ID: 1144743582

View in Genome Browser
Species Human (GRCh38)
Location 17:17598200-17598222
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144743576_1144743582 5 Left 1144743576 17:17598172-17598194 CCTCTGTACTCCAGCCACACTGG No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743575_1144743582 6 Left 1144743575 17:17598171-17598193 CCCTCTGTACTCCAGCCACACTG No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743572_1144743582 24 Left 1144743572 17:17598153-17598175 CCTTCCCAGCTCTTCTTGCCCTC No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743580_1144743582 -9 Left 1144743580 17:17598186-17598208 CCACACTGGCCTCTTTGAGGTTC No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743571_1144743582 27 Left 1144743571 17:17598150-17598172 CCACCTTCCCAGCTCTTCTTGCC No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743578_1144743582 -5 Left 1144743578 17:17598182-17598204 CCAGCCACACTGGCCTCTTTGAG No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743574_1144743582 19 Left 1144743574 17:17598158-17598180 CCAGCTCTTCTTGCCCTCTGTAC No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data
1144743573_1144743582 20 Left 1144743573 17:17598157-17598179 CCCAGCTCTTCTTGCCCTCTGTA No data
Right 1144743582 17:17598200-17598222 TTGAGGTTCCTTCCAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144743582 Original CRISPR TTGAGGTTCCTTCCAGCCAC AGG Intergenic
No off target data available for this crispr