ID: 1144758898

View in Genome Browser
Species Human (GRCh38)
Location 17:17695959-17695981
Sequence CCCTGGGTGAGGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 1, 2: 5, 3: 86, 4: 777}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144758898_1144758906 4 Left 1144758898 17:17695959-17695981 CCTTTCTCCCTCCTCACCCAGGG 0: 1
1: 1
2: 5
3: 86
4: 777
Right 1144758906 17:17695986-17696008 TGCACAAAGAGGCTGAGAATCGG 0: 1
1: 0
2: 1
3: 15
4: 237
1144758898_1144758904 -7 Left 1144758898 17:17695959-17695981 CCTTTCTCCCTCCTCACCCAGGG 0: 1
1: 1
2: 5
3: 86
4: 777
Right 1144758904 17:17695975-17695997 CCCAGGGCACATGCACAAAGAGG 0: 1
1: 0
2: 1
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144758898 Original CRISPR CCCTGGGTGAGGAGGGAGAA AGG (reversed) Intronic
900095180 1:937328-937350 CCATGAGTGAGGAGTGAGCATGG + Intronic
900117734 1:1035672-1035694 CCCTTGCTGAACAGGGAGAAGGG - Intronic
900226173 1:1534562-1534584 CCCTGAGAGAGGAGGGAGGAGGG + Exonic
900358871 1:2278464-2278486 CCCTGACTGTGGAGGGTGAAGGG - Intronic
900469610 1:2847276-2847298 CCTTGGGGGAGGCGGGAGCAGGG - Intergenic
900526652 1:3132578-3132600 CCCTCGGTAAGGAGGAAGGAAGG - Intronic
900531305 1:3154755-3154777 TCCTGGTAGAGGAGTGAGAACGG - Intronic
900685942 1:3947716-3947738 CCCTGGGGCAGGGGGAAGAAGGG - Intergenic
900806122 1:4769450-4769472 CCCAGGGTGTGAGGGGAGAAAGG + Intronic
900809420 1:4790080-4790102 ACCTGGGGCAGAAGGGAGAAAGG + Exonic
900960348 1:5915118-5915140 TCCTGAGGGAGGAGGGAGAGGGG + Intronic
901080270 1:6580131-6580153 GCCTGGGTGAGGAGGGCGCGGGG + Exonic
901148935 1:7087472-7087494 CCCTGGGTCAGTGGGGAGCAGGG + Intronic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901494522 1:9613554-9613576 CCCTGGGGGAGGGGGAAGCATGG + Exonic
901671057 1:10856628-10856650 CCCTGGGTGAGGACGGGGCAAGG - Intergenic
901731194 1:11281021-11281043 CCCAGGATGAGCAGGAAGAAAGG - Intronic
901749995 1:11400238-11400260 GCCTGGGTGAGGAGGGGGAGGGG + Intergenic
901845618 1:11980403-11980425 CCCAGGGGGAGGCGGGAGGAGGG - Exonic
901917359 1:12510064-12510086 CCCAGGATGAGAAGGGAGCAGGG + Exonic
902041063 1:13492902-13492924 GCCTGGGTCAGGGGGGAGAGGGG - Intronic
902326390 1:15703493-15703515 CCTTGTCTGACGAGGGAGAAAGG + Intronic
902777981 1:18686650-18686672 CCAGGGGTGGGGAGAGAGAAGGG + Intronic
902923653 1:19681859-19681881 CTCTGGGGGAGGTGGGAGGAGGG - Intergenic
903015463 1:20358657-20358679 CCCTGGGAAAGGAGAGGGAAGGG + Intergenic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903280757 1:22248644-22248666 CCCTGGGGGGAGAGGGAGTATGG + Intergenic
903580191 1:24365004-24365026 CCCAGGGTTGGGAGGGATAAAGG + Intronic
904001410 1:27341139-27341161 CCCTGGGAGAGGCAGGACAAGGG - Intergenic
904266201 1:29319791-29319813 CCCTAGGTCAGGAGGAAGACTGG + Intronic
904336284 1:29800437-29800459 GTCTGGGTGTGGAAGGAGAAGGG - Intergenic
904501446 1:30915095-30915117 AGCTGGGTGAGGAGAGAGGAGGG + Intergenic
905205612 1:36341302-36341324 GCCTGGGAGAGCAGGGAGGAGGG + Exonic
905232247 1:36521695-36521717 CCCAGTCTGAGGAGGGAGACAGG - Intergenic
905318018 1:37095957-37095979 CCCTGGCTGGGGAGGCAGACTGG + Intergenic
905771922 1:40643896-40643918 CCCTCTGTGAGGAAGCAGAAAGG - Intronic
