ID: 1144757999

View in Genome Browser
Species Human (GRCh38)
Location 17:17691819-17691841
Sequence CAGGCTGGAAGGTAGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144757999_1144758013 26 Left 1144757999 17:17691819-17691841 CCCAGGTGCTACCTTCCAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 234
Right 1144758013 17:17691868-17691890 TTTGCAGCTTTCTGATAGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 162
1144757999_1144758011 22 Left 1144757999 17:17691819-17691841 CCCAGGTGCTACCTTCCAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 234
Right 1144758011 17:17691864-17691886 CTCATTTGCAGCTTTCTGATAGG 0: 1
1: 0
2: 1
3: 8
4: 179
1144757999_1144758012 25 Left 1144757999 17:17691819-17691841 CCCAGGTGCTACCTTCCAGCCTG 0: 1
1: 0
2: 1
3: 22
4: 234
Right 1144758012 17:17691867-17691889 ATTTGCAGCTTTCTGATAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144757999 Original CRISPR CAGGCTGGAAGGTAGCACCT GGG (reversed) Intronic
900603889 1:3515368-3515390 CAGCCTGGGAGGGAGGACCTGGG - Intronic
900719099 1:4163677-4163699 CTGGGTGGAGGGCAGCACCTGGG - Intergenic
901037851 1:6347083-6347105 CAGACTGGAAGGCACCACCAGGG + Intronic
903225602 1:21892816-21892838 CAGGCTGGAAGGCAGTACAGTGG - Intronic
903241160 1:21983628-21983650 ACGGCTGGAAGGTAGGACTTGGG + Intronic
904459934 1:30670593-30670615 CAGGCGGGAAGGAAGCCCCCAGG - Intergenic
904605613 1:31696194-31696216 CAGGCTGGAAAGGGGCACCCAGG + Intronic
906587350 1:46991138-46991160 CAGTCTGGAAGGTTGCTTCTGGG - Intergenic
906652498 1:47522680-47522702 TATGCTGGAAGCTGGCACCTTGG - Intergenic
909350984 1:74653036-74653058 CAGCTGGGAAGGTAGCACCCCGG - Intronic
909787446 1:79633039-79633061 CAGGCTGGAAACCAGGACCTTGG - Intergenic
912262269 1:108121881-108121903 GAGGCTGGGAGGAGGCACCTGGG - Intergenic
912884748 1:113458627-113458649 CAGGCTCCCAGGTAGCAGCTAGG + Intronic
913573096 1:120141301-120141323 CATGCTGAAAGATTGCACCTGGG + Intergenic
914294352 1:146306098-146306120 CATGCTGAAAGATTGCACCTGGG + Intergenic
914555396 1:148756881-148756903 CATGCTGAAAGATTGCACCTGGG + Intergenic
915863618 1:159474694-159474716 AAGGCTGGAAGATGGCACCTTGG - Intergenic
919730859 1:200912868-200912890 CAGGCTGGAGGGTAGTATATAGG + Intronic
922033448 1:221825974-221825996 CAGGCTCCATGGTAGCATCTAGG - Intergenic
922752651 1:228077887-228077909 CAGGCTGGATGTCAGAACCTGGG - Intergenic
923600020 1:235394629-235394651 CAGGCTGGTGTTTAGCACCTGGG + Intronic
924297507 1:242603284-242603306 CAGGCAGGAAGGGAGCTCATGGG - Intergenic
1066128356 10:32364790-32364812 CAGGTTGGAAGGTTGCAGGTTGG - Intronic
1067027777 10:42859048-42859070 CAAGCTGGCTGGTAGCCCCTGGG + Intergenic
1068435633 10:56988086-56988108 CAGGCAGCTAGGTAGCACTTTGG + Intergenic
