ID: 1144757148

View in Genome Browser
Species Human (GRCh38)
Location 17:17686603-17686625
Sequence GTGTGTGCACGCGCGCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 2, 2: 8, 3: 44, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144757143_1144757148 29 Left 1144757143 17:17686551-17686573 CCACTGGTTCTTGAACCCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG 0: 1
1: 2
2: 8
3: 44
4: 169
1144757145_1144757148 13 Left 1144757145 17:17686567-17686589 CCGTGTGTGTGTGTGTGTGTGTG 0: 1789
1: 2002
2: 2702
3: 4398
4: 7597
Right 1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG 0: 1
1: 2
2: 8
3: 44
4: 169
1144757144_1144757148 14 Left 1144757144 17:17686566-17686588 CCCGTGTGTGTGTGTGTGTGTGT 0: 1491
1: 2524
2: 3655
3: 5497
4: 10599
Right 1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG 0: 1
1: 2
2: 8
3: 44
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144757148 Original CRISPR GTGTGTGCACGCGCGCGCCG GGG Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
903353571 1:22732528-22732550 CTGTGTGCACACGCGCACTGAGG - Intronic
907387867 1:54137699-54137721 GTGTGTGCATGCGGGGGCAGGGG + Intronic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
912435176 1:109656580-109656602 GTGTGTGTGTGCGTGCGCCGGGG + Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915549912 1:156625778-156625800 GTGTGTGCACGCTCATGTCGGGG + Intergenic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
921217730 1:212951450-212951472 GTGTGCGCGCGGGCGCGGCGAGG - Exonic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
924799340 1:247316229-247316251 GTGTGTGTGAGCGCGCGCAGTGG + Intronic
1063114970 10:3067041-3067063 GTGAGTGGGCGCGAGCGCCGGGG - Intronic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1064306826 10:14174913-14174935 GTGTGTGGACGCGCGCGTACGGG + Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1072881254 10:99232196-99232218 GTGTATGCGCGCGCGCGCGTTGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074843329 10:117375638-117375660 GTGGGTGGCGGCGCGCGCCGCGG - Intergenic
1078090800 11:8263267-8263289 GTGTGTGTGCCTGCGCGCCGCGG + Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1082035554 11:47642567-47642589 GCGTGCGTGCGCGCGCGCCGCGG - Exonic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1089169277 11:116500853-116500875 GCGGGTGCACGCGGGGGCCGGGG - Intergenic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1094163697 12:27420004-27420026 GTGTGTGCACGCGCAAACCCTGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1097195520 12:57240558-57240580 GTGTGTGTGTGCGCGCGCCGGGG - Intronic
1097232434 12:57520834-57520856 GTGTCTGCACGCGCACGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1102645518 12:114401071-114401093 GCATGTGCACGCGCGCGCCCAGG - Intronic
1103560942 12:121793129-121793151 GTGAGTGCGCCTGCGCGCCGGGG - Intronic
1105438119 13:20394631-20394653 GTGTGTGTCCGCGCGCGCTCAGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1107359464 13:39603142-39603164 GTGGGCGCGCGCGGGCGCCGGGG + Exonic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1107996750 13:45868659-45868681 GTATGTGCATGCGCGCGCACGGG + Intergenic
1108530891 13:51326038-51326060 GTGTGTGCGCGCGCGCACGTGGG + Intergenic
1111343437 13:86917682-86917704 GTGTGTGCGCGCGCACGTGGTGG - Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1113653938 13:112056727-112056749 GTGTGCGCGCGCGCGAGGCGAGG + Intergenic
