ID: 1144748605

View in Genome Browser
Species Human (GRCh38)
Location 17:17633089-17633111
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 3, 1: 18, 2: 25, 3: 69, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144748605 Original CRISPR GTGTTTACAAACCTTTAGCT AGG Intergenic
902148055 1:14420350-14420372 GCATTTACAAACCTTGAGCTAGG + Intergenic
902726514 1:18339561-18339583 GTTTCTACAAAACATTAGCTGGG + Intronic
904514057 1:31039526-31039548 GTGTTTAAAAAGTTTTAGCCTGG - Intronic
905104012 1:35551888-35551910 GTCTTTAGTAACCTTGAGCTTGG - Intronic
906003781 1:42450437-42450459 AAATTGACAAACCTTTAGCTAGG - Intronic
906076066 1:43053082-43053104 GTGATTACAAACACATAGCTGGG + Intergenic
906367258 1:45221324-45221346 GTGGTTTCAAATCTTTAACTTGG + Intronic
906876243 1:49541974-49541996 GTGTTTACAAACCTTGAGCTGGG - Intronic
909359650 1:74745564-74745586 GCATTTACAATCCTCTAGCTAGG + Intronic
909759331 1:79269615-79269637 GTATTTACAATCCCTGAGCTAGG - Intergenic
909759359 1:79269823-79269845 GTGTTTACAATCCCCGAGCTAGG - Intergenic
912020164 1:105098167-105098189 GTGTTTACAAAACTTCAGCTAGG + Intergenic
912437235 1:109670278-109670300 GCATTTACAATCCTTTGGCTAGG + Intronic
912879602 1:113396875-113396897 GTGTTTAAAACTCTTTAGGTAGG + Intronic
915618541 1:157062192-157062214 AAATTAACAAACCTTTAGCTAGG - Intergenic
916039307 1:160948785-160948807 GTGCATACAAAACATTAGCTGGG - Intronic
917938884 1:179896403-179896425 GTGTTTAAAAATGTTTGGCTGGG - Intronic
918796026 1:188897828-188897850 GCATTTACAATCCTTTAGCTAGG + Intergenic
919530043 1:198705719-198705741 GTGTTTACAAATCTGTAAGTGGG - Intronic
921846250 1:219885949-219885971 AAGTTGACAAACCTTTGGCTAGG + Intronic
921860968 1:220041864-220041886 GTGTTTATAAACCAGTATCTGGG - Intronic
922029912 1:221787854-221787876 GTCTTTACAACTCTTTATCTTGG - Intergenic
922031451 1:221803855-221803877 GTGTCTACAAAAAATTAGCTGGG - Intergenic
922546902 1:226464539-226464561 GCATTTACAAACCTTGAGCTAGG - Intergenic
1063859425 10:10291554-10291576 GCATTTACAATCCTTTAGCTAGG + Intergenic
1064081281 10:12309880-12309902 GCGTTTACCATCCCTTAGCTAGG + Intergenic
1065555006 10:26906156-26906178 GTATTTACAATCCCTTAGCTAGG - Intergenic
1065826653 10:29578656-29578678 GTTTTTATAATCCTTTAGCTAGG - Intronic
1065995603 10:31056356-31056378 GTGTTCACAAACCTTGAGCTAGG - Intergenic
1065995646 10:31056754-31056776 GTGTTTACAATCCCTGAGCTAGG - Intergenic
1066016734 10:31252908-31252930 AAATTGACAAACCTTTAGCTAGG - Intergenic
1066045062 10:31587742-31587764 GCATTTACAATCCTTTCGCTAGG + Intergenic
1066296213 10:34056218-34056240 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1067229615 10:44397271-44397293 GTGTCTACAAACCTTTTGCGAGG + Intergenic
1067679680 10:48423361-48423383 GGGTTTAAAAAACTTTAGGTAGG + Intronic