905791542 1:40792198-40792220 CCCTGGGAGGGGAGGGGGCAGGG + Intronic
906059029 1:42936438-42936460 CCCAGGGTGAGCTGGGAGATTGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906209644 1:44005329-44005351 CCCTGAGTGAGAAGGGTGAGTGG + Intronic
906264385 1:44417616-44417638 CGCGGGGCGAGGAGGGAGGACGG - Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906412550 1:45590442-45590464 CCCAGGCTGAGGCAGGAGAATGG + Intronic
906535422 1:46548547-46548569 CCCTGGGAGAGATGGGAGAGGGG + Intronic
906780435 1:48568418-48568440 CCCAGGATGAACAGGGAGAAAGG - Intronic
906838926 1:49114755-49114777 CCTGAGGTGAGGAAGGAGAAGGG + Intronic
907496450 1:54848383-54848405 CTCTGGGGGAGGGGTGAGAAAGG - Intergenic
907596823 1:55727778-55727800 CCTTAGGTCAGAAGGGAGAAGGG - Intergenic
907596936 1:55728671-55728693 CCTTAGGTCAGAAGGGAGAAGGG + Intergenic
908534605 1:65066612-65066634 GTCTGGGGTAGGAGGGAGAACGG - Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910867460 1:91801418-91801440 CACTGGGTGAGGAGAGGGAAAGG + Intronic
910867652 1:91802872-91802894 CATTGGGTGAGGAGAGGGAAGGG - Intronic
911038598 1:93574736-93574758 CCCTAGGGCAGGAGGGAAAAAGG + Intronic
911040633 1:93588401-93588423 CCGGGGGTGAGGAGAGAGACAGG - Intronic
911070103 1:93825635-93825657 CCCTGGGGAAGGAGGGTGGAAGG - Intronic
912950653 1:114118195-114118217 TCCTGGGTGAGCAGGGGGAAGGG - Intronic
913120383 1:115734745-115734767 CCCTGAGAGAGGGGGAAGAAAGG - Intronic
913531300 1:119736061-119736083 CCCCTGGTGAGGAAGGGGAAAGG + Intronic
913578097 1:120197307-120197329 CCCTGGATGAGGTGAGAGCATGG + Intergenic
913630073 1:120701045-120701067 CCCTGGATGAGGTGAGAGCATGG - Intergenic
914457330 1:147848100-147848122 CCCTGGTAGAGGAAGGTGAAGGG + Intergenic
914560015 1:148808727-148808749 CCCTGGATGAGGTGAGAGCATGG + Intronic
914612818 1:149321488-149321510 CCCTGGATGAGGTGAGAGCATGG - Intergenic
914921642 1:151851404-151851426 CCCTGGCTGAGAATGGAGATAGG + Intronic
915124183 1:153651811-153651833 CCCTGGGTGGGCAGAGAAAATGG - Intergenic
915164301 1:153940126-153940148 GCCTGGGTGGGGAGGGAGGCTGG - Intronic
915267264 1:154727971-154727993 CCTAGCGAGAGGAGGGAGAATGG - Intronic
915298833 1:154940643-154940665 AACTGGGTGAAGAGGAAGAAAGG - Intergenic
915446475 1:155977510-155977532 CGCTGGGGGAGGAGGAGGAAGGG + Intronic
915728814 1:158038101-158038123 GCCTGGCTGATGAGGGAGGAAGG + Intronic
915777125 1:158502005-158502027 CTCTGGCTGAGGCGGGAGAATGG - Intergenic
916515726 1:165514667-165514689 TCCTGGGTGAGCAAGGTGAAAGG + Intergenic
916684602 1:167132882-167132904 CCCAGGGAGAGTGGGGAGAAGGG + Intergenic
916865766 1:168856426-168856448 CCAGGGGTTAGGAGGAAGAAAGG + Intergenic
916963999 1:169916577-169916599 CCCAGGATGAGGAGGGGGAGGGG - Intergenic
917537991 1:175888264-175888286 CCCTGGGGGAGGAGGGAGCTGGG - Intergenic
917724916 1:177819135-177819157 CCCTAGGTGGGTAGGGAGAGGGG + Intergenic
919465661 1:197919867-197919889 CCCAGGGTGTGCAGGGAGAGCGG - Intronic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920034337 1:203056211-203056233 CCCTGGGGGAGGAAGCTGAAAGG - Intronic
920052802 1:203173725-203173747 CCCAGGGTGAGGAGAGACACAGG - Intronic
920086655 1:203422398-203422420 CCTGGGGTGAGGACGGAGGAGGG - Intergenic
