ID: 1144757867

View in Genome Browser
Species Human (GRCh38)
Location 17:17691185-17691207
Sequence ACCAAAAATGTCTCCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 2, 1: 21, 2: 56, 3: 108, 4: 254}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144757867_1144757870 -9 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757870 17:17691199-17691221 ATTTTTGGTTGTCTCAGCTGGGG 0: 1
1: 26
2: 159
3: 504
4: 1064
1144757867_1144757869 -10 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757869 17:17691198-17691220 CATTTTTGGTTGTCTCAGCTGGG 0: 2
1: 50
2: 256
3: 672
4: 1150
1144757867_1144757875 20 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757875 17:17691228-17691250 TGCTGGCATCTAGTGGGTAAAGG 0: 1
1: 38
2: 364
3: 830
4: 1348
1144757867_1144757871 -6 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757871 17:17691202-17691224 TTTGGTTGTCTCAGCTGGGGAGG 0: 1
1: 6
2: 62
3: 206
4: 626
1144757867_1144757874 14 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757874 17:17691222-17691244 AGGTGCTGCTGGCATCTAGTGGG 0: 4
1: 75
2: 338
3: 805
4: 1601
1144757867_1144757876 26 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757876 17:17691234-17691256 CATCTAGTGGGTAAAGGCCATGG 0: 17
1: 212
2: 706
3: 1162
4: 1453
1144757867_1144757873 13 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757873 17:17691221-17691243 GAGGTGCTGCTGGCATCTAGTGG 0: 2
1: 47
2: 267
3: 672
4: 1574
1144757867_1144757872 3 Left 1144757867 17:17691185-17691207 CCATGTCAGGAGACATTTTTGGT 0: 2
1: 21
2: 56
3: 108
4: 254
Right 1144757872 17:17691211-17691233 CTCAGCTGGGGAGGTGCTGCTGG 0: 1
1: 0
2: 5
3: 38
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144757867 Original CRISPR ACCAAAAATGTCTCCTGACA TGG (reversed) Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901591505 1:10347798-10347820 AGCAAAAATGTCCCCTGGCAAGG - Exonic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
902675285 1:18004503-18004525 ACTGCAAATGTCTGCTGACAGGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905467276 1:38164742-38164764 ACCAGAAAAGGCTCCTGAGAAGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
908304700 1:62800500-62800522 ATTAAAAATGTCTCCTAAAATGG - Intronic
909924916 1:81427514-81427536 ACCAAAACTGCCCCCTTACATGG - Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911289335 1:96037959-96037981 AACAAAACTGTCTCCTGCCATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921412487 1:214850552-214850574 ACCAAAAATGTCTCATTCCATGG - Intergenic
921699939 1:218257563-218257585 AAAAAAAATTTCTGCTGACATGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1067019810 10:42785390-42785412 ACCAAAAAAGTCTACTTATAAGG + Intronic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069270728 10:66524122-66524144 ATGAAAAATGTTTCCTGAGACGG - Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070233579 10:74598388-74598410 ACAAAATATGTCTTCTCACAGGG + Intronic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072249359 10:93569368-93569390 ACTAAAATTGTGTGCTGACAGGG + Intronic
1072289667 10:93952523-93952545 ACCAACCAAGTCTCCCGACATGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1074684230 10:115944487-115944509 ACCTAAAATGTTTCTTGACTTGG - Intronic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075989038 10:126817259-126817281 ACCAAAGTTGTATCCTCACATGG - Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076740498 10:132480688-132480710 AGCAACAATGTTTCCTGACCAGG + Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079381213 11:19939223-19939245 ACCCCAAAATTCTCCTGACATGG - Intronic
1079915396 11:26363570-26363592 ACCAAAAATGCCTCTTTAAAGGG + Intronic
1081222980 11:40485547-40485569 ACCAAAAATGGCTAGTTACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1084966609 11:72747866-72747888 ACCAGCAATGTCACCTGACCAGG + Intronic