1069605505 10:69736524-69736546 GAGGCAGGAAGATTGCACCTAGG + Intergenic
1069685667 10:70316920-70316942 CAGGCAAGAAGCTACCACCTCGG + Intronic
1069738453 10:70672645-70672667 CAGGCGGGAGGGAAGCAGCTAGG + Intergenic
1070358262 10:75661543-75661565 CAGGCTTGGAGGGAGGACCTTGG - Intronic
1070803153 10:79255211-79255233 CAGGGTGGCAGATGGCACCTGGG - Intronic
1070890793 10:79941234-79941256 CAGGCTGGAAGGCAGGAGCATGG - Intronic
1072240979 10:93495742-93495764 CAGGCTGGAGGGTAGCAGTCTGG + Intergenic
1074365918 10:112857439-112857461 CAGGCTGGAAGCTAACAACGGGG - Intergenic
1075584631 10:123648691-123648713 CAGGCTGGAAAGTGGGACTTTGG + Intergenic
1075712127 10:124536414-124536436 CAGGCTGGATGGAAGCTCCCCGG + Intronic
1077249062 11:1552645-1552667 CAGGGGGTAAGGGAGCACCTCGG + Intergenic
1078049170 11:7946637-7946659 GAGAATGGAAGGAAGCACCTGGG - Intergenic
1080505873 11:32912832-32912854 GAGCCTGGAAGGTCACACCTAGG + Intronic
1080642393 11:34165389-34165411 CAGCGTGGCAGGGAGCACCTGGG + Intronic
1081847622 11:46252081-46252103 CAGAGTGGCAGGAAGCACCTGGG + Intergenic
1082789689 11:57338736-57338758 GAAGCTGGATGGTAGCACCGAGG - Intronic
1083628861 11:64085695-64085717 CAGCCTGCAAGGTTGCCCCTGGG - Intronic
1085317458 11:75554276-75554298 CAGGCTGGAATCTAGGAGCTGGG + Intergenic
1085803015 11:79608863-79608885 CAGTCTGGAAGGTTGCACAGAGG - Intergenic
1086048013 11:82555835-82555857 TAGGCTGAGAGGTAGCACATGGG - Intergenic
1087592010 11:100201761-100201783 CAGTCTTGAAGGGAGAACCTGGG - Intronic
1089012919 11:115145302-115145324 CAGTCTGGAAGGCAGCAACTTGG + Intergenic
1089541145 11:119189622-119189644 CAGGAAGGGAGGGAGCACCTGGG - Exonic
1089695040 11:120211529-120211551 CAGGCTTGAAGGTGCCACCCCGG - Intronic
1091274785 11:134342751-134342773 CAGGCTGGACTGGAGCACCCTGG + Exonic
1096198503 12:49664488-49664510 CAGGGTGGCAGGTAGCACTCAGG + Intronic
1096610456 12:52797523-52797545 CAGCCTGGCAGGTAACACATGGG - Intergenic
1098315548 12:69189017-69189039 CAGGCTGGAATGCAGCACTGTGG + Intergenic
1100390003 12:94139918-94139940 CAAGATGGAAGATAGCACGTTGG + Intergenic
1102204594 12:111081927-111081949 GAGGCTGGAGGGCTGCACCTGGG - Intronic
1102512048 12:113422423-113422445 CAGGCTGGAGGGCAGGAGCTGGG + Exonic
1104581520 12:130014494-130014516 CACGCTGGAGGGTAACACCTGGG + Intergenic
1104581590 12:130015015-130015037 CACGCTGGAGGGTAACACCTGGG - Intergenic
1105555381 13:21443198-21443220 TAGGGGAGAAGGTAGCACCTTGG - Intronic
1105813050 13:24011191-24011213 CAGGCTGGGAGGTGGCACCCAGG - Intronic
1106313898 13:28577172-28577194 CTGGCTGGATGGTAGCGCCAGGG + Intergenic
1106504946 13:30363048-30363070 CGGGCTGGAAGGGAACAGCTGGG - Intergenic
1108304302 13:49115843-49115865 CAGGCTGGAAAGCAGGACTTTGG - Intronic
