620356-35620378 CAGGGAAAGCAGGTGGCATCAGG + Intergenic
1066526412 10:36284037-36284059 CAGGGCATGCAGGGGCGGGCGGG + Intergenic
1067256958 10:44650765-44650787 CAGGGGAAGGAGGAGAGCTCTGG + Intergenic
1069826927 10:71260272-71260294 GGAGGCAAGCAGGGGTGCTCGGG + Intronic
1069860132 10:71465602-71465624 CACGGCCAGCAGGGCTGCTCTGG - Intronic
1070825069 10:79386123-79386145 CAGGGAAAGCAGGGAGTCTGGGG - Exonic
1071208599 10:83312732-83312754 CAGGGCTGGCAGGGGGCCACTGG - Intergenic
1071249934 10:83807283-83807305 CAGGGCAAGCTGGTGGCCTCTGG - Intergenic
1073054137 10:100688357-100688379 GAGGGCAGGCAGGAGGCCTCCGG + Intergenic
1073054310 10:100689250-100689272 CAGGGCTATGAGGGGGGCACAGG + Intergenic
1073071846 10:100799181-100799203 CTGGGGGAGCAGTGGGGCTCAGG - Intronic
1073298509 10:102456131-102456153 CAGGGAATGCAGGCAGGCTCTGG + Intergenic
1073778226 10:106809441-106809463 CAGGGCTAGCAGGGGGATCCTGG - Intronic
1073842681 10:107516087-107516109 TAGGCCAAGCACAGGGGCTCAGG + Intergenic
1074362252 10:112832889-112832911 CAGGGTAGGCAGTGGGGCTTTGG + Intergenic
1074830278 10:117243011-117243033 CAGGCCAGGCACGGTGGCTCAGG - Intronic
1074869346 10:117564760-117564782 CAGGGGAGACAGGGGAGCTCAGG + Intergenic
1075176736 10:120171094-120171116 CAGGGCAAGCAGGAATGCTCAGG + Intergenic
1075710000 10:124525862-124525884 CAAGCCCAGCAGGGGGGTTCAGG - Intronic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1076050439 10:127329256-127329278 CAGGGGAAGCAGGGGAGGTCAGG - Intronic
1076189167 10:128470619-128470641 CAGGGGAAGCAGGCCTGCTCGGG - Intergenic
1076481653 10:130788969-130788991 CAGGGGAAGCAGGGGAGCAGGGG + Intergenic
1076481662 10:130788994-130789016 CAGGGGAAGCAGGGGAGCAGGGG + Intergenic
1076544685 10:131237280-131237302 CAGGGGAGGGAGGGGAGCTCAGG - Intronic
1076730262 10:132435808-132435830 GAGGGCACGCAGGGAGGCTGTGG - Intergenic
1076753487 10:132555424-132555446 AAGGGGAAGAAGGGGGGCTTGGG + Intronic
1076791626 10:132779719-132779741 CAGGACAAGCAGACGGGCGCCGG + Intronic
1076839547 10:133039297-133039319 CAAGGAAAACAGCGGGGCTCAGG - Intergenic
1076851638 10:133096165-133096187 CAGGCCCAGGAGGGGGCCTCGGG - Intronic
1076883416 10:133250767-133250789 CAGAGACAGCAGGGAGGCTCTGG + Intergenic
1076883542 10:133251285-133251307 CAGAGACAGCAGGGAGGCTCTGG - Intergenic
1076891861 10:133288617-133288639 CTGGGCAAGGAGGGGAGCTGGGG + Intronic
1076970990 11:132225-132247 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1077113195 11:870888-870910 CAGGGCCAGCAGCGGGGCCAGGG - Intronic
1077216983 11:1399021-1399043 CAGGGTTTGCAGGGGGGCTGCGG + Intronic
1077318271 11:1928827-1928849 CGGGGCAAGGTGGGGGGCTAAGG - Intronic
1077332090 11:1988257-1988279 CGGAGCCAGCAGGGGGGCTGTGG - Intergenic
1078602850 11:12748857-12748879 CAGGGGAGGCAGGGGGACTGGGG + Intronic
1079135912 11:17775919-17775941 CAGGGGAAGTAGAGGGGCTGGGG - Intronic
1079383787 11:19961024-19961046 CAGGAAAAACAGGGGGGCTCAGG - Intronic
1081812651 11:45922416-45922438 CAGGGCAGGTAGCGGGGCCCGGG + Intronic
1083592768 11:63904982-63905004 CAGGGCCGGCGGGGGGCCTCTGG + Exonic
1084422117 11:69065683-69065705 GAGGACAAGCAGGCTGGCTCTGG - Intronic
1084642738 11:70435534-70435556 CAGGACAAGCACGAGGCCTCAGG + Exonic
1084658192 11:70531537-70531559 CAGGGCAGGCAGGGTGACTGTGG + Intronic
1085512307 11:77094552-77094574 CAGGGACTGCAGGGGGACTCTGG + Intronic
1086270193 11:85053983-85054005 CAGGCCAGGCACGGTGGCTCAGG + Intronic
1086395651 11:86412734-86412756 CAGGGCATGCAGTGGGGGTGTGG + Intronic
1087811205 11:102610966-102610988 CAGGGAAAGCAGTGTGACTCGGG - Intronic
1087975117 11:104535807-104535829 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1089098467 11:115939654-115939676 CAGGACTGGCAGGGTGGCTCTGG - Intergenic
1089462080 11:118659380-118659402 CAGGTCCTGCAGGGGGGCCCAGG + Exonic
1089494431 11:118901191-118901213 CAGGGCCAGCAGGGATTCTCTGG - Exonic
1089631423 11:119787026-119787048 CAGGACAGGAAGGGGTGCTCCGG - Intergenic
1090650402 11:128801206-128801228 CAGCGCATGGAGTGGGGCTCAGG - Intronic
1202815071 11_KI270721v1_random:43433-43455 CGGAGCCAGCAGGGGGGCTGTGG - Intergenic
1091616650 12:2054756-2054778 GAGTGCAAACAGGGAGGCTCTGG - Intronic
1091740612 12:2958815-2958837 GAGGGCAAGCGAGGGGGCACTGG + Intergenic
1091789185 12:3261649-3261671 CAGTGCAAGCAGGGAGTTTCGGG + Intronic
1091828543 12:3533275-3533297 CAGAGCAAGCTGGGGAGCCCGGG + Intronic
1092181783 12:6451369-6451391 CAGGGGGAGCAGGCAGGCTCCGG - Exonic
1092238114 12:6822214-6822236 CAGGCCCAGCTGGTGGGCTCAGG - Intronic
1092872023 12:12813643-12813665 TAGGGCAAATAGGGGGTCTCAGG - Intronic
1092931170 12:13317254-13317276 CAGGGCAGGCAGGGCTGCTGAGG - Intergenic
1093506272 12:19870568-19870590 CAGAGCCAGCAGGGGGGTTGGGG + Intergenic
1093858746 12:24137349-24137371 TAGGCCAGGCAGGGTGGCTCAGG + Intergenic
1094730043 12:33164016-33164038 CACCTCAAGCAGGGGAGCTCAGG + Intergenic
1095416933 12:41987482-41987504 CATCCCAAGCAGGGGGACTCTGG + Intergenic
1096075362 12:48800529-48800551 CAGGGCAGGCAGGGCAGCCCAGG + Intergenic
1096171714 12:49476668-49476690 CAGGGCATGCAGTGGGGGTGTGG - Intronic
1096460783 12:51820630-51820652 CAGGGCACGCAGGGCTTCTCTGG - Intergenic
1096632616 12:52938493-52938515 CAGGCCAAGCACAGTGGCTCAGG + Intronic
1097166190 12:57087843-57087865 CAGGGAAAGGAGGGGGGGTGGGG - Intronic
1097222143 12:57457248-57457270 CAGGGTAAGCAGGCTGGCCCAGG + Exonic
1100407058 12:94280878-94280900 CAGAGCAAGGAGGGGGCCTGGGG + Intronic
1102028427 12:109726626-109726648 CAGGAGCAGCAGGGGGGCTCAGG + Intronic
1102068652 12:109999605-109999627 CAGGGCAGGCAGGCGGGCGCGGG + Exonic
1102298195 12:111753329-111753351 CAGGGCAGGAAGGGGTGCTGCGG + Intronic
1102428449 12:112862874-112862896 CAGGGCTACCAGGGGCCCTCTGG + Intronic
1102801520 12:115739025-115739047 CTGGGAAAGCAGGGGAGGTCAGG - Intergenic
1104042310 12:125138679-125138701 CAGGGCACCCAGCTGGGCTCTGG + Intronic
1104062629 12:125281237-125281259 CAGGGCAGGCAGGGAAGCCCGGG + Intronic
1104258184 12:127158190-127158212 CAGGGTCACCAGGGGTGCTCAGG - Intergenic
1106796199 13:33208391-33208413 CAAGGCAAGCTTGGGGACTCAGG + Intronic
1109727510 13:66362897-66362919 CAGGCCAGGCACGGTGGCTCAGG + Intronic
1113056321 13:106271964-106271986 CAGGCCATGCACGGTGGCTCAGG + Intergenic
1113619082 13:111700969-111700991 AAGGGCATGCAGGGGGCCTGGGG - Intergenic
1113624611 13:111786230-111786252 AAGGGCATGCAGGGGGCCTGGGG - Intergenic
1113788608 13:113015807-113015829 GAGAGAAAGCAGGGGGTCTCTGG + Intronic
1114065911 14:19059794-19059816 CAGAGCCAGCAGTGTGGCTCAGG + Intergenic
1114069161 14:19094510-19094532 CAGGACAAAGAAGGGGGCTCAGG - Intergenic
1114093099 14:19305493-19305515 CAGGACAAAGAAGGGGGCTCAGG + Intergenic
1114096357 14:19340231-19340253 CAGAGCCAGCAGTGTGGCTCAGG - Intergenic
1114454679 14:22847027-22847049 CAAGCCAAGCAGGGGGCCACAGG + Exonic
1114526774 14:23371464-23371486 CTGGGAAAGCAGGGGCACTCAGG - Intergenic
1118413639 14:65508781-65508803 TAGGCCAAGCACGGTGGCTCAGG - Intronic
1118918949 14:70132530-70132552 GTGGGCAAGCAGGTGGGCTCTGG + Intronic
1119275717 14:73353563-73353585 CAGGCCAGGCATGGTGGCTCAGG + Intronic
1119319487 14:73721247-73721269 CAGGGCAAGCAGGGTGGAGCTGG - Intronic
1119663017 14:76465015-76465037 CAGGTCAAGCAGGGGGCCAGGGG + Intronic
1120615683 14:86701021-86701043 CAGGCCAGGCAGGATGGCTCAGG + Intergenic
1120750391 14:88192187-88192209 CAGGCCAGGCACTGGGGCTCTGG - Intronic
1121955193 14:98207094-98207116 CAGGCCAACCAGGGGTGCTGGGG - Intergenic
1122386207 14:101350060-101350082 CAGGGCAGGCAGGGTGGGTGGGG - Intergenic
1122414016 14:101540229-101540251 CAGGCCAGGCTGGTGGGCTCTGG - Intergenic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1122746266 14:103898893-103898915 CAGGGCAGGCAGGGCGGCAGGGG + Intergenic
1122786597 14:104166983-104167005 CTGAGCAGGCAGGGGGGCGCCGG - Exonic
1122909514 14:104820383-104820405 CAAGCCAAGGAGGGGGCCTCTGG - Intergenic
1122971583 14:105154437-105154459 CAGGGCAACCAGAGGGGCTGGGG - Intronic
1123108795 14:105855656-105855678 GAGGGGAAGCAGGTGGGGTCTGG - Intergenic
1123176197 14:106421607-106421629 CAGGGCCAGCAGGGGGCGTGCGG - Intergenic
1123450783 15:20357894-20357916 CAGTGCAGGCCGGGGGGCGCTGG - Intergenic
1123855543 15:24407147-24407169 CAGGGCACGCAGAAGGGTTCTGG + Intergenic
1123939545 15:25210211-25210233 CAAGGCAAGAATGGGGACTCAGG - Intergenic
1124092626 15:26620726-26620748 CAGGGCAACCAGGGAAGCCCAGG + Intronic
1124373059 15:29114360-29114382 CAGGGCAAGCAGCCTGGCTGTGG - Intronic
1124794829 15:32767483-32767505 CATGGCAAGCAGGGTGGCCTTGG - Exonic
1125204736 15:37140554-37140576 AAGGTAAAGCAGGAGGGCTCTGG + Intergenic
1126142616 15:45450372-45450394 CAGGCGTAGCAGAGGGGCTCCGG + Intergenic
1126876386 15:53045983-53046005 CAGGGCAGGCACAGTGGCTCAGG - Intergenic
1127931792 15:63601570-63601592 GAGGGGAAGCAGGGGCGCACGGG + Exonic
1128053804 15:64684971-64684993 CAAGGCAAGCGGGTGGGCTGGGG - Exonic
1128151007 15:65363476-65363498 CTGGGCAAGCATTGGGTCTCTGG - Intronic
1129061150 15:72861273-72861295 CGGGGCAGGCAGTGGGTCTCTGG + Intergenic
1129708318 15:77807178-77807200 CAGGGCATGCCGGGGTACTCGGG - Intronic
1129757879 15:78109417-78109439 CAGGATAAGCAGGAGGGCCCCGG + Intronic
1130024865 15:80262238-80262260 CACGGCAAGAAGGGGGACTTTGG + Intergenic
1131294722 15:91136857-91136879 CAGGAGAAGCAAGAGGGCTCTGG + Intronic
1132095854 15:98984289-98984311 CAGGCCGAGCACGGTGGCTCAGG - Intronic
1132104232 15:99051300-99051322 GAGGGGGAGCAGGGGGGCTGAGG - Intergenic
1132162537 15:99556326-99556348 GAGAGAAAGCAGGGGGACTCAGG + Intergenic
1132399254 15:101495479-101495501 CAAGGTGAGCAGGGCGGCTCAGG + Intronic
1132616394 16:842958-842980 CAGGGCAGGCAGACGGGCTGGGG + Intergenic
1132669574 16:1097084-1097106 CAGGCCAAGCTGAGGGGCTGCGG - Intergenic
1132715709 16:1288959-1288981 CAGGGCAAGGAGGGGGTCCTGGG + Intergenic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132815194 16:1822487-1822509 CAGGGCAAGCTGGCAGGGTCAGG - Intronic
1133028961 16:3000711-3000733 CAGGGCAGGCCGGGGTGCTGTGG + Intergenic
1133435259 16:5773971-5773993 CAGGCCAAGCATGGTGGCTCAGG - Intergenic
1134093336 16:11403111-11403133 CTGGGAAAGCAGGGCTGCTCAGG - Intronic
1134197065 16:12167430-12167452 AAGGGCAACCAGGTGAGCTCAGG - Intronic
1134789917 16:16980575-16980597 TAGGGCTAGCAGGCGGGTTCTGG - Intergenic
1134809383 16:17154320-17154342 CAGGGCTAACATGGGGGCCCTGG + Intronic
1135193265 16:20372719-20372741 CAGGGCAGGCAAATGGGCTCAGG + Intronic
1135462366 16:22655876-22655898 CAGGCCAGGAATGGGGGCTCAGG - Intergenic
1136050493 16:27646653-27646675 CAGGGCAAGAAGGTGGGCTGTGG + Intronic
1136619447 16:31418369-31418391 CAGTGCAAGCAGGTGGGTCCAGG + Exonic
1137251817 16:46746859-46746881 AAGGGGCAGCAGGGGAGCTCTGG + Intronic
1137287706 16:47030200-47030222 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1137764655 16:50968566-50968588 CAGGCCAGGCACGGTGGCTCAGG + Intergenic
1139514709 16:67446276-67446298 CAGAGCAAGCAGGGGGAGTGGGG - Intronic
1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG + Intronic
1140032387 16:71348910-71348932 CAGGGCAAGCAGCTGCCCTCCGG + Intergenic
1140171080 16:72605751-72605773 CAGGCCAGGCACGGTGGCTCAGG + Intergenic
1141203644 16:81915781-81915803 CAGGGCAGGCAGGGGGGCTCTGG - Intronic
1141508275 16:84495425-84495447 CAGGGGAAGGAGGGAGGGTCTGG - Intronic
1141584897 16:85027560-85027582 CAGAGCCAGCAAGGGGGCGCCGG + Intergenic
1141702106 16:85647233-85647255 CAGGGCAGGCAGGAGGGCTTTGG - Intronic
1141892766 16:86938129-86938151 CAGGGCTTTCAGGGTGGCTCTGG + Intergenic
1142169003 16:88610548-88610570 GAGGGGCAGCAGGGAGGCTCGGG + Intronic
1142458227 17:70008-70030 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1143294365 17:5859664-5859686 AAGAGCAAGCAGTGGGGCTTTGG + Intronic
1143580110 17:7820461-7820483 CAGGGCAGTCAGGGACGCTCAGG - Intronic
1144275442 17:13663775-13663797 CATGGCAAGTAGGAGGTCTCAGG + Intergenic
1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG + Intronic
1144966054 17:19077918-19077940 GAGGTCAAGCTGGGGGGCTGGGG + Intergenic
1144981914 17:19174271-19174293 GAGGTCAAGCTGGGGGGCTGGGG - Intergenic
1144986309 17:19203968-19203990 GAGGTCAAGCTGGGGGGCTGGGG + Intergenic
1145763745 17:27443735-27443757 CACGGTGAGCAGGGGTGCTCGGG + Intergenic
1145819155 17:27818034-27818056 CAGAGCAAGGTGGGGGGGTCAGG - Intronic
1145911089 17:28543553-28543575 CAGGCCAGGCACGGTGGCTCAGG + Intronic
1146202135 17:30867884-30867906 CAGGGCAGGCACAGTGGCTCAGG - Intronic
1146482238 17:33214026-33214048 CAGAACAACCAGGTGGGCTCAGG - Intronic
1147410748 17:40250111-40250133 CCGGTCCAGCAGGGTGGCTCAGG - Intronic
1147487157 17:40827507-40827529 CAGGGTAAGTGGGTGGGCTCTGG + Intronic
1147632343 17:41940210-41940232 CAGGGGAAGCAGCAGGACTCAGG - Intronic
1147921137 17:43917813-43917835 CAGGGCTAGTGTGGGGGCTCCGG + Exonic
1148110888 17:45144261-45144283 CAGGGCCATCAGGGGGGCATTGG - Intergenic
1148168593 17:45501437-45501459 CAGGGCTAGTGTGGGGGCTCCGG + Intergenic
1148280218 17:46341503-46341525 CAGGGCTAGTGTGGGGGCTCCGG - Intronic
1148302446 17:46559440-46559462 CAGGGCTAGTGTGGGGGCTCCGG - Intronic
1148647170 17:49225720-49225742 CAGGAGAAGCAGTGGGGCTTGGG + Intronic
1149451735 17:56754986-56755008 CAGGGCAGACAGAGTGGCTCCGG + Intergenic
1150314337 17:64156035-64156057 AAGGGAAGGCAGTGGGGCTCAGG + Intronic
1150399788 17:64847888-64847910 CAGGGCTAGTGTGGGGGCTCCGG + Intergenic
1150602697 17:66664316-66664338 CAGGGCAGGCAGGGCAGCCCAGG - Intronic
1151702373 17:75750265-75750287 CAGGGTAAGGCGGGGGGCTGAGG + Exonic
1151919277 17:77141276-77141298 GAGGGCGAGCAGGGGGGCGGGGG - Intronic
1152120138 17:78413439-78413461 GAGGGCAAGCAGGTGGCCACGGG - Intronic
1152337659 17:79707441-79707463 CAGTGCAAGCTGGGGGGCGCTGG + Intergenic
1152445756 17:80342077-80342099 CAGGCCAGGCACGGTGGCTCAGG - Intronic
1152622789 17:81373627-81373649 CAGGGCCAGCATGGGTGCACAGG - Intergenic
1152691618 17:81720703-81720725 CAGGGCAGGCAGCGGTGCGCGGG - Exonic
1152762053 17:82113959-82113981 CAGGGCAGGCAAGGGGGCCTTGG - Intronic
1153288648 18:3479354-3479376 CAGGTCAGGCACGGTGGCTCAGG + Intergenic
1154173290 18:12066436-12066458 CAGGCCAGGCACGGTGGCTCAGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1156027561 18:32672215-32672237 CAGGGCAATTAGAGGGGCTATGG - Intergenic
1156093818 18:33505101-33505123 CAGGTCAAGCAGTGGGGGGCGGG - Intergenic
1157210586 18:45738894-45738916 CAGTGCAAGCAGGAGAGCACAGG + Intronic
1157424321 18:47571884-47571906 CAGGGGACTCAGGGGGACTCAGG - Intergenic
1158275236 18:55759686-55759708 AAGGGCAAGCACGGAGGCCCAGG + Intergenic
1160106770 18:75985107-75985129 CAGGGCATGGAGGAGGGCACTGG + Intergenic
1160123303 18:76148902-76148924 TGGGGCAAGCAGAGGGGCTGTGG + Intergenic
1160242039 18:77131790-77131812 CAGGACAGGCAGTGGGGCCCAGG + Intronic
1160327344 18:77963076-77963098 AAGGGTAAGAAGGAGGGCTCGGG + Intergenic
1160588036 18:79923320-79923342 ACGGGCAGGCAGGGGGGCTGTGG + Intronic
1160704742 19:524679-524701 GAGGGCAGGCAGGGTGCCTCAGG - Intergenic
1160887248 19:1355563-1355585 CAGCAGAAGCGGGGGGGCTCAGG - Intronic
1161128371 19:2573302-2573324 CAGGCCAGGCGTGGGGGCTCAGG - Intronic
1161199054 19:3004356-3004378 GAGGGCAAGCGCGGTGGCTCAGG + Intronic
1161310240 19:3589922-3589944 CAGGGTAAGCCAGGGGGCCCTGG + Intronic
1161400579 19:4065154-4065176 AAGGGAAAGGAGGGGGGGTCCGG + Intronic
1161480047 19:4505884-4505906 CAAGGAGAGCAGGGGGGCTGAGG - Intronic
1162589362 19:11580630-11580652 CTGGCCAAGCATGGTGGCTCAGG + Intronic
1162850445 19:13427168-13427190 CAGGGCATGCGTGGTGGCTCAGG + Intronic
1163015059 19:14449836-14449858 TAGGCCAAGCATGGCGGCTCAGG - Intronic
1163021485 19:14483010-14483032 CAGGACAGGAAGTGGGGCTCAGG + Intronic
1164545482 19:29158319-29158341 CAGATCCAGCAGAGGGGCTCTGG + Intergenic
1164854805 19:31512535-31512557 CAGGGCACACAGGAAGGCTCAGG + Intergenic
1164931721 19:32180810-32180832 CAGGCCATGCAGGTGGGGTCTGG - Intergenic
1165830608 19:38728580-38728602 CTAGGGAAGAAGGGGGGCTCGGG - Intronic
1166203336 19:41252824-41252846 CAGGGCTACCTGGGGGGCTCAGG + Exonic
1166704885 19:44903245-44903267 GAGGGAAGGGAGGGGGGCTCAGG - Exonic
1167264428 19:48476592-48476614 CAGGCCAGGCACGGTGGCTCAGG + Intronic
1167277411 19:48546680-48546702 CAGGCCAAAGAGGGGGCCTCTGG - Intergenic
1167524618 19:49975969-49975991 CAGGAGAAGCAGGTGGGATCAGG - Intergenic
1167769193 19:51503427-51503449 CACGGCAAGGATGGGGGCCCAGG - Intergenic
1167949766 19:53016710-53016732 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1168688978 19:58365681-58365703 CAGGCCAAGCGTGGTGGCTCAGG - Intergenic
925016152 2:525776-525798 CAGGGCCCGTACGGGGGCTCAGG - Intergenic
925887312 2:8404023-8404045 CAGGGCCAGCAGGGAGGGACTGG - Intergenic
925970506 2:9103526-9103548 CAGGGCAAAAAGGGGAGCCCAGG + Intergenic
926206114 2:10835340-10835362 CTGGTCAAGAAGGCGGGCTCCGG - Intronic
926299258 2:11590403-11590425 CAGAGCAAGCAGGTGGGACCAGG - Intronic
926683085 2:15678652-15678674 CAGGGCCTGCTGGGGGGCTGGGG + Intergenic
927454739 2:23239720-23239742 CAGGGCAGGAAGAGAGGCTCGGG - Intergenic
927553046 2:24015748-24015770 CAGAGCAAGGAGGGTGCCTCTGG - Intronic
927553058 2:24015866-24015888 CAGAGCAAGGAGGGTGCCTCTGG - Intronic
927843909 2:26461665-26461687 CAGGGCAGGGATGGGGGTTCAGG - Intronic
929716704 2:44318370-44318392 CAGGCCAGGCAAGGTGGCTCAGG - Intronic
930804068 2:55472544-55472566 GGGGCCAAGCAGGGTGGCTCAGG + Intergenic
932176697 2:69609398-69609420 CAGGCCAGGCACGGTGGCTCAGG + Intronic
932435165 2:71699080-71699102 CTGGGCACACAGCGGGGCTCAGG + Intergenic
932711045 2:74063163-74063185 CAGGCCAGGCATGGTGGCTCAGG - Intronic
932758275 2:74423548-74423570 CAGGGCATGGAGGGGTGCTGGGG + Intronic
932777967 2:74539755-74539777 CAGGGCGAGCAGGAGGTCCCGGG + Intronic
933833326 2:86227457-86227479 CCGGGCAAACAGGGAGGCCCTGG + Intronic
934163336 2:89272619-89272641 CAGGGCACGCAGGGAGGGTGGGG + Intergenic
934203938 2:89909905-89909927 CAGGGCACGCAGGGAGGGTAGGG - Intergenic
934520035 2:95014287-95014309 CACGGCAAGCGGGGTGGCTTAGG - Intergenic
934684966 2:96314334-96314356 CAGGCCAGGCATGGTGGCTCAGG - Intergenic
934845388 2:97658815-97658837 CATGGCAAGCAGGACGGCACAGG + Intronic
934920416 2:98339904-98339926 CAGTGCAGGCAGGAGGGCTGTGG + Intronic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
937231079 2:120398625-120398647 GAGGGCAAGCAGGGGAGCAGGGG - Intergenic
937264618 2:120608003-120608025 CAGGGAACCCAGGGGGGCTCAGG + Intergenic
937322594 2:120969976-120969998 TAATGCAAGCTGGGGGGCTCAGG + Intronic
937629512 2:124084548-124084570 CAGGGCAGGCACGGTGGCTCAGG - Intronic
937641263 2:124214331-124214353 CAGGGCTAACAAGAGGGCTCTGG - Intronic
937872233 2:126794095-126794117 CAGGGAAAGAAGTGGGTCTCAGG - Intergenic
938892744 2:135722078-135722100 CAGTGCCAACAGGTGGGCTCAGG - Intronic
939531256 2:143364743-143364765 CAGGCCAGGCACGGTGGCTCAGG + Intronic
941017114 2:160370044-160370066 CAGGGGAAGCAGGGAAGCACAGG - Intronic
946689122 2:222297795-222297817 CAGAGCAAGAATGGGGGCTGGGG - Intronic
947637977 2:231689723-231689745 CAGAGCCAGCAGGGGGGCGGGGG - Intergenic
947726065 2:232401586-232401608 CGGGCCAGGCAGGGTGGCTCAGG + Intergenic
948273630 2:236692087-236692109 CGGGGCAAGCATGGGCCCTCGGG + Intergenic
948574417 2:238940595-238940617 CAGGGAAAGAAGGGAGGCTCAGG - Intergenic
948893052 2:240916379-240916401 GGGGGCGAGCAGGGGGGCGCAGG - Intergenic
1169066124 20:2694862-2694884 GAGGGAACGCTGGGGGGCTCTGG + Intronic
1169078006 20:2773908-2773930 GAGGCCAGGCAGGGTGGCTCAGG - Intergenic
1170157219 20:13279762-13279784 CAGGGCAAACAGCGGGGACCAGG + Exonic
1170705830 20:18744201-18744223 CAGTGCCAGCAGCGGGGCTGAGG + Exonic
1171013011 20:21518682-21518704 CCGGGAAAGCAGGGTGCCTCTGG - Intergenic
1171034646 20:21705557-21705579 CAGGGCGGGGAGGGGGGCGCTGG + Intergenic
1171346960 20:24472707-24472729 CATGGCACGCAGGGAGGCACTGG + Intronic
1171489773 20:25508658-25508680 CAGGGGGAGCTGGGGGGCGCTGG + Intronic
1171977618 20:31605533-31605555 CAGGGCAGGCAGGCGCGCCCCGG - Exonic
1172129570 20:32646824-32646846 CAAGGCATGCATGGGGCCTCTGG - Intergenic
1172168597 20:32914556-32914578 CATGGCTAGGAGGGGGCCTCAGG + Intronic
1172227401 20:33314501-33314523 AGGGCCAGGCAGGGGGGCTCTGG - Intergenic
1172366466 20:34353817-34353839 CAGGCCAGGCACGGTGGCTCAGG - Intergenic
1172392670 20:34576492-34576514 CAAGGAATGCAGGGGGCCTCTGG - Intronic
1172839967 20:37897038-37897060 CAGGGACAGCAGGGGGGCCTGGG - Intergenic
1172844825 20:37923628-37923650 CTGAGCAGGGAGGGGGGCTCAGG + Intronic
1174128623 20:48326576-48326598 CAGGGCAAGGAGGGGGCCCTGGG + Intergenic
1175121732 20:56721202-56721224 CAGGGAGAGAAGGGGTGCTCTGG + Intergenic
1175131462 20:56792774-56792796 CAGGGAAAGCAGGCGGCCTTTGG + Intergenic
1175727085 20:61325905-61325927 CAGGCCAACCAGACGGGCTCTGG - Intronic
1176188824 20:63796886-63796908 CAGGCCAGGCACGGTGGCTCAGG + Intronic
1176645309 21:9343765-9343787 CAGGCCAGGCACGGTGGCTCAGG - Intergenic
1178961764 21:37072741-37072763 TAGGGCAGGGAGGGGGGTTCTGG + Exonic
1179400396 21:41077445-41077467 AAAGCCAAGGAGGGGGGCTCAGG - Intergenic
1179411952 21:41168698-41168720 CGGGGAACGCAGAGGGGCTCGGG + Intronic
1179574743 21:42301103-42301125 CAGGGCTAGCAGGAGGGCACTGG + Intergenic
1179628033 21:42659527-42659549 CAGGGCATGTGGGGAGGCTCAGG + Intronic
1180056547 21:45361959-45361981 CACGCCAGGCAGGGGGGCTCGGG - Intergenic
1180120318 21:45741733-45741755 CAGGGCAAGCAAGGGAGCTCAGG - Intronic
1180127138 21:45800513-45800535 CATGGCAGGGAGGGGGCCTCAGG - Intronic
1180129417 21:45817522-45817544 AAAGGCAAGCATGGGGGCTGCGG - Intronic
1180180652 21:46117397-46117419 CAGGGCAAGCTGGGGCGCATCGG + Exonic
1180181751 21:46121300-46121322 CAGGGCAGGATGGGGGGCTGGGG - Intronic
1180484391 22:15782386-15782408 CAGAGCCAGCAGTGTGGCTCAGG + Intergenic
1180487635 22:15817073-15817095 CAGGACAAAGAAGGGGGCTCAGG - Intergenic
1180799427 22:18624889-18624911 CAGGACAGGCAGGAGGGCACAGG - Intergenic
1180992263 22:19943777-19943799 CAAGGCCAGCAGGGGCACTCAGG + Intronic
1181052023 22:20242377-20242399 CAGGGCACGCAGGGGGGCCAGGG + Exonic
1181222291 22:21370377-21370399 CAGGACAGGCAGGAGGGCACAGG + Intergenic
1181497489 22:23295705-23295727 CAGGACCAGCAAGGGGGCCCTGG + Intronic
1181523107 22:23460532-23460554 CAGGCCAAGTAGAGTGGCTCTGG - Intergenic
1181531652 22:23520846-23520868 GAAGGCAAGCAGAGTGGCTCGGG - Intergenic
1181638050 22:24183370-24183392 CAGGACAGGCAGGAGGGCACAGG + Intronic
1182681857 22:32085737-32085759 CAGGGCCAGCAGGGCGGGGCAGG + Intronic
1183107877 22:35627737-35627759 TAGGGGAAGCTGGGGAGCTCAGG + Intronic
1183197161 22:36361349-36361371 GCGGGCATGGAGGGGGGCTCAGG + Intronic
1183373403 22:37448556-37448578 CAGGGCAGGCAGGGAGGCTGAGG + Intergenic
1183455962 22:37923506-37923528 CAGGCCAGGCATGGTGGCTCAGG - Intronic
1183485702 22:38086634-38086656 CAGGGCAGAGAGAGGGGCTCAGG + Intronic
1184411581 22:44329195-44329217 CAGCACAGGCATGGGGGCTCGGG + Intergenic
1184921099 22:47606447-47606469 CCGGGCACTCAGGGGAGCTCAGG - Intergenic
1185077795 22:48692543-48692565 AAGGGCAGGCATGGTGGCTCAGG - Intronic
949930888 3:9077630-9077652 CAGGCCAGGCAGGGTGGCTGAGG - Intronic
950153590 3:10707057-10707079 CAGGGCAAGGAGGGGTGGCCAGG + Intronic
951929310 3:27945722-27945744 CGGGGCAAGCAGGTGGGCTAAGG + Intergenic
952368346 3:32695004-32695026 CATGGCCAGCACGGTGGCTCAGG - Intronic
952924765 3:38312934-38312956 GAGGGCCAGCAGGGGGTCTCTGG + Intronic
953563787 3:44014165-44014187 CAGGGCCTGCAGGGTTGCTCTGG + Intergenic
953576563 3:44117387-44117409 GTGGCCCAGCAGGGGGGCTCTGG - Intergenic
953751406 3:45611337-45611359 CACTTGAAGCAGGGGGGCTCTGG + Intronic
953801665 3:46028871-46028893 CAGGTCAGGCATGGTGGCTCAGG - Intergenic
954217545 3:49132912-49132934 CAAAGCAAGGAGGAGGGCTCGGG - Intronic
954259959 3:49431559-49431581 TAGGCCAGGCAGGGTGGCTCAGG + Intergenic
954288256 3:49634936-49634958 CAGGGGTAGCGGGTGGGCTCTGG + Intronic
954374215 3:50185613-50185635 CAGGGCAGGGAGGGGGTCCCTGG + Intronic
954379348 3:50211313-50211335 CAGGGCAGGGAGGAGGGCTGGGG - Intronic
954792787 3:53145416-53145438 CTGGGCCAGGAGGAGGGCTCTGG - Intergenic
957239171 3:77636310-77636332 TAGGCCAAGCACGGTGGCTCAGG + Intronic
957597560 3:82287621-82287643 CAGGGCAAGCTGGAGAGCCCTGG - Intergenic
958548565 3:95588629-95588651 CAGGGGAAGCTGGGGGGCTAGGG + Intergenic
959472837 3:106773730-106773752 CAGGGCAAGCAGAGGAGGTGGGG + Intergenic
959604037 3:108222506-108222528 CAGGGCAAGAAGAGGGCCACAGG - Exonic
959619607 3:108385837-108385859 CAGAGTGAGCAGGGGAGCTCTGG - Intronic
960176121 3:114519490-114519512 CAGGGCAAGGAGGGTGGCAGAGG - Intronic
960938147 3:122915871-122915893 CAGGGCATGCCTGGGGGCCCGGG - Exonic
961569217 3:127786107-127786129 CAGGGGCAGCAGTGGGGCACTGG + Intronic
961593232 3:127996390-127996412 CAGGGATCCCAGGGGGGCTCAGG + Intergenic
965439865 3:168699419-168699441 CAGGGCAGGCACAGGGGCCCTGG - Intergenic
966677143 3:182601832-182601854 CATGGCCAGCAGGGGAGGTCAGG + Intergenic
966851500 3:184167760-184167782 CAGGGCAGGCCGGAGGGCCCAGG + Intronic
966887919 3:184386916-184386938 CAGGGCAAACAGGGCAGCACTGG - Exonic
967442642 3:189526952-189526974 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
968107095 3:196009120-196009142 CAGGGGATGCAGGGGGGATGCGG - Intergenic
968166979 3:196474409-196474431 GAGGCCAAGCACGGTGGCTCAGG - Intronic
968226469 3:196975517-196975539 GAGGGCCAGCAGGGAGGCCCAGG + Intergenic
1202741581 3_GL000221v1_random:61303-61325 CAGGCCAGGCACGGTGGCTCAGG + Intergenic
968506233 4:972651-972673 CGCGGCAAGCAGGCGGGCCCCGG - Intronic
968811273 4:2800647-2800669 CTGGGCAGGCAGGAGAGCTCAGG + Intronic
969188632 4:5499136-5499158 CAGGGCACAAAGAGGGGCTCTGG - Exonic
969236812 4:5871120-5871142 CACTGCAAGCAGGGGCGCCCAGG + Intronic
969370590 4:6728752-6728774 CAGGGCAAGCAGGGCAGGACAGG - Intergenic
969529956 4:7725148-7725170 GAGGGCCTGCAGGGGGGCTGTGG - Exonic
969564758 4:7971224-7971246 CAGGGCAGGCAGGGTGGGTGAGG + Intronic
976716906 4:88132788-88132810 CAGGTCATGCATGGTGGCTCAGG + Intronic
979070282 4:116195011-116195033 CAGGCCAGGCACGGTGGCTCAGG + Intergenic
979678586 4:123435460-123435482 CAGGGAAGGGAGGGGGGCTTGGG + Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981027385 4:140090767-140090789 CAGGCCAGGCATGGTGGCTCAGG + Intronic
984944522 4:184960732-184960754 CAGGGCGTGCAGGGGGCCCCAGG + Intergenic
985732388 5:1556537-1556559 CAGGGCCAGCAGTGGGGTGCGGG + Intergenic
987152354 5:15055978-15056000 CTGGGGAAGAAGGGGTGCTCTGG + Intergenic
987710799 5:21499007-21499029 CAGGCCAGGCATGGTGGCTCAGG - Intergenic
989096752 5:37788940-37788962 CAGGGCATGCAAGGGGGCTGAGG - Intergenic
990207811 5:53449090-53449112 CAGGCCAAGCATGGTGGCTCAGG + Intergenic
991761139 5:69918065-69918087 CAGGCCAGGCATGGTGGCTCAGG - Intergenic
991786190 5:70200035-70200057 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
991840367 5:70793115-70793137 CAGGCCAGGCATGGTGGCTCAGG - Intergenic
991878634 5:71200421-71200443 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
992060922 5:73046346-73046368 CAGGCCAGGCACGGTGGCTCAGG - Intronic
992527897 5:77629938-77629960 CAGCGCAAGCAGGGAGGCCAGGG + Exonic
992799871 5:80286423-80286445 TAGGGCAAGCACGGTGGCTCAGG + Intergenic
994802753 5:104399764-104399786 CAGGGCCTGTCGGGGGGCTCGGG + Intergenic
995164388 5:109022186-109022208 CAGGGCATGGAAGTGGGCTCAGG - Intronic
995222463 5:109665700-109665722 CAGGCCAACCATGGTGGCTCAGG - Intergenic
995298496 5:110549331-110549353 GAGGCCAAGCAGAGTGGCTCAGG + Intronic
995424676 5:112007191-112007213 CTGGGCAGGCAGAGGGGCTTAGG - Intergenic
997285460 5:132675023-132675045 CAGAGCAAGCTGAGGAGCTCTGG - Intronic
997713989 5:136028848-136028870 CAGGGCAGCCAGGGGCGCACGGG + Intergenic
998007387 5:138666008-138666030 CAGGCCCAGCAGTGGGGCTGAGG + Intronic
998439115 5:142141455-142141477 CAGGCCAGGCATGGTGGCTCAGG - Intronic
1001400013 5:171440827-171440849 AAGGGCAAGCACAGGGGCTCTGG - Intronic
1001619074 5:173067111-173067133 CAGGCCGAGCACGGTGGCTCAGG - Intronic
1001945426 5:175773931-175773953 CAGAGCAAGCAGGCAGGCTCTGG + Intergenic
1002101021 5:176857682-176857704 CAGGGCCAGCCAGTGGGCTCTGG + Intronic
1002123533 5:177023584-177023606 CAGAGCAAGCTGGGGCGCTTCGG - Intronic
1002446081 5:179290928-179290950 CAGGGCCCACAGGGTGGCTCAGG - Intronic
1002755621 6:156911-156933 AAGGGCAGGCAGTGGGGCCCAGG - Intergenic
1002784616 6:392024-392046 GAGGGCAGGCGGGGAGGCTCGGG - Intronic
1002814741 6:669270-669292 CAGGGCTGGCAGGGGGCCACAGG - Intronic
1002991846 6:2245643-2245665 CGGGCCAAGCAGCGGGGCTGCGG + Exonic
1003550453 6:7098325-7098347 CAGGGAAAGCAGGAGGGGTGAGG - Intergenic
1003621589 6:7705529-7705551 CAGGCCAGGCATGGTGGCTCAGG - Intergenic
1004866934 6:19862515-19862537 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1005546887 6:26881496-26881518 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1006021712 6:31121346-31121368 CAGGGCCAGCAGATGGGCTATGG - Intronic
1006061624 6:31424686-31424708 GAGGGCAGGCATGGTGGCTCAGG + Intergenic
1006509755 6:34515530-34515552 CAGGGCCAGCAGGGAGGCTCTGG - Intronic
1006514746 6:34539566-34539588 CAGGGCAAGGAGAGGGGGTTGGG + Intronic
1006516221 6:34547059-34547081 CGTGGCAGGCATGGGGGCTCTGG - Intronic
1006694887 6:35922505-35922527 CAAGTCAAGCATGGGGGCTTTGG + Intergenic
1007069161 6:39022538-39022560 CTGGGCAGGCAGGTGGGCTCTGG - Intronic
1007095771 6:39212004-39212026 CAGGCCAGGCACGGCGGCTCAGG + Intronic
1007139174 6:39554437-39554459 CAGAGACAGCAGGTGGGCTCTGG - Intronic
1007569918 6:42882176-42882198 CAGGCCAGGCAGGGTGGCTCAGG - Intronic
1007664647 6:43507114-43507136 CAGGGGCTGCATGGGGGCTCTGG - Exonic
1007854958 6:44846128-44846150 CAGGGCATGCAGTGGGGGTGTGG - Intronic
1008109690 6:47478380-47478402 CAGGGCAAGAAGGGGCGGTGGGG - Intronic
1008555866 6:52672327-52672349 CAGGAAGAGCTGGGGGGCTCAGG + Intronic
1009017643 6:57922578-57922600 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1012467654 6:99533267-99533289 AAAGGCAAGGAGGGTGGCTCAGG + Intergenic
1014089616 6:117388924-117388946 GTGGGTAAGCAGGTGGGCTCTGG - Intronic
1015775882 6:136813720-136813742 CTGGCCAAGCATGGTGGCTCAGG - Intergenic
1017679704 6:156851189-156851211 TAGTGCTTGCAGGGGGGCTCTGG - Intronic
1017753305 6:157509037-157509059 CAAGGAATGCAGGGGGCCTCTGG - Intronic
1018017825 6:159727639-159727661 CAGGGCAAGCAGCGCGGCCTCGG + Intronic
1018804595 6:167248964-167248986 CAGGGCAGGCAGGGTGGTGCAGG + Intergenic
1019140172 6:169937863-169937885 CAGGGCAGGCAGGAGGCTTCAGG - Intergenic
1019178564 6:170173607-170173629 CAGGTCAGGGAAGGGGGCTCAGG - Intergenic
1019290396 7:247377-247399 CAGGGCAGGCAGGGAGGCTCTGG - Intronic
1019331983 7:464800-464822 CAGGGCAGGCAGGAGTGCTGGGG - Intergenic
1019352156 7:559391-559413 CAGGGCCAGGACGGGGGCTCAGG + Intronic
1019465517 7:1185962-1185984 CATGGCAAGGCGGGGGGCTCGGG - Intergenic
1019534925 7:1523866-1523888 CAGGGTAACCCGGGGGACTCAGG - Intergenic
1019537081 7:1534731-1534753 CGAGGCCAGCATGGGGGCTCTGG - Intronic
1019588223 7:1816026-1816048 CAGGCCAAGCAGAGTGGCTCCGG + Exonic
1019732384 7:2635132-2635154 CAGGGCCACCAGGGAGTCTCAGG - Intronic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1023037687 7:36147571-36147593 CAGGGCTAGCAGGGGACCACGGG + Intergenic
1023802638 7:43848214-43848236 CAGATGAAGCAGGGGGGCTCGGG + Intergenic
1024215716 7:47246473-47246495 CAGGGCATGCTGGGGGACTCTGG - Intergenic
1026134366 7:67646534-67646556 GAGGGAAAGCAGGAGGGCTCTGG + Intergenic
1026238704 7:68552535-68552557 CAGGTCAAGCATGGTTGCTCAGG - Intergenic
1026379701 7:69786733-69786755 CAGGTCAGGCACGGTGGCTCAGG - Intronic
1027188875 7:75986679-75986701 CAGGGCCTGCATGGGGGCACCGG + Exonic
1027402576 7:77823498-77823520 CAGGCCAGGCACGGTGGCTCAGG - Intronic
1027681893 7:81232596-81232618 CAGGGCAAGCAGGGGTGGGAGGG + Intergenic
1029598417 7:101549865-101549887 CAGGGCAAGGTGAGGGGCTGAGG - Intronic
1031502815 7:122542159-122542181 CAGGGGAAGAAGGGAGGCACAGG + Intronic
1031922372 7:127611635-127611657 CAGGGCAGGCAGGGCTGCTGTGG + Exonic
1032056147 7:128685931-128685953 CAGGCCAGGCATGGTGGCTCAGG + Intronic
1032318102 7:130859910-130859932 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1032391077 7:131555986-131556008 CCGGGCAAACAGGGGCGCGCCGG - Intronic
1032515316 7:132502336-132502358 CAGGGCAGGAAGGGGAGCTTTGG + Intronic
1033348020 7:140540493-140540515 CAGGGCAGGGAGGGTGGCTGGGG + Intronic
1035705319 8:1670409-1670431 CAGGGGAAGCTGGGGGGATGAGG - Intronic
1036793073 8:11736184-11736206 CAGGCCAGGCATGGTGGCTCTGG - Intronic
1039302210 8:36221691-36221713 CAGGCCAGGCACGGTGGCTCAGG - Intergenic
1040661134 8:49577190-49577212 CAGGGCAAACAGAGGGGATTTGG + Intergenic
1041529844 8:58853078-58853100 CAGGGCACACATGGGGGCTGTGG - Intronic
1041689776 8:60678291-60678313 CGGGGCAGGAAGCGGGGCTCCGG - Intergenic
1042263382 8:66883510-66883532 AAGGCCAAGCACGGTGGCTCAGG + Intronic
1043286631 8:78540233-78540255 CAGGGGTAGCAGGGGGGCAGTGG - Intronic
1045347358 8:101305045-101305067 CAGGGAAAGGCAGGGGGCTCAGG + Intergenic
1047052768 8:121131404-121131426 CAGGGCATGCAGGAGGGGTGAGG + Intergenic
1047762446 8:127964111-127964133 CAGGACAAGCAGATGGGTTCAGG + Intergenic
1047895764 8:129364825-129364847 AAGGGCAAGCAGCGAGGCTTAGG - Intergenic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049290181 8:141797636-141797658 CAGGGGAGGCAGGGGAGCCCTGG + Intergenic
1049328480 8:142037397-142037419 CAGGTGAAGCAGGAGGCCTCGGG + Intergenic
1049360910 8:142212245-142212267 CCGGGCCAGGAGGGGTGCTCGGG + Exonic
1049389253 8:142359651-142359673 CAGGTGAGGCAGGCGGGCTCTGG - Intronic
1049402445 8:142434549-142434571 CGGGGCATGCAGGAGGGCTCAGG + Intergenic
1049530563 8:143152364-143152386 GAGGGGAAGCAGGAGGGCTTTGG + Intergenic
1049612377 8:143561598-143561620 CAGGGCAGGAAGGGAGGCTGGGG - Intronic
1049689157 8:143951203-143951225 CAGGGCAGGCAGGGGGGCTGAGG + Intronic
1049827254 8:144677047-144677069 CAGGCCAGGCACGGTGGCTCAGG - Intergenic
1050374636 9:4958219-4958241 CAGGGGAAGAAGGGGTACTCTGG - Intergenic
1051365973 9:16321737-16321759 CTGGGCAAACAGGGTTGCTCTGG - Intergenic
1051374212 9:16387776-16387798 CAACTCAAGCAGGAGGGCTCAGG + Intergenic
1052721918 9:32182362-32182384 CAGTGCAAGCATGGGTGCTGTGG - Intergenic
1053113198 9:35480010-35480032 GAGGGTAAGGAGGGAGGCTCAGG - Intergenic
1055422093 9:76154472-76154494 GAGTGCAAGCATGGGCGCTCAGG + Intronic
1057027539 9:91746356-91746378 CAGGCCAGGCATGGTGGCTCAGG - Intronic
1057201931 9:93145413-93145435 CAGGCCAGGCACGGTGGCTCAGG - Intergenic
1057216588 9:93232002-93232024 CAGGGCAAGCAGCGTGGGTCGGG + Intronic
1057258428 9:93569225-93569247 CAGGGCAAGGAGGGGTGTCCTGG - Intergenic
1058365211 9:104200865-104200887 CACTGCAAGCGGGGAGGCTCAGG - Intergenic
1059238931 9:112786400-112786422 GAGGCCAGGCAGGGTGGCTCAGG - Intronic
1059520193 9:114933658-114933680 CCGGGCAAGCAGAGGGGGTTGGG - Intergenic
1060052142 9:120385150-120385172 GAAGGCAGACAGGGGGGCTCAGG + Intergenic
1060052344 9:120386324-120386346 TAGGGCAAGCAGGGGGCCCTGGG + Intergenic
1060177303 9:121506391-121506413 CTAGGCAAGCAGGAGGCCTCAGG + Intergenic
1060208245 9:121695070-121695092 CGGGGCAGGCAGGGCTGCTCAGG - Intronic
1060228066 9:121808282-121808304 TAGGGCCAGGAGGGAGGCTCTGG - Intergenic
1060666217 9:125433570-125433592 CTGGGGCAGCAGAGGGGCTCAGG + Intergenic
1060814097 9:126625817-126625839 CCGAGCAGGCAGCGGGGCTCAGG - Intronic
1060895666 9:127215626-127215648 CAGGAGAGGCAGGAGGGCTCAGG - Intronic
1061180290 9:129021547-129021569 CGGGGAAAGGAGGGTGGCTCCGG - Intronic
1061227749 9:129290630-129290652 CTGGCCAAGCGGGAGGGCTCCGG + Intergenic
1061237625 9:129351834-129351856 CAGGGCCAGCAAGGGGGAGCCGG - Intergenic
1061504760 9:131025530-131025552 GGGAGCAAGCAGAGGGGCTCAGG + Intronic
1061797905 9:133098989-133099011 CAGGCCAAGCCGGGGGGTTCTGG - Intronic
1061811285 9:133163876-133163898 CAGGGCAGGCAGCGGGGCCGCGG + Exonic
1061912470 9:133732383-133732405 GGGGGCAAGGAGGGGGGCTTGGG - Intronic
1062282776 9:135759386-135759408 CCCGGCAGGCAGGGAGGCTCCGG + Intronic
1062599622 9:137314044-137314066 CAGGGCAGCCTGGGGGCCTCAGG - Intronic
1062732882 9:138119460-138119482 CAGGGCTGGCACGGGGGCTCCGG - Intronic
1203710215 Un_KI270742v1:91227-91249 CAGGCCAGGCACGGTGGCTCAGG + Intergenic
1203576760 Un_KI270745v1:15059-15081 CAGGCCAGGCATGGTGGCTCAGG - Intergenic
1185760551 X:2687368-2687390 CAGGGCAAGTAGGAGGACCCTGG - Intergenic
1186604673 X:11077737-11077759 AAGGGCAAGCAGTGGGTCTCGGG + Intergenic
1187158798 X:16745355-16745377 CAGGGCAAGATGGGAGGCCCAGG + Intronic
1189396642 X:40628955-40628977 TAGGGCAAGGAGGTGGGCCCAGG - Intronic
1189577926 X:42375302-42375324 CAGGGCAGGCAGGGCTGGTCAGG + Intergenic
1190717125 X:53114326-53114348 GAGGCCAAGCACGGTGGCTCAGG - Intergenic
1192331362 X:70177843-70177865 CAGGCCAGGCACGGTGGCTCAGG + Intronic
1195267220 X:103194167-103194189 CAGGGCAGGCAGGGTGGGCCAGG + Intergenic
1196084794 X:111673373-111673395 ATGGGCAAGCATGGGGGCTGAGG + Intronic
1196346168 X:114661650-114661672 CAGGCCAGGCACGGTGGCTCAGG - Intronic
1196403377 X:115339226-115339248 CAGGCCAGGCATGGTGGCTCAGG + Intergenic
1197239022 X:124103556-124103578 CAGGGTGGGAAGGGGGGCTCAGG - Intronic
1197365851 X:125563630-125563652 CAGGGGGAGGAGGGGGGTTCGGG + Intergenic
1197890236 X:131262974-131262996 AAAAGCAAGCAGGGCGGCTCTGG - Intergenic
1197992281 X:132331077-132331099 CAGAGTAACCATGGGGGCTCAGG + Intergenic
1200062615 X:153490268-153490290 CAGGGCCTGCGTGGGGGCTCCGG - Intronic
1200066135 X:153504893-153504915 CGGGGCATGCAGGGAGGCTCAGG + Intronic
1200164269 X:154025359-154025381 CAGGGCAGGCAGGGGGCCTTGGG + Intronic
1200213697 X:154358158-154358180 CAGGGGAGGCAGGGGGGCCTGGG - Intronic
1201604558 Y:15770970-15770992 CGGGGAAAGGAGGGTGGCTCCGG + Intergenic