1085196206 11:74673302-74673324 ACCAAAAATTCCTCTTGACCTGG - Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086388998 11:86341215-86341237 AACAAAAATGTATACTGATAAGG - Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091220309 11:133926642-133926664 AGCAAACATGTGGCCTGACAAGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092623569 12:10301230-10301252 AAGAAAAAAGTCTTCTGACAAGG - Intergenic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096140041 12:49235195-49235217 AATAAAAAGGGCTCCTGACACGG + Intronic
1098311821 12:69156482-69156504 ACCAAAAATCTCTCCTGGCCAGG + Intergenic
1098801789 12:74969351-74969373 ACCAAAAATGAGTTCTGAAATGG + Intergenic
1099149836 12:79096600-79096622 ACCTAAAATGCCTCCTTTCAAGG - Intronic
1099506205 12:83479212-83479234 GCCTAAAATGTCTCCTAAGATGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100400708 12:94226704-94226726 ACCAAAAATGTCACTTTACCTGG - Exonic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102765497 12:115429402-115429424 ACAAATAATGTTTACTGACATGG + Intergenic
1102862427 12:116348270-116348292 ACCATAAATTTCTCTTGAAAAGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103278010 12:119730326-119730348 ACCAAAAATGTCCCATGGTAAGG + Intronic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105023268 12:132831798-132831820 AACCAAAATGTCCTCTGACATGG + Intronic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109598782 13:64595020-64595042 ACCAATAATGTGTTCTGAAATGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112598160 13:100829052-100829074 ACCAAAAATGTCTATTAAAAAGG - Intergenic
1112999724 13:105620099-105620121 ACAAAAAATGTATCCTAATATGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117380847 14:55161376-55161398 ACTAATAAAGTCTCATGACAAGG - Intronic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122777426 14:104127218-104127240 ACCACAAATGTCTCAGGAAAAGG - Intergenic
1128099203 15:64984507-64984529 ACCAAAAAATTCACCTGACGTGG - Intronic
1129682036 15:77663518-77663540 ACCCAAGATGTATCCTGAAATGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130762954 15:86839704-86839726 ACCAAAATTGCCTCCTGTCAAGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131318765 15:91366407-91366429 ACCAAAAAAGCTTCCTGCCAGGG - Intergenic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131597372 15:93812289-93812311 ACCAAAAATTTTTCTTGATATGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134004283 16:10807512-10807534 ATGAAAAATGTCTCCTGATGTGG - Intronic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137757018 16:50910485-50910507 ATCAAAAATGTCTCCTGCAGGGG + Intergenic
1139060649 16:63246637-63246659 ACTAAAAATGTCTTCTTACTGGG + Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1139285762 16:65812537-65812559 GGAAAAAATGTCTACTGACAGGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141926860 16:87175417-87175439 ACCACAAAAGTGTCCTGACCGGG - Intronic
1143370207 17:6434834-6434856 ACCAAAAATGCCCCCTGAATGGG + Intronic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145021242 17:19433028-19433050 ACCAAAAATGTCTCCCCAAGTGG - Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153748050 18:8200408-8200430 AACAACAATGTCTTGTGACAAGG - Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154289025 18:13089435-13089457 AAAAAAAATCTCTCCTGGCAGGG + Exonic
1157315624 18:46587087-46587109 ACCAATATTGTCTCCTCATAGGG + Intronic
1157488964 18:48108998-48109020 CTGAAAAATGTCTCCTGCCAGGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161520507 19:4721064-4721086 ACCAAAAATGTCCCCTGGGGGGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161878950 19:6933680-6933702 ACCAAAAATGTCTTCTGGTCGGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1164599233 19:29549678-29549700 ACCATATATGTCTCCCCACAGGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1167023569 19:46897331-46897353 ACAAAAAATGCCTCATGAAATGG - Intergenic
1167992951 19:53376098-53376120 ACTAAAAAAGTATCCTGGCATGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
927086918 2:19681016-19681038 ACCAAAAATGGCTCTTATCATGG + Intergenic
927541629 2:23917110-23917132 ACCAAAAATGTTTGCCCACATGG + Intronic
928477225 2:31640863-31640885 AAAAAAAAAGTCTCCTGCCAGGG + Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