1109898598 13:68730687-68730709 CAGGCAGAAAGGTTGCACCTGGG + Intergenic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1113069993 13:106411077-106411099 CAGACTGGAAGGTGTCTCCTGGG - Intergenic
1113925632 13:113940066-113940088 CAGGCAGGCAGGTAGCCTCTTGG - Intergenic
1113932907 13:113977693-113977715 CAGGGAGGAGGGTGGCACCTGGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1116653276 14:47621398-47621420 CAGGCTGGACTGGAGCTCCTGGG + Intronic
1118839534 14:69500455-69500477 CAGGATGGAAGCTAGACCCTGGG - Intronic
1120041325 14:79756595-79756617 CAGGCTGGAAAACAGCACTTTGG - Intronic
1120892330 14:89502115-89502137 CAGGCTGGAATGTGGGATCTAGG - Intronic
1121322226 14:92998599-92998621 GAGGCTGGGAGGTGGCACCTGGG + Intronic
1121485392 14:94310576-94310598 CAAGCTGGATGGTGGCACCCTGG - Intronic
1121555928 14:94837062-94837084 CAGGCTGGCAGGTTGAACTTGGG + Intergenic
1122722634 14:103730713-103730735 CAGGCTGGCAGGCGGCCCCTTGG - Intronic
1123041827 14:105493401-105493423 GAGGCTGGAAGGTGGCACAGAGG - Intronic
1123427428 15:20183877-20183899 CAGGCTGGCTGGTGGCCCCTGGG + Intergenic
1123536664 15:21190427-21190449 CAGGCTGGCTGGTGGCCCCTGGG + Intergenic
1124019019 15:25903079-25903101 CAGGCTGGAGGTTAACACCACGG - Intergenic
1125501291 15:40241540-40241562 CAGGCTTGGAGGTGGCACCTGGG + Intronic
1125719922 15:41840368-41840390 CTGGGTGGAAGGTGGCAGCTGGG + Intronic
1128277873 15:66369397-66369419 CAGGCTGGATGGTGCCATCTTGG + Intronic
1129741649 15:77992428-77992450 CAGGCTGGCAGGAGGCCCCTGGG + Intronic
1130866010 15:87933887-87933909 CAGGATGGAAAGGAGCATCTGGG + Intronic
1132283193 15:100638520-100638542 CAGTTTGGAAGATAGGACCTTGG + Intronic
1132566408 16:625545-625567 CAGGCTGGATGGAGGTACCTGGG + Intronic
1132668045 16:1090842-1090864 CTGGCTGGGAGGAAGCAGCTGGG - Intronic
1132846449 16:2003066-2003088 GAGGCTGAAAGGTGGCAGCTCGG + Exonic
1136856861 16:33665932-33665954 CAGGCTGGCTGGTGGCCCCTGGG - Intergenic
1138174968 16:54888823-54888845 CAGGCAGGAAGGTAGGACAGAGG + Intergenic
1139421518 16:66852081-66852103 CAGGCTGGAAGATGGCATCTGGG + Intronic
1139485659 16:67255343-67255365 GAGGCGGGAAGGCAGCAACTGGG - Intronic
1142189223 16:88710006-88710028 CAGGCGAGAAGGTAGCGTCTGGG + Exonic
1203118436 16_KI270728v1_random:1514407-1514429 CAGGCTGGCTGGTGGCCCCTGGG - Intergenic
1143884402 17:10055223-10055245 AGCGCTGGAAGCTAGCACCTGGG + Intronic
1144365595 17:14541630-14541652 CAGGCTGAAAGCCTGCACCTGGG + Intergenic
1144757999 17:17691819-17691841 CAGGCTGGAAGGTAGCACCTGGG - Intronic
1146373845 17:32281358-32281380 CAGCCTGGGAGGCAGCCCCTAGG + Intronic
1146586989 17:34091001-34091023 CAGGTTGGAAGGTACCAGGTAGG - Intronic
1148092333 17:45030051-45030073 CTGGCTGGAAGGGAGGACCATGG - Intronic
1148339788 17:46866618-46866640 CAGGGTGGAAGCCAGCACCCCGG + Intronic
1148965075 17:51428126-51428148 CAGGCTGGGAGCCAGAACCTGGG + Intergenic
1149453228 17:56766439-56766461 CAGGCTGGAAAGTGCCTCCTGGG - Intergenic
1152811424 17:82384519-82384541 AAGGCGGGAAGGTGGGACCTGGG - Intergenic
1155273845 18:24167176-24167198 CAGGCAAGAAGGGAGCACCCGGG + Intronic
1156500476 18:37554292-37554314 CAGGCTGGATGTGAGCACCTGGG + Intronic
1156996948 18:43480079-43480101 CAAGCTGGAAGGGAGCAGGTTGG - Intergenic
1157074311 18:44448415-44448437 CTGGCTGAAAGGAAGAACCTTGG - Intergenic
1161161186 19:2762641-2762663 CAGGCTGGAGGAGAGCACCGGGG + Exonic
1161408094 19:4101622-4101644 CAGCCTGAAAGGCAGCATCTGGG + Intronic
1162087945 19:8259814-8259836 CAGCCTGGATGGCATCACCTAGG + Intronic
1162743881 19:12788685-12788707 CAGGCCAGAGGGCAGCACCTTGG - Intronic
1163033664 19:14560001-14560023 CGGGCTGCAAGGCAGCACCTAGG - Intronic
1163548254 19:17951708-17951730 CGGGCTGGAAGGTCCCAGCTAGG - Intronic
1163734065 19:18967885-18967907 CCTGCAGGAAGGAAGCACCTTGG + Intergenic
1164559100 19:29276380-29276402 GAGGATGGAAGGTGGCTCCTGGG - Intergenic
1165120172 19:33553758-33553780 CAGGCTGGAAGGAAGGAGCTAGG + Intergenic
1165423950 19:35735531-35735553 CAAGCTGGAAGGGAGCCCCTGGG - Intronic
1166034502 19:40157799-40157821 CAGGCTGGAATGCAGTAGCTTGG + Intergenic
1166118154 19:40668085-40668107 CAGGCTGGAAGGCAGCTGCAGGG + Exonic
1166217007 19:41342328-41342350 GAGGCAGGAAGGAAGCCCCTGGG - Intronic
1168245207 19:55109702-55109724 CAGTCTGGATGCCAGCACCTCGG + Intronic
925580094 2:5401458-5401480 CAGGCTGGGAGGCAGCACCTTGG + Intergenic
926464858 2:13175628-13175650 AAGGCTTGATGGTAGAACCTTGG - Intergenic
927446711 2:23169102-23169124 CAGGCTGGTCGGAAGCTCCTGGG - Intergenic
927476700 2:23419367-23419389 CAGGCTGGAGGGTCCCACCTGGG + Intronic
928391225 2:30912431-30912453 CAGGCTGGTAAGAAGCACCAAGG + Intronic
932265661 2:70365254-70365276 CAGGCAGGCAGGAAGCACCATGG - Intergenic
933514033 2:83278128-83278150 GAGCCTGGAAGATAGAACCTGGG + Intergenic
934492528 2:94771389-94771411 CAGGCTGTAAGGAAGCACAGTGG + Intergenic
934581982 2:95450054-95450076 CAGGTTGGAAAGAAGCAACTTGG - Intergenic
934597468 2:95626660-95626682 CAGGTTGGAAAGAAGCAACTTGG + Intergenic
935204681 2:100887491-100887513 CGAGCTGGGAGGTAGCACCACGG + Intronic
937969098 2:127536011-127536033 CGGGCTGAAGGGCAGCACCTGGG + Intronic
940992318 2:160110514-160110536 CTGGCTGGAAAGTACCAGCTAGG - Intronic
941943442 2:171068380-171068402 CAGGCTGGACTGTAACTCCTAGG + Intronic
942249779 2:174037803-174037825 CCGGCTGGAAGGCAGGACCTCGG + Intergenic
943600020 2:189905848-189905870 AAGGCCGGAAGGTAGCAATTTGG + Intronic
944318308 2:198307043-198307065 CAGGATGGCAGCTTGCACCTAGG + Intronic
946245203 2:218383436-218383458 CAGGCTGGCATCTAGCATCTAGG + Intronic