920400334 1:205672204-205672226 ACGTGGGTGAGGGGGGGGAATGG - Intronic
920618786 1:207523711-207523733 TCCTGGAAGCGGAGGGAGAAAGG + Exonic
920620568 1:207542282-207542304 TCCTGGAAGCGGAGGGAGAAAGG + Exonic
920622350 1:207560839-207560861 TCCTGGAAGCGGAGGGAGAAAGG + Exonic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
921031967 1:211341695-211341717 GCCGGGCTGAGGATGGAGAATGG + Intronic
921293870 1:213683841-213683863 CCCAGGGTGAGGAGGGAGGGAGG - Intergenic
921403580 1:214753769-214753791 CCCTGGGGGAGCATGCAGAAGGG - Intergenic
921446029 1:215248464-215248486 CCCTGTGAAAGGAGGGAGGAAGG + Intergenic
921871937 1:220150671-220150693 CCGTGCTTGAGGAGGAAGAATGG - Exonic
922124747 1:222711848-222711870 ACCTGGGAGAGGAGGAGGAAAGG + Intronic
922170467 1:223150332-223150354 AGCTGAGTGAGGAGGGAGGATGG - Intergenic
922340999 1:224655114-224655136 CCCTGGGTGTGAAGGGGTAAGGG + Intronic
922603925 1:226877238-226877260 CACTGGGTGAGGATGGAGCTTGG + Intronic
922604241 1:226879354-226879376 CTCTGAGTGAAGAGGGAGGAGGG + Intronic
922858736 1:228797263-228797285 CCATGGGTGAGGATGAAGTAAGG - Intergenic
922906912 1:229180278-229180300 CACCGGCTGAGAAGGGAGAAGGG - Intergenic
923220526 1:231888631-231888653 CGGTGGCTGAGGTGGGAGAATGG + Intronic
923868902 1:237969792-237969814 ACCAGGGTGAGGAGAGAGGAAGG + Intergenic
1062897640 10:1116355-1116377 CCCAGGGTGAGGTGGGTGACGGG - Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1064286798 10:13998671-13998693 GATTGGGTGTGGAGGGAGAAAGG - Intronic
1064672543 10:17731383-17731405 CCCTTGGTGGGGAGGGGGACAGG + Intergenic
1065901837 10:30214912-30214934 CCCAGAGTAAGGAGGGAGGAGGG - Intergenic
1065973982 10:30826775-30826797 CCTGGTGTGAGGAGTGAGAAGGG - Intronic
1065998724 10:31084194-31084216 CCCTGGGGCTGGAGGAAGAAAGG - Intergenic
1066195117 10:33091516-33091538 TACTTGGTGGGGAGGGAGAAGGG + Intergenic
1067146646 10:43699057-43699079 AACTGGGTGTGGAGGGAGAGGGG + Intergenic
1067471547 10:46541670-46541692 CCCTGGGAGAGGAGGAGGAAAGG + Intergenic
1067844604 10:49709846-49709868 TGCTGGGAGAGAAGGGAGAAGGG - Exonic
1067910819 10:50344765-50344787 CCCAGGCTGAGGCAGGAGAATGG + Intronic
1068072239 10:52209734-52209756 AGATGGGTGATGAGGGAGAAGGG - Intronic
1068957842 10:62836061-62836083 CCCAGGCTGAGGCAGGAGAATGG + Intronic
1069442560 10:68442028-68442050 CCCAGGATGAGGTGGGAGGATGG - Intronic
1069538151 10:69270963-69270985 CATTGGGTGAGGAAGAAGAATGG - Intronic
1069793823 10:71040002-71040024 GCGGGGGAGAGGAGGGAGAATGG + Intergenic
1070331044 10:75417570-75417592 CTCAGAGTGAGGAGGGAGGAAGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070785748 10:79161260-79161282 CCATGGCTGTGAAGGGAGAAGGG - Intronic
1070806316 10:79273063-79273085 CCTTGGGTGATGGGGGAGAGGGG + Intronic
1071456503 10:85855327-85855349 CCCTGGGCTTGGAGAGAGAAAGG - Intronic
1071815568 10:89229314-89229336 CCAGGGGTTAGGAGGGAGGAAGG + Intronic
1072475890 10:95759370-95759392 CCTTGGCTGAGCAGGGAGTAGGG - Intronic
1072541134 10:96398661-96398683 CCCAGGGCGAGGTGGGAGATGGG + Intronic
1073585332 10:104704525-104704547 TCCTGGGTGAGGAGGGAAACTGG + Intronic
1073607974 10:104915074-104915096 CCATGGTGGAGGAGGGAGAGAGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074466821 10:113691114-113691136 CACTGGGTCAGGAGTGTGAATGG - Intronic
1074819146 10:117166110-117166132 CGCTTGAGGAGGAGGGAGAAAGG - Intergenic
1075107758 10:119553209-119553231 GCCTGGGAGAGGAGGGTGAAAGG + Intergenic
1075467171 10:122660501-122660523 CCTTGTGTGAGGAGAGGGAAAGG - Intergenic
1075777704 10:124998973-124998995 CTCTGGCTGAGGAGGGTAAATGG - Intronic
1076067426 10:127459827-127459849 CTGTGGGTGAGAGGGGAGAAAGG + Intergenic
1076260185 10:129059007-129059029 CCTGGTGTGAGGAGGGACAAGGG + Intergenic
1076290067 10:129339308-129339330 CCCAGGGGGAGGAAGGAGGATGG + Intergenic
1076369154 10:129940742-129940764 CCCTGGGTGGGGAGGGGGCCTGG - Intronic
1076698723 10:132259187-132259209 CCCTGGGGCAGGTGGGAAAATGG + Intronic
1076713361 10:132351122-132351144 CGCTGGGTGATGTGGGAGCAGGG - Intronic
1077082349 11:729638-729660 CACTGGGCGAGGAGGGAGGGCGG + Intergenic
1077325881 11:1963939-1963961 CCATTGGTGAGGAGGGTGCAGGG - Intronic
1077591993 11:3499464-3499486 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
1077826939 11:5820813-5820835 CGCTTGGTGAGGAGAGTGAATGG - Exonic
1078355743 11:10630185-10630207 CTCTGGATGAGGTGGGTGAACGG + Intronic
1078375890 11:10792703-10792725 CCCTGGGTCAGGACGGGCAAGGG + Intergenic
1079004282 11:16781302-16781324 CCCTGAGTAGGGAGGAAGAAAGG + Intronic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1079648505 11:22896514-22896536 CCCAGGCTGAGGCAGGAGAATGG + Intergenic
1080021071 11:27560745-27560767 CCCTGGGGAATGAGAGAGAATGG + Intergenic
1080258795 11:30323256-30323278 CCCTGGGTGGCGAGGGAGCCCGG + Intronic
1080696691 11:34608892-34608914 GCCTGGGTGGGGAGGGCGAAAGG + Intergenic
1081265502 11:41015883-41015905 CCCAGGCTGAGGCAGGAGAATGG + Intronic
1081435388 11:43022045-43022067 CCCTGGTTTAGCAGGGATAAAGG - Intergenic
1081481300 11:43491999-43492021 TCCTGGGAGAAGAAGGAGAATGG - Exonic
1081665005 11:44911623-44911645 GCCGAGGTGAGGAGGGGGAAAGG - Intronic
1081911092 11:46700505-46700527 CCCCGGGTGGGGATGGGGAAAGG - Intronic
1081941319 11:46944688-46944710 CCCTCCTTTAGGAGGGAGAAGGG - Intronic
1082771151 11:57208597-57208619 CTCTGGGTAAGGAGGCAGATTGG + Intergenic
1083479147 11:62932700-62932722 CCCTGGGTGTGGGGGGAGCGGGG + Intergenic
1083593381 11:63907967-63907989 CTCTGGGGGAGGAGGGGGAGTGG - Intronic
1083802288 11:65053571-65053593 ACCTGGCTGGGGAGGGTGAAGGG + Exonic
1083990541 11:66243497-66243519 GCCTGGAGCAGGAGGGAGAAGGG - Exonic
1084784795 11:71435838-71435860 CCCTGGGGGGCGAGGGGGAAGGG + Exonic
1084824988 11:71723297-71723319 CCCTGGGGCTGGAGGGAGCAGGG - Intergenic
1085297736 11:75440356-75440378 CTATGGGAGAGGAGGGTGAAGGG - Intronic
1085326526 11:75610760-75610782 TGCTGGGTCAAGAGGGAGAATGG + Intronic
1086096255 11:83052783-83052805 CCTTTGTTGGGGAGGGAGAAGGG + Intronic
1088139242 11:106595638-106595660 CTCTGGGGGAGGTGGAAGAAAGG + Intergenic
1088259301 11:107928941-107928963 CCCTGGAAGAGGAGGGGCAAAGG - Intronic
1088363886 11:109018871-109018893 CCAAGGGTTAGCAGGGAGAAAGG - Intergenic
1088738685 11:112749168-112749190 GCCAGGGAGAGGAGGGAGCAAGG + Intergenic
1088912552 11:114202751-114202773 CCCGGGGTGAGGGGGCAGAGGGG + Intronic
1089614796 11:119689217-119689239 CCCAGGGTGAGGAGCGCAAACGG - Intronic
1089618186 11:119706996-119707018 AGCTGGGTGAGGAAGGAGAGGGG + Intronic
1089677577 11:120100097-120100119 CCCTGGGTGGGGTGGGGGAGAGG - Intergenic
1090051122 11:123380825-123380847 CCCAGAATGAGGAGGGAGATGGG - Intergenic
1090644638 11:128757907-128757929 ACCTGGGTGAGGAGGGACTTTGG - Intronic
1090968145 11:131616258-131616280 TCTTGGGTGAGGAAGGAGAAAGG - Intronic
1091226182 11:133957493-133957515 GTCTGGGTGCGGAGGGAGACGGG - Intergenic
1091278484 11:134368623-134368645 CTCTGCCGGAGGAGGGAGAAAGG - Exonic
1202808861 11_KI270721v1_random:19118-19140 CCATTGGTGAGGAGGGTGCAGGG - Intergenic
1091613213 12:2029422-2029444 CCCTGGGTGAGGCGGGAATAGGG - Intronic
1092014046 12:5141970-5141992 TCCAGGGTGATAAGGGAGAATGG + Intergenic
1093021254 12:14206397-14206419 ACCTAGGTCAGGAGAGAGAAAGG - Intergenic
1093296352 12:17396885-17396907 CCAGGAGTGAGGAGAGAGAAAGG + Intergenic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1094739756 12:33275255-33275277 ACCTGGGGAAGGGGGGAGAAGGG - Intergenic
1094766670 12:33603642-33603664 CCATGGTTGAGGAGGGGCAAAGG + Intergenic
1095587171 12:43862271-43862293 CCGTGGCTGAGGCAGGAGAATGG - Intronic
1095699484 12:45176093-45176115 TCCTGGGAGAGCAGGGAGCAAGG - Intergenic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096551815 12:52378116-52378138 CCCTGGGTGGGCAGGGGGCAGGG + Exonic
1097260631 12:57718125-57718147 CCCTGGGTGGGTAGGGAGTGGGG - Exonic
1097998995 12:65921362-65921384 CCCAGGCTGAGGCAGGAGAATGG - Intronic
1098601759 12:72339886-72339908 CCCTGGGAGAGAAGGGGTAAGGG + Intronic
1100386520 12:94109215-94109237 GCGTGGAGGAGGAGGGAGAAGGG + Intergenic
1100515293 12:95321713-95321735 CCCTGGGAGAGGCGGGAGCCAGG - Intergenic
1100840618 12:98608527-98608549 CCCAGGCTGAGGCAGGAGAATGG + Intergenic
1100922794 12:99507936-99507958 CCCTGGTAGAGGAGGAAAAAGGG - Intronic
1101211501 12:102539373-102539395 CTCTGGCTGGGGATGGAGAATGG + Intergenic
1101639702 12:106579214-106579236 CCAGGGATGGGGAGGGAGAAGGG - Intronic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1101957563 12:109224367-109224389 CCCCGAGTGATGAGGTAGAAGGG + Intronic
1102445325 12:112997877-112997899 CCATGGGTGGGGAGGCAGATGGG + Intronic
1102584849 12:113915577-113915599 CCCTGGGAGAGCAGGGAGACAGG - Intronic
1102634497 12:114311369-114311391 CCCTGGGACAGGAGGGAGTGAGG + Intergenic
1102961344 12:117095382-117095404 CCCTGGGTGGAGACAGAGAAAGG + Intronic
1103068216 12:117917786-117917808 CCTCGGGTGATGGGGGAGAATGG - Intronic
1103158848 12:118710615-118710637 CCCTGTGGCAGGAGGGAGCATGG - Intergenic
1103547120 12:121710297-121710319 TCCTGGGTGAGCAAGGAGCAAGG + Intergenic
1103952678 12:124559465-124559487 CCCTGGGTGAGAACTGAGCACGG - Intronic
1104379209 12:128292006-128292028 CCCTAGGGGAGGAGGAACAATGG - Intronic
1104401858 12:128482881-128482903 CCCTGGGTGAGTGGGCAGATGGG + Intronic
1104924856 12:132308815-132308837 CCGTGGGTGAGGTGTGAGGACGG - Intronic
1105490505 13:20883257-20883279 CAATGGGTGAGGAGAAAGAAAGG + Intronic
1105666710 13:22567059-22567081 CGATGGCTGAGGCGGGAGAATGG - Intergenic
1105686881 13:22792912-22792934 CTCGGGATGTGGAGGGAGAAAGG + Intergenic
1105746193 13:23379081-23379103 GCCTGGTAGAGGAGGGAGAGGGG - Intronic
1106136666 13:26978681-26978703 CCCTGGGTGCTGAGAGAGACAGG - Intergenic
1106541053 13:30690515-30690537 CCCTCAGTGAGGAGGGAAAAGGG - Intergenic
1106670138 13:31896540-31896562 CCCTGGCAGAGGAGGCAGCAAGG + Intergenic
1107522839 13:41200707-41200729 AGCTGGGTGAGGTAGGAGAAGGG - Intergenic
1107658912 13:42619178-42619200 CCCTGGTAGAGTAGGGAGCAGGG - Intergenic
1108134389 13:47339560-47339582 CCCTGGGTGGGATGGCAGAACGG - Intergenic
1108172986 13:47762546-47762568 CCTTGGGTTAAGAGGGAGTAAGG - Intergenic
1109309032 13:60671322-60671344 CACTAGGTAGGGAGGGAGAAAGG - Intergenic
1109958135 13:69595361-69595383 AGCAGGGTGAGGAGGGAGCAAGG + Intergenic
1110254458 13:73417418-73417440 CCCTGGGCGAGGGGGGAGGCGGG - Intergenic
1110702161 13:78561671-78561693 CCAAGGGTTAGGAGGGAGAAAGG + Intergenic
1110762980 13:79251269-79251291 GCCTGGGAGAGGAGGGAGGTGGG - Intergenic
1112200502 13:97269480-97269502 CCCTGGATGAGCAGGGAGGAAGG - Intronic
1112283955 13:98087586-98087608 CCCTGGGAAAGGATGGGGAAAGG - Intergenic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1112496077 13:99905868-99905890 TCCTGGCTGAGGTGGGAGGATGG - Intergenic
1112759696 13:102680473-102680495 AGCTGGGGGTGGAGGGAGAAAGG - Intergenic
1113541067 13:111110170-111110192 CCCTGGCTGAGCAGGCAGCATGG + Intergenic
1113556959 13:111244550-111244572 CTCTGGGAGAGAAAGGAGAATGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113740959 13:112712130-112712152 CTCAGGGTGGGGAGGGAGAACGG - Intronic
1113741380 13:112714463-112714485 CGGGGAGTGAGGAGGGAGAAAGG - Intronic
1113768340 13:112894316-112894338 CACTGGGCGGGGAGAGAGAAGGG - Intergenic
1114414592 14:22532763-22532785 CACTAGGTCAGGATGGAGAAGGG + Intergenic
1114549856 14:23526486-23526508 CCATGGCTGAGGAGGAAGAGGGG - Exonic
1115038393 14:28889031-28889053 TGCTGCTTGAGGAGGGAGAAGGG - Intergenic
1117475225 14:56087590-56087612 CGCTGGATGAGGAGTGAGTAAGG + Intergenic
1117609211 14:57464824-57464846 CCCTGGCTGGGGAGGAAAAAGGG + Intergenic
1117619407 14:57569196-57569218 CTCTGGCTGAGAATGGAGAATGG - Intronic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1117957060 14:61130969-61130991 TCCTGGAGGAGGAGGGAGGAGGG - Intergenic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1119461643 14:74809705-74809727 CACTGGGCCAGGAGGGGGAATGG - Exonic
1119701967 14:76761741-76761763 CCCTGGCTGAGGGTGGAGGAAGG - Intergenic
1119761457 14:77154914-77154936 CCCTAGGTGTGGAGGGGGAATGG + Intronic
1120981682 14:90294934-90294956 CCATGAGTTAGGAGGGGGAAGGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121325745 14:93018675-93018697 TCTTGGGTGAGGAAGGGGAAGGG + Intronic
1121492416 14:94369846-94369868 CCCTGGGGAAGGCAGGAGAAGGG + Intergenic
1121604291 14:95229243-95229265 CTCTGGGTGAGAAGGGGGATGGG - Intronic
1121816988 14:96936133-96936155 AACAGGGTGACGAGGGAGAAGGG - Intergenic
1122038531 14:98965422-98965444 AAAGGGGTGAGGAGGGAGAAGGG - Intergenic
1122046825 14:99029880-99029902 CACTGTGTGTGGAAGGAGAAGGG + Intergenic
1122156199 14:99751877-99751899 CCCTGGGTGAGAAGGGAGCCAGG + Intronic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123703220 15:22931303-22931325 ACCTGGGTGAGTGAGGAGAATGG + Intronic
1123705532 15:22948152-22948174 CACTGGCTGAGGGTGGAGAAGGG + Intronic
1124658182 15:31525146-31525168 CCCTGTGGCAGGAGGGAGAGAGG + Intronic
1124776383 15:32593531-32593553 CGCAGGGTGGGGAGGGAGGAAGG - Exonic
1125547040 15:40513429-40513451 CCCTGGGTGTGCCGGGAGGAAGG - Intergenic
1125673896 15:41492640-41492662 CCCTGGCTGAGGGGAGAGAAGGG + Intergenic
1126736095 15:51733499-51733521 CGCTGGGGGACTAGGGAGAAAGG + Intronic
1128270636 15:66306212-66306234 CCATGGCCGAGGAAGGAGAATGG - Intronic
1128338324 15:66802738-66802760 CACTAGGAGAGGACGGAGAAGGG - Intergenic
1128512555 15:68322309-68322331 CCCTGGCTGCTGTGGGAGAATGG + Intronic
1128560996 15:68667602-68667624 CCCTGCGTGAGGAGTGGGACGGG + Intronic
1128591976 15:68906216-68906238 CCCAGGGAGTGGAGGGAGATGGG - Intronic
1129168128 15:73790919-73790941 CCGTGGATGAGCAGGGAGACTGG - Intergenic
1129294292 15:74591446-74591468 TCCTGGGGGAGAAGGAAGAAAGG + Intronic
1129530677 15:76261723-76261745 CCACGAGTGAGGAGGGAGGAGGG + Intronic
1129604719 15:77019270-77019292 CCCTGGGTGAGGACAGAGCCAGG + Intronic
1129879213 15:78996049-78996071 CCCTGCCTGAGGTGGCAGAAAGG - Intronic
1129919948 15:79311443-79311465 ACCTGGGAGTGGAGGGAGAAGGG - Intronic
1130298027 15:82660849-82660871 CCATGAATGAGGAGGGAGACAGG - Intronic
1130778159 15:87006906-87006928 TCATGGGTGAGGAGTGAGACAGG + Intronic
1130821768 15:87503340-87503362 CCCTGGGTGAGTGGGGAGCAGGG + Intergenic
1131222357 15:90595454-90595476 CCCAGGCTGAGGCAGGAGAATGG + Intronic
1131577733 15:93608455-93608477 TCCTGGGAGAGGACTGAGAAAGG - Intergenic
1131782129 15:95871117-95871139 CCCTGCGTGGGGATGGAGCATGG + Intergenic
1132146865 15:99434363-99434385 GCCTGGGTGATGATGGAGATGGG - Intergenic
1132306784 15:100820795-100820817 CCCTGGGTTAGGTGGGGGGATGG - Intergenic
1132874973 16:2133107-2133129 ACATGGGTCAGGAGGGAGAAGGG + Intronic
1133112101 16:3554185-3554207 CCTTGGAGGAGGAGGGAGAAGGG + Intronic
1133140628 16:3741151-3741173 CCCTGGGTGAGGAGGGGTGGCGG - Intronic
1133235539 16:4385781-4385803 CCCTGGGTGAGGATGAGGAGGGG + Intronic
1134019983 16:10914926-10914948 CCCAGGCTGCGGCGGGAGAAGGG + Intronic
1134070249 16:11256046-11256068 CCCTGGGCGAGGAGGCGGGAGGG - Intronic
1135293964 16:21263510-21263532 CCGGGGGTGAGGAGAGGGAAAGG - Intronic
1135638802 16:24102047-24102069 CCCTGTATCAGGAGGCAGAATGG - Intronic
1135668364 16:24354425-24354447 GCTGGGCTGAGGAGGGAGAATGG + Intronic
1135721580 16:24822554-24822576 CCCTGAGGGAGGAGGGAGGTGGG - Intronic
1135938608 16:26801834-26801856 CCCTGGGGCAGGAGGAAGCAAGG - Intergenic
1136024249 16:27459898-27459920 TTCTGGATGAGGAGGGACAAAGG - Intronic
1136043968 16:27601325-27601347 TACTGGGTGAGGAGGCAGACAGG + Intronic
1136121490 16:28138606-28138628 CTCTTGCTGAGGAAGGAGAATGG - Intronic
1136403633 16:30031142-30031164 CCCTCGGTGGGGAGGGGGAGGGG + Exonic
1136518234 16:30780663-30780685 CCCTGGCTGGGCAGGGAGAAAGG + Exonic
1136634436 16:31510654-31510676 TCCTGAGTGGGGAGGGAGCATGG + Intergenic
1136913803 16:34163252-34163274 GCCTGCGGGGGGAGGGAGAAGGG - Intergenic
1137447101 16:48538593-48538615 GCCTGGCAGGGGAGGGAGAAGGG + Intergenic
1137589798 16:49686622-49686644 GCCTGGGTGTGGTGGGAGAGGGG - Intronic
1138385740 16:56634877-56634899 CCGTGGCTGAAGCGGGAGAATGG - Intergenic