931606466 2:64058062-64058084 TCTAAAAATATCTCCTTACAGGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
942264664 2:174210517-174210539 ACCAAAACTGTCTACTCATAAGG + Intronic
942380898 2:175388954-175388976 AACTAAAAAGTTTCCTGACATGG - Intergenic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
942889846 2:180976896-180976918 ACCAAAAAAGGCTCATGTCATGG - Intronic
943098763 2:183461263-183461285 CCCAAAAATTTTTCCTGAAAAGG + Intergenic
943178390 2:184508773-184508795 AAGATAAATGTCTCATGACAGGG - Intergenic
944736548 2:202572018-202572040 AGGAAAAATGTGTCCTGAAATGG + Intergenic
945883829 2:215354017-215354039 AAAAAAAAAGTTTCCTGACAAGG - Intergenic
946109248 2:217399507-217399529 ACCAGGAATTTCTCCTGACTGGG - Intronic
946198763 2:218057748-218057770 GCCTAAAATGTTTCCTGAAAAGG - Intronic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947868066 2:233415166-233415188 AACAGCCATGTCTCCTGACAAGG - Intronic
948576301 2:238952553-238952575 AACCAAAATGTCCACTGACATGG - Intergenic
1169191061 20:3659672-3659694 AACCAAGATGCCTCCTGACAGGG + Intronic
1169608328 20:7349347-7349369 ACCAAAACAGTCTTGTGACATGG + Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170817946 20:19730621-19730643 CCCAACAATGCCTCCTGAGAAGG - Intergenic
1171164794 20:22960210-22960232 TCCCAAAATGTGTCCTTACAAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
950874711 3:16261336-16261358 ACCAAAAATCTCTGCTTCCAAGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953624294 3:44557886-44557908 CCCAAAAATGTCACCTTTCAGGG - Intronic
953957936 3:47245911-47245933 ACCACAAATGCCTCCTGAGGTGG + Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955465517 3:59233031-59233053 ACAAAAATTGTGTCCTCACATGG - Intergenic
955696433 3:61641939-61641961 ACCAACAAGGTCTCCTCAGAAGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955802850 3:62704044-62704066 ACCTAAAATCTTGCCTGACATGG - Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960791404 3:121435168-121435190 ACAAAAAAAGTCTGCTGTCATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962676045 3:137759505-137759527 AGCAAAAAAGTCTCCTTACCTGG + Intergenic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967750987 3:193116074-193116096 ACAAAAGATGTGTCCTCACATGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969542626 4:7803243-7803265 CCCAAAAATGGCTTCTGAAAAGG + Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971030476 4:22631507-22631529 ACCAGAAATGGCTCATTACAAGG + Intergenic
971246040 4:24928902-24928924 ACCATAAATGTCACCTGAAAAGG - Intronic
971400586 4:26272018-26272040 CTTAAAAATGTCTCCTGACTAGG + Intronic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978395199 4:108271547-108271569 ACAAGAAACGTCTCCTGTCAAGG - Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
978611844 4:110550250-110550272 AGCAAAAGAGTTTCCTGACAAGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986596636 5:9429607-9429629 ATCAGGAATATCTCCTGACAAGG + Intronic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988447584 5:31305093-31305115 ACCAAAAATGTTTCGTGTCTTGG + Intronic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
992145133 5:73839264-73839286 GCTTAAAATATCTCCTGACATGG - Intronic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993168858 5:84389865-84389887 ACCAGAAATTTCTCCTACCAGGG - Intergenic
993514245 5:88810752-88810774 GACAAAAATGTCTCCTGGGATGG - Intronic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995415029 5:111900763-111900785 ATAAAAAAAGTCTCCTAACAAGG + Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997149301 5:131475290-131475312 ACCAAAACAGTCTCCTGAGAAGG + Intronic
997633777 5:135389837-135389859 GTCACAAATGTCTCCTGAAAAGG + Intronic
997645668 5:135480185-135480207 ACCAAAAATGCCACCTGGCAAGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999664244 5:153896046-153896068 GCCAAAAATCCATCCTGACATGG - Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003631911 6:7795007-7795029 AACATAAATGTTTCCTGTCAAGG - Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005840383 6:29741313-29741335 ACCAGAAATGTCTACTTAAAGGG + Intergenic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007109124 6:39302956-39302978 ACCTAAAATGTCTCCTCTCTGGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008420594 6:51294601-51294623 ACCATCTATGTCTCCTCACATGG - Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1011810579 6:91128130-91128152 ACCATGAATGTCACCTTACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012372486 6:98524540-98524562 ACCCAATCTGTCTCCTGACGTGG + Intergenic