946250875 2:218411339-218411361 CAGGCTGGAATGGAACTCCTGGG - Intergenic
946353151 2:219168723-219168745 CAGGCTGGGAGCCAGCACCAGGG + Exonic
948111818 2:235462391-235462413 CAGGCTGGATCCTAGCACTTTGG - Intergenic
948337101 2:237218112-237218134 CAGGCTGTAAGGAGGCACCTTGG + Intergenic
948575265 2:238945876-238945898 CAGGCTGGAGGGTATCCTCTGGG - Intergenic
948632663 2:239312135-239312157 CAGTGTGGTAGGTGGCACCTTGG - Intronic
1169309092 20:4519894-4519916 CAGGTTGGCAGGTAGCTCATGGG + Intergenic
1169832298 20:9838523-9838545 CAGGCTGGATAGTAGCGCATGGG + Intronic
1170704156 20:18729742-18729764 TAGGCTGGGAGGCAGTACCTAGG - Intronic
1170745912 20:19098748-19098770 TTGGCAGGAAGGAAGCACCTTGG + Intergenic
1170778982 20:19406660-19406682 CAGACTGAAAGGTAGCACAGAGG + Intronic
1171386986 20:24777077-24777099 CAGCCTGGAGGGTGTCACCTCGG + Intergenic
1171464230 20:25316621-25316643 CGTGCTGGAAGGTAGGGCCTTGG - Intronic
1173199840 20:40946269-40946291 CAGGCTGGAGGGGTGCCCCTTGG - Intergenic
1175801323 20:61802692-61802714 CAGGCTGGGAGGCAGCTCCCAGG - Intronic
1177196151 21:17905537-17905559 CAGGCTGGTCTGTAACACCTGGG - Intronic
1178288015 21:31342232-31342254 CAGGCTGGACTGGAGCTCCTGGG - Intronic
1178894048 21:36544160-36544182 CAAGCTGGCAGGCAGCACCATGG - Intronic
1180052239 21:45336425-45336447 CAGGCTGGTGGGGAGCACATGGG - Intergenic
1180113171 21:45675356-45675378 CAGACAGGCAGGTACCACCTAGG + Intronic
1180721481 22:17912076-17912098 CAGGCTGGAGTCTAGCTCCTGGG - Intronic
1180830380 22:18902854-18902876 CAGGCTGGCTGGTGACACCTTGG - Intergenic
1181069330 22:20322677-20322699 CAGGCTGGCTGGTGACACCTTGG + Intergenic
1181621455 22:24094317-24094339 CAGGCAGGATGGTAGCCCCAGGG + Intronic
1181822050 22:25484058-25484080 CAGCCAGGAGGGAAGCACCTGGG + Intergenic
1183094162 22:35542162-35542184 CAGGCTGGGAGGGAGCAGCCAGG + Intronic
1183203052 22:36399384-36399406 CAGGCTGGAAGGCTGAACTTTGG - Intergenic
1183738332 22:39656197-39656219 CAGGCTGGAAGCTGGCGCTTGGG + Intronic
1203280469 22_KI270734v1_random:128125-128147 CAGGCTGGCTGGTGACACCTTGG - Intergenic
950298338 3:11851347-11851369 GGGGCTTGAAGGTACCACCTGGG + Intergenic
951731698 3:25816469-25816491 CAGCCTGGAAGTTCCCACCTTGG + Intergenic
953737136 3:45505259-45505281 CAGGCTGGAATCAAGCTCCTGGG - Intronic
953993309 3:47500436-47500458 CTGGCTGGAAGGATGCACGTTGG + Intronic
954117553 3:48475580-48475602 AGGGCTGGGAGGTAGCACCGGGG + Intronic
954419192 3:50409690-50409712 CAGGGTGGAAGGTTGAACCTGGG + Intronic
956385022 3:68707579-68707601 CAGGCTGGACTGGAGCTCCTGGG - Intergenic
960292826 3:115907130-115907152 CAGGCTGGAAGCAAGCAACAAGG - Intronic
962285678 3:134084120-134084142 CAGGCTGGAACCCACCACCTAGG + Intronic
962629183 3:137258705-137258727 CAGGCATGAAGTTAGCAGCTTGG - Intergenic
963033504 3:141003682-141003704 CAGGTTGCAAGGTGTCACCTGGG + Intergenic
963151599 3:142051202-142051224 TAGGCAGGAAGGTTGCCCCTGGG - Intronic
964730674 3:159861215-159861237 GAGGCAGGAAGGCAGAACCTGGG + Intronic
968052034 3:195661535-195661557 CAGGGTGGAAAGGAGGACCTGGG + Intergenic
968103778 3:195986803-195986825 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
968302080 3:197624396-197624418 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
968900334 4:3428240-3428262 CAGGCGGTAAGGAAGCACCAGGG - Intronic
969261395 4:6036268-6036290 CAGGCTGTGAGGGAGCAACTCGG + Intronic
969581300 4:8067146-8067168 CAGGCTGGATGCTACCTCCTGGG + Intronic
969711569 4:8847221-8847243 CAGGCTGGACTGGAGCTCCTGGG - Intronic
970604364 4:17665651-17665673 GAGGCTGGAGGGTAGGGCCTTGG + Intronic
971351903 4:25862896-25862918 CGGGCGGGAAGGTGGCGCCTCGG - Exonic
976318624 4:83686294-83686316 CAGGCTGGAAGTGAGCAGCCAGG + Intergenic
976749605 4:88440774-88440796 AAGGCTGGAAGCTAGCACGGGGG - Intronic
977566328 4:98584149-98584171 CAGGCTGGAGTCTAGCTCCTGGG + Intronic
981661626 4:147174127-147174149 CAAGCTGAAAGTTAGCACATGGG + Intergenic
982214018 4:153064826-153064848 CAGACTGGCAGGTAGCAGCAAGG - Intergenic
982643843 4:157997391-157997413 CAAGCTGAAAGGCATCACCTAGG + Intergenic
983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG + Intronic
986171642 5:5319349-5319371 CAGGCTGAAATGTGGCACCCTGG + Exonic
990465965 5:56071704-56071726 AGGGCTGGAAGGCAGCGCCTGGG + Intergenic
991129270 5:63103517-63103539 CAGGCTGGAGGGTGGCATATGGG + Intergenic
991554757 5:67882856-67882878 CAGGCTGGAGTGCAGCATCTTGG - Intergenic
994742415 5:103637170-103637192 CAGGATGGAAGGAAGGAACTAGG - Intergenic
996164202 5:120205133-120205155 CAGGCTGGAAGTGAGAAACTGGG + Intergenic
996542772 5:124647656-124647678 GAGGCTGGAATGCAGCACTTTGG - Exonic
997155275 5:131549633-131549655 CAGGCTGGACGTTAACTCCTGGG - Intronic
999373782 5:151072363-151072385 CAGGCTGGAAGGGAGCTCAGAGG + Intronic
1000039348 5:157473609-157473631 CAGCCTGGCAGTCAGCACCTCGG + Exonic
1000980775 5:167814294-167814316 CAGGATGAAAAGTAGCACGTAGG + Intronic
1006169775 6:32086185-32086207 GAGGCTGGAGGGCAGAACCTGGG - Intronic
1006362227 6:33593052-33593074 CAAGGGGGAAGGTACCACCTGGG - Intergenic
1007527177 6:42506656-42506678 CATGCTGGATGGTAGAACCATGG + Intergenic
1007741768 6:44014709-44014731 CAGGCTGGTCTGTAGCTCCTGGG + Intergenic
1009627897 6:66160545-66160567 CAGGCTCCATGGTAGCATCTAGG + Intergenic
1015791356 6:136967558-136967580 CAGGCTGGATGGTGGCTCCAAGG - Intergenic
1017495788 6:154982296-154982318 CAGGCTGGAGGGTGACACATTGG - Intronic
1018852355 6:167649786-167649808 CTGGCTGGAAGGTTGAACATTGG + Intergenic
1019307853 7:344323-344345 CAGGCTGGGAGTTGGCAACTGGG + Intergenic
1020015526 7:4829256-4829278 CAGGCTGGGAGGCAGAGCCTGGG + Intronic
1022188715 7:27996302-27996324 CAGGCTGGGAGGTAGCAGTGTGG + Intronic
1022955508 7:35376692-35376714 CAGGCTGGGAGGCAGCACCGCGG - Intergenic
1023632829 7:42180572-42180594 AAGGCTGGAGGGTAGGACCCAGG + Intronic
1027461840 7:78463925-78463947 CAGGCAGGCAGGTAGCAAGTAGG + Intronic
1027875626 7:83764153-83764175 CAGGCAGGAAGATAGCAGGTAGG - Intergenic
1029980119 7:104870775-104870797 CATGCTGGAATGTAGGACATGGG + Intronic
1034397856 7:150840881-150840903 GTGGCTGGAAGATACCACCTTGG + Intronic
1034449738 7:151130875-151130897 CAGGCTGGAAGGTGGCGGCCAGG - Intronic
1036763881 8:11533740-11533762 CAGGCTGGAAAGTACCACAGAGG + Intronic
1036910077 8:12751103-12751125 CATGCTGGAAGCTGACACCTGGG - Intronic
1040690324 8:49929551-49929573 GAGGCCGGAAGGACGCACCTGGG + Intronic
1041029168 8:53718598-53718620 CAGGCTGGACGCTAACTCCTGGG + Intronic
1044542929 8:93428135-93428157 CAGGCTGGTCTGTAGCTCCTGGG - Intergenic
1044943987 8:97373799-97373821 CAGGCGGGAATGGAGCAGCTGGG - Intergenic
1045986351 8:108253960-108253982 CAGGCTGGAATGCAGCAGCATGG + Intronic
1046340377 8:112846446-112846468 CAGGCTGGAATGCAGCAGCAGGG + Intronic
1047267851 8:123325145-123325167 CAGGCTGGAAGGCACGATCTCGG + Intronic
1048548862 8:135415031-135415053 CAGGCTGGAAGTTAACACCCAGG + Intergenic
1048623989 8:136164332-136164354 CAGGGTGGAGGGCCGCACCTGGG - Intergenic
1049022908 8:139970149-139970171 AAGGCTGAAGGGAAGCACCTCGG + Intronic
1049134577 8:140884354-140884376 CAGGATGGAAAGTATCATCTAGG - Intronic
1049369621 8:142257600-142257622 CAGGCTGGGAGGAAGCAGTTTGG + Intronic
1050799009 9:9585445-9585467 AAGTTTGGAAAGTAGCACCTAGG - Intronic
1055332538 9:75198867-75198889 CAGACTGGAACATAGCACCAAGG - Intergenic
1057810216 9:98251758-98251780 CAGGCAGGAGGGTAGCCCATTGG + Intronic
1058678605 9:107422472-107422494 TGGGCTGGAAGCCAGCACCTAGG + Intergenic
1058805781 9:108590263-108590285 CAGGTTGTAAGTTAGCACATGGG + Intergenic
1061497375 9:130982713-130982735 CAGCCTGGAGGCTGGCACCTAGG + Intergenic
1061649067 9:132031593-132031615 CAGGCTGGACTGTAACTCCTGGG - Intronic
1062115710 9:134807014-134807036 CAGGCTAGCAGGAAGCATCTAGG - Intronic
1186054287 X:5632415-5632437 CAGGCTACTAGGTAGCACCTTGG - Intergenic
1189204711 X:39227814-39227836 CAGGCTCAGAGGCAGCACCTGGG - Intergenic
1189595964 X:42565731-42565753 CAGGATGGAAGGTAGGACTTGGG + Intergenic
1192048613 X:67702464-67702486 CAGGCTGCAAGGTATGATCTGGG - Intronic
1200161576 X:154012511-154012533 CAGCCTGGGCGGCAGCACCTGGG + Exonic
1200223575 X:154404421-154404443 CAGGCTGGCAGGGAGCCCTTTGG - Intronic
1201237469 Y:11924837-11924859 CAGGCTGGAGTGCAGCACCATGG - Intergenic