ID: 1144755473

View in Genome Browser
Species Human (GRCh38)
Location 17:17677934-17677956
Sequence GTGGGCTGGGCTAGCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144755473_1144755480 10 Left 1144755473 17:17677934-17677956 CCAGGAGAGCTAGCCCAGCCCAC No data
Right 1144755480 17:17677967-17677989 TAGCCCAGTGAAACTGATTTTGG 0: 9
1: 53
2: 136
3: 286
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144755473 Original CRISPR GTGGGCTGGGCTAGCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr