ID: 1144754890

View in Genome Browser
Species Human (GRCh38)
Location 17:17673456-17673478
Sequence GATAATGAATGCTCAGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144754890_1144754893 30 Left 1144754890 17:17673456-17673478 CCCATAGCTGAGCATTCATTATC No data
Right 1144754893 17:17673509-17673531 GAATATATTTAGTACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144754890 Original CRISPR GATAATGAATGCTCAGCTAT GGG (reversed) Intergenic
No off target data available for this crispr