1113667518 13:112151088-112151110 GTGTGTGTGCGCGCTTGCCGTGG - Intergenic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1121421258 14:93816893-93816915 GTGTGTGCAGGCACGCCCCTGGG - Intergenic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1126725043 15:51622985-51623007 GTTTGCGCGTGCGCGCGCCGTGG + Intergenic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129687151 15:77693061-77693083 GTGTGTGCACGCGTGCACATGGG - Intronic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1136623123 16:31443099-31443121 GTGTGTGCATGCGCATGGCGCGG - Intronic
1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG + Intergenic
1141870177 16:86779860-86779882 GGGTGTGCACCCTGGCGCCGAGG - Intergenic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1143503290 17:7351173-7351195 GGGTGGGAACGTGCGCGCCGCGG - Intronic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144624140 17:16836160-16836182 GTGTGTGCACGCACACACGGTGG - Intergenic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1144801159 17:17928576-17928598 GTGTGTGCATGCTCACGCGGGGG - Intronic
1144882286 17:18436559-18436581 GTGTGTGCACGCACACACGGTGG + Intergenic
1145149948 17:20507827-20507849 GTGTGTGCACGCACACACGGTGG - Intergenic
1146634935 17:34496859-34496881 GTGTGTGCGTGCGCGCACCCAGG - Intergenic
1146972048 17:37081338-37081360 GTGTATGCACGCGCGCGTGGGGG + Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1150802359 17:68291872-68291894 GGGGGAACACGCGCGCGCCGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153688630 18:7568728-7568750 GTGCCTGCACGCGCGCGCGGGGG + Intronic
1153923166 18:9809050-9809072 GTGTGTGCGCGCGCACGCGTGGG + Intronic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1160334602 18:78027481-78027503 GTGTGTGCGTGCGTGCGCCTGGG - Intergenic
1161264778 19:3359276-3359298 GTGTGTGTGCGCGCGCGCCGCGG + Intergenic
1162435234 19:10654302-10654324 GGGCGGGCAGGCGCGCGCCGGGG - Exonic
1163804126 19:19385918-19385940 GGGTGCGCGTGCGCGCGCCGGGG - Exonic
1166017953 19:39997329-39997351 GTGTGTGTGTGCGCGCGACGGGG + Intronic
1166126019 19:40715863-40715885 GTGTGTGTGCGCGCGCGCGTTGG + Intronic
1166139676 19:40799337-40799359 GGGTGTGGGGGCGCGCGCCGGGG + Intronic
1166302186 19:41917608-41917630 GTGTGTGCATGCGGGGGCGGCGG - Intronic
1167102726 19:47414175-47414197 GTGTGTGCAAGAGGGCACCGTGG + Intronic
1167309581 19:48729245-48729267 GTGGCTGCCCGCGCGCCCCGGGG - Exonic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926435795 2:12836256-12836278 GTGTGTGCGCACACGCGCTGAGG + Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
930003444 2:46877553-46877575 GTTTGTGCACGCGCGTGTCTGGG - Intergenic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
937216174 2:120315042-120315064 GTGTGTGGACGAGTGTGCCGGGG - Intergenic
937913837 2:127089349-127089371 GTGTGTACACGCGCCAGCCTGGG - Intronic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
941580808 2:167293576-167293598 GTGTGTGCGCGCGCGCGGCTTGG + Intergenic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1169118620 20:3082816-3082838 GTGTGAGCACGGGCGCCCTGGGG + Intronic
1169832240 20:9838174-9838196 GTGTGTGCGCGCGCGCCTGGTGG - Intronic
1170960255 20:21019491-21019513 GTGTGTGCGCGCGCGCGGCAGGG - Intergenic
1171963725 20:31514400-31514422 GTGTGCGCGCGTGCGCGGCGCGG + Intergenic
1172118302 20:32584122-32584144 GTGTGTGTGTGCGCGCGCGGAGG - Intronic
1173429589 20:42974458-42974480 GTGTGTGCGCGCGTGCACTGAGG - Intronic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180997212 22:19971505-19971527 GTGTGTGCACGTGCCCGCCCTGG - Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181495349 22:23284458-23284480 GTGTGTGCACGCCTATGCCGAGG - Intronic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182603998 22:31489575-31489597 GTGCGTGAGCGCGGGCGCCGGGG - Exonic
951640599 3:24830439-24830461 GTGTACGTGCGCGCGCGCCGTGG + Intergenic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
956897257 3:73675471-73675493 GTGTGTGCACCCACGCGTGGTGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
960047441 3:113211695-113211717 GTGTCTGTGCGCGCGCGCGGCGG - Exonic
963228743 3:142888925-142888947 GTGTGCCGGCGCGCGCGCCGTGG - Exonic
963448725 3:145449208-145449230 GTGTGTGCACGCGTGCACCATGG + Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967118498 3:186362332-186362354 GTGTGTGTACGCGCGCGCGCCGG - Intergenic
967858504 3:194135024-194135046 GTGTGTGTGCGCGCGCCCCGGGG - Intergenic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
975050906 4:69863601-69863623 GTGTGTGCACATGCACGCCCAGG + Intergenic
978384967 4:108169151-108169173 GTGTGTGCGCGCGCGCCTGGAGG + Intergenic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
985589194 5:755943-755965 GTGAGTGCCCGCCCTCGCCGAGG - Intronic
985603873 5:848459-848481 GTGAGTGCCCGCCCTCGCCGAGG - Intronic
985780990 5:1871724-1871746 GTGTTGGCACGCGGGCGCCCTGG - Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
995250157 5:109983944-109983966 GTGTGTGCGCACGCGCACAGTGG - Intergenic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1003030766 6:2598748-2598770 GTGTGTGTGTGCGCGCGCTGGGG + Intergenic
1004193626 6:13486208-13486230 GGTTGTGCGCGCGCGCGCCTGGG - Intronic
1005942621 6:30571924-30571946 GTGTGTGTATGCGCGCGCAGGGG - Intronic
1013272859 6:108559598-108559620 GGGTGTCCGGGCGCGCGCCGTGG - Intergenic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1019127906 6:169853544-169853566 GTGTGTGCACACACGTGCCCTGG + Intergenic
1019540956 7:1550749-1550771 GTGCGTGCACGCAGGCCCCGGGG + Intronic
1019711353 7:2519574-2519596 GGGCGTGCACGTGCGCGCCGGGG + Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1024255361 7:47536716-47536738 GTGTGTGCACGCGCAGGACAAGG - Intronic
1026665604 7:72337393-72337415 GTGTGAGTGCGCGCGCGCCGAGG - Intronic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1034400393 7:150857958-150857980 GGGTGTGCAGGCGAGTGCCGTGG - Exonic
1035271134 7:157720579-157720601 GGGTGTGCACGCGGGGACCGAGG + Intronic
1036762041 8:11515966-11515988 GGGTGTGCACTCGCGTGCCTGGG + Intronic
1037823672 8:22148005-22148027 GTGTGTACAGGCGCACCCCGTGG - Exonic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1038644714 8:29351930-29351952 GTTTGTGCACGCACGCGGTGGGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1040928824 8:52713924-52713946 GTGTGTGCACGGGAGGGCCCCGG - Intronic
1042206670 8:66336404-66336426 GTGTGTGCATGCACGTGCCTTGG - Intergenic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1046094345 8:109539853-109539875 TTGTGTGCGCGCGCGGCCCGCGG + Intronic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048484255 8:134832340-134832362 GTGTGTGTGCGCGCGCGCGTGGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1056910895 9:90699514-90699536 GTGTGTGTGTGCGCGCGGCGGGG - Intergenic
1057401616 9:94728224-94728246 GTGTGTGCATGCGCGCACGCAGG - Intronic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1062104286 9:134744914-134744936 GTGTGTGCACGTGCACGCCTGGG - Intronic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062262737 9:135670993-135671015 CTGTGTGCACACGTGCACCGGGG + Intergenic
1062494193 9:136823909-136823931 GAGTGGGCACGCGGGCGCCTCGG + Intronic
1186209982 X:7240450-7240472 GTGTGTGCGCGCGCGCTCCTTGG - Intronic
1186490594 X:9969422-9969444 GTGTGTGCGCGCGTGCACTGGGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1194035536 X:88866238-88866260 GTGTGTGCGCGCGCGCAAAGGGG + Intergenic
1196684075 X:118495912-118495934 GTGAGTCCACCCGCCCGCCGAGG + Exonic
1197559848 X:128006303-128006325 GTGTGTGCACGCGCACGCGTGGG - Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1198534730 X:137574587-137574609 GTGTGCGCCTGCGCGCGGCGCGG - Intronic