1012446248 6:99310119-99310141 ACCAAAAAAGTCTACTGTCTAGG + Intronic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013425414 6:110008266-110008288 AACAAAAGGGTCTCATGACAAGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014195417 6:118552542-118552564 ACCAAACATGTTGCCTAACATGG + Intronic
1015329429 6:131960015-131960037 AAAAAAAATCTCTCCTGAAATGG - Intergenic
1019005100 6:168790158-168790180 ACTAAAAATGGGTCCTGCCACGG + Intergenic
1019026170 6:168964779-168964801 TCCAGAAACGGCTCCTGACAAGG + Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021976939 7:26020230-26020252 ACCAACACTGTGTCCTCACATGG - Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025292806 7:57746064-57746086 ACCAAACATATATCTTGACAGGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027657905 7:80954151-80954173 ACCAAAAATGTATTCGTACAGGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030209029 7:106978267-106978289 ACCAAAAATGTCTCCTGGAGTGG - Intergenic
1030359811 7:108583066-108583088 ACCAAAAATGTCATCTACCAAGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031261863 7:119531800-119531822 CTCAAAAATGACTCCTGCCATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032151316 7:129432625-129432647 ACCAAAAATGTCTCGGGGCGGGG - Intergenic
1033133660 7:138767139-138767161 AACAATAATGTCTCATTACATGG - Intronic
1033611272 7:142965191-142965213 CCCAAAACTGTCACCTCACAAGG - Intergenic
1034197339 7:149258531-149258553 TCCCATAATGTCTCCTGACTTGG - Intergenic
1035791345 8:2308097-2308119 AACAAGAATGTCTCCTTTCATGG + Intergenic
1035801460 8:2413608-2413630 AACAAGAATGTCTCCTTTCATGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036384253 8:8264570-8264592 ACCAGAAATGTGTCCTGCCCAGG - Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038520011 8:28223506-28223528 ACCAATAATGACTTCTGAAATGG - Intergenic
1039295300 8:36145062-36145084 ACAAAAAAATTATCCTGACATGG - Intergenic
1040605439 8:48927128-48927150 ACCAAACATGTCCACTGCCATGG - Intergenic
1044197347 8:89393587-89393609 ACCAAAAATGAGTACTGATAAGG - Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046581198 8:116094568-116094590 AACAAAGATGTCTAGTGACATGG + Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047137064 8:122091344-122091366 ACTACAAATGTCTTCTGTCACGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1049690418 8:143956410-143956432 ACTAAAAAACTATCCTGACACGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050099971 9:2108577-2108599 ACCAAAAATTTCTTCTAAAATGG - Intronic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1052155261 9:25179560-25179582 AACAAAAATGTCTACTAAAAAGG + Intergenic
1052321109 9:27168758-27168780 ACCAAATATGTCACCTAAGAGGG - Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056961055 9:91123693-91123715 AACAAAAATGTGTTCTGACTAGG + Intergenic
1058101291 9:100920196-100920218 CCCAGAAATCTCTCCTAACATGG - Intergenic
1058542106 9:106022249-106022271 ATTAAAAATCTCTCCTGACTTGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187596881 X:20783095-20783117 GCCAACAGTGGCTCCTGACAGGG - Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190452477 X:50595491-50595513 ACCAAAGAAATCTCCTGAAATGG - Exonic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1193624920 X:83806578-83806600 AGCAAAAATCTCTTTTGACAAGG + Intergenic
1195012150 X:100743153-100743175 ACCAAAAATGTCCCCTGGGCAGG - Intergenic
1195284532 X:103371192-103371214 AACAAAAATGTGTCCTTTCATGG + Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1198330082 X:135614402-135614424 ACCACAAATATCTCCTGCCATGG + Intergenic
1198362754 X:135911868-135911890 ACCACAAATATCTCCTGCCATGG + Exonic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic