ID: 1144743575

View in Genome Browser
Species Human (GRCh38)
Location 17:17598171-17598193
Sequence CAGTGTGGCTGGAGTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144743575_1144743582 6 Left 1144743575 17:17598171-17598193 CCCTCTGTACTCCAGCCACACTG No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743575_1144743583 7 Left 1144743575 17:17598171-17598193 CCCTCTGTACTCCAGCCACACTG No data
Right 1144743583 17:17598201-17598223 TGAGGTTCCTTCCAGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144743575 Original CRISPR CAGTGTGGCTGGAGTACAGA GGG (reversed) Intergenic
No off target data available for this crispr