ID: 1144756156

View in Genome Browser
Species Human (GRCh38)
Location 17:17681763-17681785
Sequence CCGCGCTCACTCGGGGGCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144756156_1144756168 10 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756168 17:17681796-17681818 GAGCAGCGAGCGCCGGGGCGCGG 0: 1
1: 0
2: 3
3: 23
4: 285
1144756156_1144756167 5 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756167 17:17681791-17681813 GAGGTGAGCAGCGAGCGCCGGGG 0: 1
1: 0
2: 1
3: 17
4: 156
1144756156_1144756169 11 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756169 17:17681797-17681819 AGCAGCGAGCGCCGGGGCGCGGG 0: 1
1: 1
2: 2
3: 18
4: 217
1144756156_1144756171 13 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756171 17:17681799-17681821 CAGCGAGCGCCGGGGCGCGGGGG 0: 1
1: 1
2: 3
3: 33
4: 331
1144756156_1144756166 4 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756166 17:17681790-17681812 CGAGGTGAGCAGCGAGCGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 125
1144756156_1144756170 12 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756170 17:17681798-17681820 GCAGCGAGCGCCGGGGCGCGGGG 0: 1
1: 0
2: 3
3: 32
4: 278
1144756156_1144756172 14 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756172 17:17681800-17681822 AGCGAGCGCCGGGGCGCGGGGGG 0: 1
1: 1
2: 5
3: 27
4: 329
1144756156_1144756165 3 Left 1144756156 17:17681763-17681785 CCAAGGCCCCCGAGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1144756165 17:17681789-17681811 CCGAGGTGAGCAGCGAGCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144756156 Original CRISPR CCGCGCTCACTCGGGGGCCT TGG (reversed) Exonic
900193162 1:1359958-1359980 CGTCGCACACTCTGGGGCCTTGG + Intronic
900411580 1:2514953-2514975 CAGAGCTCACTCCGGGTCCTGGG + Intronic
904773373 1:32893293-32893315 CCGCGCTCCCTTGGAGGGCTGGG - Intronic
907294239 1:53439417-53439439 GCGCACTCACTCAGGGGCCGCGG + Intergenic
909958011 1:81802090-81802112 CCGCGCGGACTCGGCGGCCGAGG + Intronic
914255970 1:145961420-145961442 CCGAGATCACGCGGGCGCCTCGG - Exonic
1062952529 10:1515579-1515601 ACGGGGTCACTCTGGGGCCTGGG - Intronic
1062958837 10:1558045-1558067 CCACGCTCACTGCTGGGCCTGGG - Intronic
1076637190 10:131889802-131889824 CCGCGCTCACTGCCGGGCCCAGG + Intergenic
1076707281 10:132308602-132308624 GCGCGCACACGCGGGCGCCTGGG + Intronic
1080386222 11:31812653-31812675 CCGAGCTCTCTCGGCGGCTTCGG + Intronic
1083423590 11:62570804-62570826 CCGAGCACACTGGGGGGCCGAGG - Intronic
1084310269 11:68312665-68312687 CCGCGCTCACTCGGGCTCCATGG - Exonic
1087118111 11:94544986-94545008 CAGCGCTGGCCCGGGGGCCTGGG - Exonic
1089750659 11:120648976-120648998 CCAGGCTCCCTCGGGGGCCAAGG - Intronic
1095982192 12:47979999-47980021 CCTCACTCACCGGGGGGCCTTGG + Exonic
1096459384 12:51814041-51814063 GCGCGCGCCCCCGGGGGCCTGGG - Intergenic
1102822135 12:115917124-115917146 CCGCGCTGAGTCGGGGCCCCCGG - Intergenic
1103856206 12:123972782-123972804 CCGCGCTGACCCGGCGGGCTAGG + Exonic
1119421292 14:74509375-74509397 CAGCGCTCGCCCGGGGACCTAGG + Intronic
1123004524 14:105314885-105314907 CGCCGCTCCCTCGGCGGCCTGGG - Exonic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1123473577 15:20571725-20571747 CCTGGCTCACCCGGTGGCCTCGG + Intergenic
1123644432 15:22428628-22428650 CCTGGCTCACCCGGTGGCCTCGG - Intergenic
1123665748 15:22608536-22608558 CCTGGCTCACCCGGTGGCCTCGG - Intergenic
1123733875 15:23166736-23166758 CCTGGCTCACCCGGTGGCCTCGG + Intergenic
1124284378 15:28388041-28388063 CCTGGCTCACCCGGTGGCCTCGG + Intronic
1124298319 15:28523573-28523595 CCTGGCTCACCCGGTGGCCTCGG - Intronic
1124319569 15:28702950-28702972 CCTGGCTCACCCGGTGGCCTCGG - Intronic
1124482942 15:30092481-30092503 CCTGGCTCACCCGGTGGCCTCGG + Intronic
1124489394 15:30144552-30144574 CCTGGCTCACCCGGTGGCCTCGG + Intronic
1124520635 15:30404737-30404759 CCTGGCTCACCCGGTGGCCTCGG - Intronic
1124538022 15:30561482-30561504 CCTGGCTCACCCGGTGGCCTCGG + Intronic
1124544482 15:30613543-30613565 CCTGGCTCACCCGGTGGCCTCGG + Intronic
1124564445 15:30800978-30801000 CCTGGCTCACCCGGTGGCCTCGG + Intergenic
1124626790 15:31312339-31312361 CAGAGCTCACCAGGGGGCCTTGG - Intergenic
1124754135 15:32393775-32393797 CCTGGCTCACCCGGTGGCCTCGG - Intronic
1124760628 15:32446103-32446125 CCTGGCTCACCCGGTGGCCTCGG - Intronic
1124778004 15:32602959-32602981 CCTGGCTCACCCGGTGGCCTCGG + Intronic
1127071329 15:55290261-55290283 CCGCGCGGACTCGGGAACCTCGG - Intronic
1131122266 15:89830026-89830048 CAGTTCTCACTCGGGGGGCTGGG + Intergenic
1132929522 16:2451745-2451767 CCTCCCTCCCTCGGGGGCTTCGG + Intronic
1133023908 16:2979576-2979598 CCTGGCACACTCGGGGACCTGGG + Intronic
1135207039 16:20492625-20492647 CTCCGCACCCTCGGGGGCCTGGG + Intergenic
1135211846 16:20531007-20531029 CTCCGCACCCTCGGGGGCCTGGG - Intergenic
1141631693 16:85291477-85291499 CAGGGCTCACGCGGGGGCCGGGG - Intergenic
1142177306 16:88651101-88651123 CCGCGGTCACCTGGGGGGCTGGG - Exonic
1144756156 17:17681763-17681785 CCGCGCTCACTCGGGGGCCTTGG - Exonic
1145273449 17:21416693-21416715 CCGCGGTCGCTCAGGGGCCCCGG + Exonic
1145311640 17:21704137-21704159 CCGCGGTCGCTCAGGGGCCCTGG + Exonic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1152283963 17:79401834-79401856 CCGCGCTCCCTCGGGAGGCTGGG - Intronic
1162741913 19:12778335-12778357 CCGTACGCACCCGGGGGCCTCGG + Intronic
1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG + Exonic
1163440571 19:17320618-17320640 CCGGCCTCATCCGGGGGCCTGGG + Exonic
927881168 2:26691312-26691334 CTGCTCTCAGTCAGGGGCCTTGG + Intergenic
927917599 2:26947004-26947026 GCGTCCTCACTCGGGGGGCTTGG - Exonic
931708730 2:64969312-64969334 CGGCGCTCACTGGGGAGGCTGGG - Intergenic
942446776 2:176083382-176083404 CTTCGCTCCCCCGGGGGCCTCGG - Exonic
947641259 2:231708971-231708993 CCGGGCGCCCTCGGGGGCCGAGG + Intronic
948983145 2:241505252-241505274 CAACGCTTACTCGGGGCCCTGGG + Intronic
1176118609 20:63444178-63444200 TCTCGGTCACTGGGGGGCCTGGG + Intronic
1176223195 20:63979593-63979615 TCGCGCACACTCGCGGGCCGCGG - Exonic
1184452280 22:44590432-44590454 CCTCGCTCACAGGGTGGCCTTGG - Intergenic
1185280537 22:49967985-49968007 CCTGGCTCACTCGGCAGCCTTGG - Intergenic
949947880 3:9204396-9204418 CCCCGCTCACTCCTGGGCCTGGG + Intronic
950531026 3:13552473-13552495 CCACCCACACTCGGGGACCTGGG - Intronic
960281240 3:115783971-115783993 GCGCGCGCACACGGGGTCCTGGG - Intergenic
966941774 3:184752491-184752513 ACCCCCTCCCTCGGGGGCCTGGG + Intergenic
969530730 4:7728917-7728939 CCTCTCTCACTTGGGGGCCAAGG - Intronic
969691517 4:8706585-8706607 CCCCGCTCCCTCTGGGGCCCTGG - Intergenic
969711360 4:8846140-8846162 ACGCGGTCACTCGGGGGTCCAGG + Intronic
972671421 4:41216318-41216340 CCGCTCTCTCTCGGGGGTCCGGG + Intronic
984667840 4:182448263-182448285 CCGCGCTCGCCCCTGGGCCTCGG - Intronic
991436087 5:66597585-66597607 CCGCGCTCCCTCGGTGGCGCTGG + Intronic
997361645 5:133299091-133299113 CACTGCTCACTCTGGGGCCTGGG + Intronic
997608517 5:135193634-135193656 GCGGAATCACTCGGGGGCCTTGG - Intronic
1001686632 5:173598520-173598542 CCCTGCTCCCTCGGGGGGCTGGG + Intergenic
1003139011 6:3456285-3456307 CTGCCCTTCCTCGGGGGCCTGGG - Exonic
1006794474 6:36722781-36722803 CCGCTCTCACTCGTTGGCCCTGG - Intronic
1007793393 6:44327560-44327582 CCACACTCACTCAGGGCCCTTGG + Intronic
1011734330 6:90296625-90296647 CCCGGCGCACTCGGGGGGCTGGG - Exonic
1014718605 6:124892282-124892304 CAGCGCTCACTGGGGAGGCTCGG - Intergenic
1017743144 6:157424851-157424873 CCCAGCTGACTCTGGGGCCTGGG - Intronic
1018998641 6:168729165-168729187 CCATGCTCCCTCGGGAGCCTTGG + Intergenic
1019313665 7:374891-374913 CAGGGCTCACTCAGCGGCCTGGG - Intergenic
1019429620 7:992665-992687 CCGGCCTCACTCTGGGACCTGGG + Intergenic
1020131730 7:5562690-5562712 CAGCGCTCACCTGGGGGACTTGG - Intronic
1022129920 7:27395677-27395699 TGGCTCTCACTCAGGGGCCTGGG - Intergenic
1031786471 7:126040479-126040501 CCAGGCACTCTCGGGGGCCTAGG + Intergenic
1032062471 7:128736572-128736594 CTGCTCTCACTCGATGGCCTCGG + Intergenic
1039868964 8:41529384-41529406 CGACGCTCACTCGGGGACCTGGG - Exonic
1049662670 8:143827035-143827057 CAGCGCTCACTGTGGAGCCTGGG - Intronic
1049845487 8:144798915-144798937 CCGCGCTGTCTCGGCGGCCCAGG + Exonic
1060527479 9:124328600-124328622 CCGCAGGCACTCGGGGGTCTGGG - Intronic
1061849193 9:133404685-133404707 CAGAGCTCACACAGGGGCCTGGG - Intronic
1062517799 9:136944827-136944849 CTGCGCGCACTCGGGCGCATTGG + Intronic
1198570130 X:137945906-137945928 CCAAGTTCAATCGGGGGCCTTGG + Intergenic