1069967842 10:72136236-72136258 GCATTTACAATCCTCTAGCTAGG - Intronic
1071697445 10:87891643-87891665 GTCTTTACAAAAAATTAGCTGGG + Intronic
1071963671 10:90831797-90831819 GTATTTACAAACCCTGAGCTAGG + Intronic
1072278599 10:93845856-93845878 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1072795406 10:98350885-98350907 ATGTTGACAAACCTTTAGAGTGG - Intergenic
1073262369 10:102200402-102200424 GTGTTTACAAACCTTGAGCTAGG + Intergenic
1073555226 10:104443677-104443699 GTGATTATAAAACTGTAGCTTGG + Intronic
1073970380 10:109041082-109041104 GCATTTACAAACCTTTAGCTAGG - Intergenic
1076067387 10:127459575-127459597 GCATTTACAAACCTTTAGCTAGG + Intergenic
1078504713 11:11926573-11926595 AAGTTTACAAACCCTTAGCTAGG - Intronic
1081121389 11:39270945-39270967 GCGTTTATAATCCTCTAGCTAGG - Intergenic
1084152531 11:67296958-67296980 AAATTGACAAACCTTTAGCTAGG - Intronic
1084406061 11:68974390-68974412 GCGTTTACAATCCCTGAGCTAGG + Intergenic
1084840648 11:71843722-71843744 GCATTTACAGTCCTTTAGCTAGG + Intergenic
1088091410 11:106044273-106044295 ATGTTTAAAAACAATTAGCTGGG - Intergenic
1088996415 11:115002313-115002335 AAATTTACAAACCTTTAGCTCGG + Intergenic
1091256198 11:134188173-134188195 GCATTTATAATCCTTTAGCTGGG - Intronic
1092336791 12:7640524-7640546 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1092929701 12:13304368-13304390 GTCTACACAAACTTTTAGCTGGG + Intergenic
1093213282 12:16332941-16332963 GTGTTTACAATCCTTTAGCTAGG + Intergenic
1093506171 12:19869422-19869444 CTCTTTTCAAACCTTCAGCTTGG + Intergenic
1093741282 12:22692903-22692925 GCATTTACAAACCTTGAGCTAGG + Intergenic
1094000264 12:25686986-25687008 GTATTTACAATCCTTTAGCTAGG - Intergenic
1095597242 12:43972771-43972793 CATTTTACAAACCTCTAGCTAGG + Intronic
1095642491 12:44501156-44501178 GCATTTACAAACCTTTAGCTAGG - Intergenic
1095813333 12:46394973-46394995 GAGTTGACAAACCTTTAGGGTGG - Intergenic
1096163918 12:49404445-49404467 GTCTTTACAAAAAATTAGCTGGG - Intronic
1097491036 12:60270229-60270251 GCATTTACAAACCTTTAGCTAGG - Intergenic
1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG + Intergenic
1101021729 12:100559994-100560016 GTATTTACAATCCCTGAGCTAGG - Intronic
1102316972 12:111896350-111896372 GTGTTCACAAACTTCCAGCTTGG - Intronic
1105398582 13:20065821-20065843 GTGATTACAAAACTCTAGCATGG + Intronic
1105477296 13:20739636-20739658 GCATTTACAAACCTTGAACTAGG + Intronic
1105513589 13:21071847-21071869 GTGGTTACAAACCTTAAACGGGG + Intergenic
1106063348 13:26318015-26318037 AAGTTGGCAAACCTTTAGCTAGG + Intronic
1108157041 13:47595975-47595997 GAGTTTACAAACCTTTAGCTAGG - Intergenic
1108845780 13:54677265-54677287 GCATTTACAAACCTTGAGCTAGG - Intergenic
1109007877 13:56901504-56901526 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1109149190 13:58823568-58823590 GCGTTTACAATCCTTTAGCTAGG + Intergenic
1109699757 13:66009842-66009864 GCATTTACAATCCCTTAGCTAGG - Intergenic
1110113031 13:71774904-71774926 GTCTTTACAAACATATCGCTAGG + Intronic
1110622079 13:77608184-77608206 GTGTTGAAAAACCTTTGGATTGG + Intronic
1111197512 13:84894503-84894525 GTGTTTACAATCCTTTAGCTAGG + Intergenic
1111710236 13:91802609-91802631 CCATCTACAAACCTTTAGCTAGG + Intronic
1111729274 13:92052561-92052583 TCATTTACAATCCTTTAGCTAGG + Intronic
1113455679 13:110446854-110446876 TTGTTCACACACCTTTTGCTAGG - Exonic
1114461478 14:22888684-22888706 GTCTTTACAAAAAATTAGCTGGG + Intergenic
1114945864 14:27679208-27679230 GTGTTTACAAATCTTCAATTTGG - Intergenic
1115708535 14:36024672-36024694 GTGGTTACAAAAATATAGCTAGG - Intergenic
1116084347 14:40216820-40216842 GCCTTTACAAACCTTTAGCTAGG + Intergenic
1116152007 14:41153912-41153934 GCGTTTACAATCCCTGAGCTAGG + Intergenic
1117727245 14:58687094-58687116 GCATTTACAAACCTTGAGCTAGG + Intergenic
1117856923 14:60044204-60044226 AAATTGACAAACCTTTAGCTGGG - Intronic
1120064236 14:80021039-80021061 AAGTTAACAAATCTTTAGCTAGG - Intergenic
1120209746 14:81623300-81623322 GTATTTACAAACCCTGAGCTAGG + Intergenic
1121350569 14:93169979-93170001 GTATTTACAATCCCTGAGCTAGG + Intergenic
1124418023 15:29490618-29490640 GTATTTACAATCCTCTAGCTAGG + Intronic
1124828963 15:33129065-33129087 GCATTTACAATCCTCTAGCTAGG + Intronic
1125439590 15:39687643-39687665 TTCTTGACAAACTTTTAGCTTGG - Intronic
1126188186 15:45851102-45851124 CATTTTACAAACCTCTAGCTAGG + Intergenic
1126191843 15:45886221-45886243 GCATTTACAAACCTTTAGCTAGG - Intergenic
1126639766 15:50812462-50812484 GTATTTACAATCCCTTAGCTAGG - Intergenic
1127916527 15:63459540-63459562 GTATTTACAATCCCTTAGCTAGG - Intergenic
1128056699 15:64704877-64704899 GTGTTGAAAAAGCCTTAGCTTGG - Intergenic
1129197035 15:73974414-73974436 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1131507877 15:93032323-93032345 GTTTTTACAATCCCTGAGCTAGG - Intergenic
1136245504 16:28973748-28973770 GTGTTTCAGAACCTTAAGCTTGG - Intergenic
1140185926 16:72771988-72772010 GCGTTTACAATCCTTTAGCTAGG - Intergenic
1141978679 16:87535615-87535637 TGGTTTACAAATCTTGAGCTCGG - Intergenic
1143460408 17:7100297-7100319 GCGTTTACAATCCCTGAGCTAGG + Intergenic
1144128175 17:12221358-12221380 GTATTTACAATCCCTTAGCTAGG - Intergenic
1144748605 17:17633089-17633111 GTGTTTACAAACCTTTAGCTAGG + Intergenic
1146078370 17:29754825-29754847 GTCTTTACAAAAAATTAGCTGGG - Intronic
1146435853 17:32846803-32846825 TTGTTTAAAAAAATTTAGCTGGG - Intronic
1147818307 17:43226178-43226200 GTCTTTACAAAAAATTAGCTAGG + Intergenic
1153431192 18:5019081-5019103 GCCTTCACAATCCTTTAGCTAGG + Intergenic
1154985405 18:21546093-21546115 ATGTATACAAACCATTATCTTGG + Intronic
1155808548 18:30203763-30203785 ATGTTTACAAAACATTAGTTAGG + Intergenic
1155879802 18:31131380-31131402 CAGTTTACAAAACTTTATCTAGG - Intronic
1156324786 18:36064522-36064544 GTGTTTACAAACCTCTAGCTAGG - Intronic
1156372950 18:36487905-36487927 ATGTGTACAAACCTTAGGCTAGG + Intronic
1156488839 18:37484694-37484716 GTGTTTACATACGGTTGGCTTGG + Intronic
1159326196 18:66922383-66922405 GTTTATCCAAACCTTTAGATTGG - Intergenic
1159472832 18:68879700-68879722 GTATTTACAATCCCTGAGCTAGG + Intronic
1162560031 19:11411781-11411803 GTGTCTACAAATAATTAGCTGGG - Intronic
1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG + Intronic
1162987208 19:14278404-14278426 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1168457514 19:56525288-56525310 GTGTGGAAAAACCTTCAGCTCGG + Exonic
1168495938 19:56851114-56851136 AAATTGACAAACCTTTAGCTAGG - Intergenic
925796005 2:7543478-7543500 GTGTTTACAAATGTTTTGTTGGG - Intergenic
925950302 2:8903130-8903152 GCATTTACAAACCTTTAACTAGG + Intronic
926850760 2:17194214-17194236 GCGTTTACAATCCCTGAGCTAGG - Intergenic
927432356 2:23037647-23037669 CTGTTTACAATCCTGTTGCTTGG - Intergenic
930519475 2:52446724-52446746 GGATTTACACACCTTTAGCTAGG - Intergenic
930681763 2:54264398-54264420 GTGTTTACAATCCTCTAGCTAGG + Intronic
933050028 2:77591170-77591192 GCATTTACAAACCTTGAGCTAGG - Intronic
934867854 2:97829273-97829295 GCATTTACAATCCTTTAGCTAGG - Intronic
935414527 2:102801785-102801807 GTGTTTACAAGGCTTTTCCTGGG + Intronic
935429482 2:102959636-102959658 GTGTCTAAAAATCTTTAGGTTGG + Intergenic
937751331 2:125478979-125479001 GGGTTTACAAACCTTGAGCTAGG + Intergenic
938805565 2:134804184-134804206 GCATTTACAAATCTTTAGCAAGG + Intergenic
941309360 2:163910220-163910242 ACATTTACAAACCTTGAGCTAGG - Intergenic
942682540 2:178492777-178492799 GTGGGTACAGACCTTCAGCTGGG + Intronic
942917974 2:181335454-181335476 GTGTTTACCTACCTCTAGCTTGG - Intergenic
943365394 2:186963005-186963027 GCATTTACAAACCTTGAGCTAGG - Intergenic
944838628 2:203604389-203604411 GTGTTTAGATACGTTTAGATGGG + Intergenic
945825759 2:214717903-214717925 GCATTTACAATCCTTTAGCTAGG + Intergenic
946054095 2:216885879-216885901 GCGTTTACAATCCCTGAGCTAGG - Intergenic
948511757 2:238471491-238471513 ATATCAACAAACCTTTAGCTAGG - Intergenic
1168770807 20:415205-415227 GTCTCTACAAAACATTAGCTAGG + Intronic
1171127912 20:22620635-22620657 GTATTTACTCACATTTAGCTCGG + Intergenic
1173165868 20:40687054-40687076 GTATTTACAAGCCTACAGCTGGG + Exonic
1175434569 20:58934631-58934653 TAATTGACAAACCTTTAGCTAGG + Intergenic
1183089051 22:35508846-35508868 GTGTGTACAAACCCTGAGGTGGG - Intergenic
1185229007 22:49669837-49669859 TGATTTACAAACCTTGAGCTAGG + Intergenic
1185229024 22:49669989-49670011 TGATTTACAAACCTTGAGCTAGG + Intergenic
949259072 3:2084123-2084145 GTATTTACAATCCCTGAGCTAGG - Intergenic
949259112 3:2084449-2084471 GTATTTACAATCCCTGAGCTAGG - Intergenic
949734861 3:7160322-7160344 GTGGTTACAAACCAAAAGCTTGG - Intronic
950207980 3:11094536-11094558 GTGTTTACAAACCTTGAGCTAGG - Intergenic
950601323 3:14037702-14037724 GCATTTACAATCCTTTAGCTAGG - Intronic
950852621 3:16077239-16077261 GTATTTACAATCCTTTAGCTAGG - Intergenic
951250090 3:20384226-20384248 ATGTTTACAAAAAATTAGCTGGG + Intergenic
951332866 3:21387075-21387097 GTGTTTACTAACCTTGAGCTAGG + Intergenic
951571512 3:24068179-24068201 TTGTTTCCAAACCTTTACATTGG + Intergenic
952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG + Intronic
952302440 3:32115374-32115396 GCGTTTACAATACTTTAGCTAGG + Intronic
953514855 3:43579982-43580004 GTCTTTACAAAAAATTAGCTGGG + Intronic
954230486 3:49213243-49213265 GCATTTACAAACCTTGAGCTAGG + Intronic
954598563 3:51850033-51850055 GTGTTTACAAACCTTTAGCTAGG - Intergenic
955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG + Intronic
957510589 3:81182731-81182753 GCATTTACAAACCTTTAGCTAGG + Intergenic
957510594 3:81182863-81182885 GCATTTACAATCCTTTAGCTAGG + Intergenic
958883501 3:99699703-99699725 GTGATTAAAAAGTTTTAGCTCGG - Intronic
960063312 3:113346383-113346405 GCACTTACAATCCTTTAGCTAGG - Intronic
960771291 3:121195272-121195294 CGGTTGACAAAACTTTAGCTAGG - Intronic
961572871 3:127813030-127813052 GAGATTAAAAACCTTTAGTTAGG - Intronic
962590953 3:136889656-136889678 GCGTTTACAATCCCTGAGCTAGG + Intronic
962824768 3:139090448-139090470 GTGTTTAAAAATCTTTCACTAGG + Intronic
963021735 3:140878427-140878449 GCATTTACAATCCTTTAGCTAGG - Intergenic
963403098 3:144826562-144826584 GCATTTACAAACCTTTAGCTAGG + Intergenic
963744261 3:149110012-149110034 GTGTTTACAATCCCTGAGCTAGG - Intergenic
964618552 3:158696707-158696729 GTGTGTAAAAACCTTGAGCCAGG - Intergenic
965943337 3:174211338-174211360 GCGTTTACAATCCCTGAGCTAGG + Intronic
966186066 3:177228404-177228426 GCGTTTACAATCCTCCAGCTAGG + Intergenic
966529670 3:180961544-180961566 CCGTATACAAACCTTTAGATAGG - Exonic
970574469 4:17413928-17413950 GCATTTACAATCCTTTAGCTAGG + Intergenic
971430578 4:26562279-26562301 AAGTTGACAAATCTTTAGCTAGG - Intergenic
972913408 4:43846791-43846813 GCATTTACAATCCTGTAGCTAGG - Intergenic
973142194 4:46782408-46782430 GCATTTACAATCCTTTAGCTAGG - Intronic
973146417 4:46831585-46831607 GTGTTTACAAACCTTGAGCTAGG - Intronic
976596967 4:86904012-86904034 GCATTTACAATCCTTTAGCTAGG + Intronic
977172693 4:93782274-93782296 GTGTTTAGAAACATTTATTTTGG - Intergenic
977751423 4:100614336-100614358 GTGTTTCAAAATCTTTATCTTGG + Intronic
978809182 4:112831302-112831324 GCATTTACAATCCTTTAGCTAGG - Intronic
979172593 4:117620988-117621010 GTATTTAGAAACATTTACCTGGG - Intergenic
982063707 4:151631220-151631242 AGATTCACAAACCTTTAGCTAGG + Intronic
982629273 4:157811242-157811264 GAGATTCCAACCCTTTAGCTGGG - Intergenic
983660610 4:170127549-170127571 GCCTTTACAAACCTTTAGCTAGG + Intergenic
983736960 4:171073539-171073561 GCGTTTACAGTCCTTTAGCTAGG + Intergenic
983834142 4:172369226-172369248 GCATTTACAATCCTCTAGCTAGG + Intronic
983922322 4:173359238-173359260 GCATTTACAACCCTTTAGCTAGG - Intergenic
984180484 4:176476807-176476829 GCGTTTACAATCCTTTAGCTAGG + Intergenic
984391492 4:179139544-179139566 GTGTTTACAAATCTTTTGTCAGG - Intergenic
986828607 5:11550091-11550113 GTGTTTTCAAACAATTAGCATGG - Intronic
986963698 5:13244920-13244942 GTATTTACAATCCCTTAGCTAGG - Intergenic
987923273 5:24310498-24310520 GCATTTACAATCCTTTAGCTAGG - Intergenic
989759139 5:44991007-44991029 GAATGGACAAACCTTTAGCTTGG + Intergenic
990367325 5:55084586-55084608 GCATTTACAATCCTTTAGCTAGG + Intergenic
992083188 5:73254384-73254406 GTGTTTACTGACCTTTACCAAGG + Intergenic
993202101 5:84829980-84830002 GCGTTTACAAACCTTTAGCTAGG + Intergenic
993803447 5:92374757-92374779 GTATTTACAATCCCTTAGCTAGG + Intergenic
994925283 5:106109843-106109865 GTGTTTACAAAATATTTGCTAGG + Intergenic
995920537 5:117305598-117305620 GTATTTACAATCCCTGAGCTAGG - Intergenic
996478592 5:123948852-123948874 GTATTTACAGACCTTGAGCTAGG + Intergenic
999900739 5:156084120-156084142 GTGTCTACAAAAATTTTGCTTGG + Intronic
1000535447 5:162472576-162472598 GCATTTACAATCCTTTAGCTAGG - Intergenic
1002291277 5:178202684-178202706 GTGTTTACAAAAAATTCGCTTGG + Intergenic
1003578234 6:7316687-7316709 GTGTTTATAATCCCTCAGCTAGG + Intronic
1003581552 6:7344922-7344944 GCGTTTACAATCCCTGAGCTAGG - Intronic
1003806146 6:9727748-9727770 GCATTTACAAACCTTTACCTAGG - Intronic
1003881289 6:10482393-10482415 GCATTTACAAACCTTGAGCTAGG + Intergenic
1003947365 6:11087711-11087733 GTATTTACAATCCCTGAGCTAGG - Intergenic
1004037080 6:11933694-11933716 GTATTTACAATCCCTGAGCTAGG - Intergenic
1005766429 6:29015856-29015878 GCATTTACAAACCTTGAGCTAGG - Intergenic
1006095613 6:31654518-31654540 GTGTCTACAAAAAATTAGCTAGG + Intronic
1006759736 6:36449549-36449571 GCGTTTACAATCCTTTAGCTAGG + Intronic
1009690955 6:67031347-67031369 GTGTTTACAAAGCTTTAGCTAGG - Intergenic
1010485657 6:76410225-76410247 CAATTAACAAACCTTTAGCTAGG - Intergenic
1011404394 6:87002725-87002747 GGGTTTATAATCCTCTAGCTAGG + Intronic
1012440475 6:99257588-99257610 GTGTCTACAAAAATTTAGCCAGG - Intergenic
1012736188 6:102947990-102948012 TTTTTTACAAACCTCTACCTTGG - Intergenic
1012789636 6:103676943-103676965 GCGTTTACAATCCTTTAGCTAGG + Intergenic
1013316959 6:108952275-108952297 GTTTTTACAAACCCTAAGCTGGG - Intronic
1014579045 6:123111824-123111846 GCATTTACAAACCTTTAGCTAGG - Intergenic
1014940164 6:127428921-127428943 GCATTTACAAACCTTTAGCTAGG + Intergenic
1014940167 6:127428962-127428984 GTGTTTACAATCCTTTAGCTAGG + Intergenic
1015479774 6:133695466-133695488 GTGTTTAGAAACCAATAACTGGG + Intergenic
1015665722 6:135626315-135626337 GCGTTTACAATCCTTTTGCTAGG + Intergenic
1017017755 6:150115739-150115761 GCATTTACAATCCTTTGGCTAGG + Intergenic
1017537469 6:155363609-155363631 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1019944157 7:4313681-4313703 GTATTTACAATCCTTGAGCTAGG + Intergenic
1019965647 7:4496674-4496696 GTATTTACAATCCTTGAGCTAGG + Intergenic
1020126856 7:5537860-5537882 GTCTCTACAAAACATTAGCTGGG - Intronic
1020164028 7:5794232-5794254 CTATTTACAAACCCTGAGCTAGG - Intergenic
1020528108 7:9290398-9290420 AAATTGACAAACCTTTAGCTAGG - Intergenic
1021200162 7:17719969-17719991 GTGTTTAGAAACCAATATCTAGG - Intergenic
1021547136 7:21826638-21826660 GGGTTTACAAACATTTTCCTTGG + Intronic
1021567469 7:22029136-22029158 GTATTTACAATCCCTTAGCTAGG - Intergenic
1022209476 7:28194758-28194780 ATGTTTACAAAAAATTAGCTGGG - Intergenic
1022450313 7:30507738-30507760 GCGTTTACAAACCTTTAGCTAGG + Intronic
1022530978 7:31066752-31066774 GTGTTGAGAACCCTTGAGCTAGG + Intronic
1023151459 7:37204894-37204916 GCGTTTACAATCCTATAGCTAGG + Intronic
1024735690 7:52302428-52302450 GTGTTTACAATCCCTGAGCTAGG + Intergenic
1027339249 7:77188388-77188410 ATGATTATAAACCTTTAGTTGGG - Intronic
1027579605 7:79977310-79977332 GTGTTTACAAACCTTGAGCTAGG + Intergenic
1027590556 7:80113721-80113743 ACATTTACAATCCTTTAGCTAGG - Intergenic
1028957959 7:96714851-96714873 ATCTTTACAAAACATTAGCTGGG - Intergenic
1030834274 7:114263950-114263972 GTGTTTTAAAATCTTTAGCTTGG + Intronic
1031409322 7:121422425-121422447 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1032097148 7:128945271-128945293 GTCTTTACAAAAAATTAGCTGGG - Intronic
1033765595 7:144486813-144486835 GTATTTCACAACCTTTAGCTTGG + Intronic
1034209019 7:149346088-149346110 AAATTTACAAATCTTTAGCTAGG + Intergenic
1037173774 8:15923840-15923862 GCGTTTACCAACCTTGAGCAAGG - Intergenic
1037811942 8:22091728-22091750 GTCTTTGAAAACCTTGAGCTGGG - Intronic
1037944344 8:22977409-22977431 GTCTCTACAAAACATTAGCTGGG + Intronic
1038312938 8:26458987-26459009 ATGTTTACAGAGCTTTAGTTTGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1040486330 8:47875358-47875380 GAGTTGACAAACCATTAGCTAGG - Intronic
1040804459 8:51378412-51378434 GAGTTTACAATCCCTGAGCTAGG - Intronic
1043945621 8:86248676-86248698 GAACTGACAAACCTTTAGCTAGG - Intronic
1045204782 8:100027058-100027080 GTCTCTACAAAACATTAGCTGGG + Intronic
1045790820 8:105981869-105981891 AAATTCACAAACCTTTAGCTGGG + Intergenic
1047394610 8:124484145-124484167 GTGTTTACATTCTTTTTGCTTGG - Intronic
1047991338 8:130289725-130289747 GTATCCACAATCCTTTAGCTGGG + Intronic
1048089558 8:131224448-131224470 GTTGTTACAAACAATTAGCTTGG - Intergenic
1050898319 9:10911544-10911566 GCGTTTACAAACGTTTAGAATGG - Intergenic
1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1051425008 9:16924240-16924262 GCGTTTACAAACCTTGAGCTAGG + Intergenic
1051934839 9:22434147-22434169 GTGTTTACAAACTTTTAGCTAGG - Intergenic
1053389227 9:37722067-37722089 GTGTTTACAAATCTTAATTTTGG - Intronic
1055382263 9:75721310-75721332 GTGTTCACAAAGCTTTACCATGG - Intergenic
1055925733 9:81508067-81508089 GCGTTTACAAACCTTGAGCTAGG - Intergenic
1056743843 9:89282958-89282980 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1056914139 9:90730106-90730128 GTGTTTACAATCCCTGAGCTAGG - Intergenic
1057517045 9:95730518-95730540 CTGTTTACACACCTTTGTCTAGG + Intergenic
1057808588 9:98240073-98240095 AAGTTGACAAACCTTTAGCTAGG - Intronic
1059239317 9:112789473-112789495 GTGTTTAAATAACTTTAGTTGGG - Intronic
1059469917 9:114496996-114497018 GTGTTTCCCAAACTTTAGCATGG + Intronic
1203782307 EBV:107458-107480 GTAGTTACAAACCTGTACCTGGG + Intergenic
1188766281 X:34095912-34095934 GCATTTACAAACTTTTAGCTAGG + Intergenic
1188861057 X:35257174-35257196 GTTTATACAAACTTTTAGTTTGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189360592 X:40347694-40347716 AAATTTACAAACCTTTAGCTAGG - Intergenic
1190191160 X:48278341-48278363 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1192241661 X:69335441-69335463 GAATTGACAAACCATTAGCTAGG - Intergenic
1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG + Intronic
1193888512 X:87013398-87013420 GCATTTACAATCCTTTAGCTAGG + Intergenic
1194168564 X:90553549-90553571 GCATTTACAATCCTTTAGCTAGG + Intergenic
1196896136 X:120337972-120337994 GTGTTTAAAAATCTAAAGCTTGG + Intergenic
1197078924 X:122388852-122388874 GCATTTACAATCCTTTAGCTAGG + Intergenic
1198230070 X:134680662-134680684 GATTTTCCAAACCCTTAGCTGGG - Intronic
1198378776 X:136064796-136064818 GTGTTTACATACCTTTAGTGTGG - Intergenic
1198982257 X:142412151-142412173 AAGTTGACAAACCTTTAGCCAGG + Intergenic
1199082140 X:143588882-143588904 GCATTTACAATCCTCTAGCTAGG + Intergenic
1200514806 Y:4131333-4131355 GCATTTACAATCCTTTAGCTAGG + Intergenic
1200750357 Y:6939326-6939348 GTGTTTACAAACCTTTAGCTAGG + Intronic
1200888757 Y:8299112-8299134 GTATTTACAATCCCTGAGCTAGG - Intergenic
1201485881 Y:14494148-14494170 GTGTTTACAATCCCTTAGCAAGG + Intergenic
1201499434 Y:14626785-14626807 GCATTTACAATCCTCTAGCTAGG + Intronic
1201556389 Y:15267776-15267798 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1201901022 Y:19046429-19046451 GTATTTACAATCCCTTAGCTAGG + Intergenic
1202100487 Y:21303244-21303266 GCATTTACAAACCTTGAGCTAGG + Intergenic
1202192991 Y:22263037-22263059 GCATTTACAATCCTTTAGCTAGG + Intergenic