1139523174 16:67496995-67497017 ACCTGGGGGTGGAGGGAGCAGGG + Intergenic
1140156978 16:72440311-72440333 CCCTGGGTGTGGAGGTTGCAGGG - Intergenic
1140177663 16:72679958-72679980 TGCAGGGTGAGGAGGGGGAATGG + Intergenic
1140722892 16:77787346-77787368 CCCTGTGGAAGGAGGGAAAATGG + Intergenic
1141053713 16:80796711-80796733 TCCAGGGTGAAGTGGGAGAATGG - Intronic
1141070318 16:80948664-80948686 ACCTTGGTTGGGAGGGAGAATGG - Intergenic
1141429326 16:83963063-83963085 CCCTGGGGGCGGAGGAAGCAGGG - Intronic
1141592673 16:85078904-85078926 CACTGTGGGAGGAGAGAGAATGG - Exonic
1141820156 16:86440222-86440244 CCCCAGGTGAGCAGGGAGAAGGG + Intergenic
1142168240 16:88605183-88605205 CCCTGAGTGAGCAGGGAGGGAGG + Intronic
1142176340 16:88647119-88647141 CCCCGGGGGAAGAGGAAGAAGGG - Exonic
1142433147 16:90041201-90041223 GCCAGGGTGAGGATGGAGGATGG + Intronic
1142501549 17:335945-335967 CCCCCGGCGTGGAGGGAGAACGG + Intronic
1142632242 17:1232551-1232573 CGCAGGCTGAGGAGGGAGGATGG - Intergenic
1142717513 17:1755140-1755162 CCCGGGCAGAGGAGGGAGACAGG - Exonic
1142877647 17:2861742-2861764 CCCAGGCTGAGGCAGGAGAATGG - Intronic
1143008523 17:3852796-3852818 GCCTGTGGGAGGAGGGAGAATGG - Intergenic
1143130999 17:4676811-4676833 CCCTGGATGTGGAGGAAAAAAGG + Exonic
1143310314 17:5982345-5982367 CCCTGGCCCAGGAGGGAGGAAGG + Intronic
1143310441 17:5983576-5983598 CCCTGGCCCAGGAGGGAGGAAGG - Intronic
1143326511 17:6102035-6102057 CGCAGGGAGAGGAGGAAGAAAGG + Intronic
1143473298 17:7189841-7189863 ACCTGGGTGTGGAGGGAGATGGG - Intergenic
1143494022 17:7300676-7300698 AACTCAGTGAGGAGGGAGAACGG - Intergenic
1143954181 17:10656004-10656026 GCCGGTGGGAGGAGGGAGAAAGG + Intronic
1144438183 17:15259831-15259853 CCCAGGCTGAGGCAGGAGAATGG + Intronic
1144577076 17:16436043-16436065 ACCTGGGTGAGGAGGGGGTGGGG - Intronic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1144888163 17:18477847-18477869 TCCTGAGTGGGGAGGCAGAATGG + Intronic
1144957978 17:19029053-19029075 CTCTGGGTGAGGGGACAGAAAGG + Intronic
1144977180 17:19145467-19145489 CTCTGGGTGAGGGGACAGAAAGG - Intronic
1145018963 17:19415468-19415490 CCCTGGCTGAGAAGGAAGGAAGG + Intronic
1145059160 17:19721363-19721385 CCTTGCGGGAGGAGGGAGAGAGG - Intergenic
1145278894 17:21454303-21454325 CCCTGGGGGAGCTGGGGGAAGGG + Intergenic
1145398972 17:22516192-22516214 CCCTGGGGGAGCTGGGTGAAGGG - Intergenic
1145841374 17:27998000-27998022 CCCGAGGTGAGGAAAGAGAAGGG - Intergenic
1146371375 17:32266921-32266943 CCCTGGGCGAGGAGAGGGAGGGG + Intronic
1146453710 17:32993846-32993868 CGCCGGGAGAGGAGGGACAACGG + Intronic
1146517193 17:33498499-33498521 CCCTGGGTGAGGGAAGAGCAGGG + Intronic
1146951581 17:36910309-36910331 CCATGGGTGAGGAGGCTAAAGGG - Intergenic
1147134258 17:38426058-38426080 CCATGGGGGAGGAGGGAGGGTGG - Intergenic
1147187261 17:38719672-38719694 CCCTGGGGGATACGGGAGAAGGG + Intronic
1147377823 17:40033313-40033335 CCCTGGGGGATGGTGGAGAAGGG - Intronic
1147389047 17:40098262-40098284 CCATGGGCGGGGTGGGAGAAGGG + Intronic
1147563293 17:41521900-41521922 ACCTGGGATAGGAGGGAGAGGGG - Exonic
1147627240 17:41908081-41908103 CCCTGGGGGAGGAGGAAGATGGG - Intronic
1147769486 17:42857589-42857611 CCCTGGGTGAGGTGGGGGTCTGG + Exonic
1148676557 17:49448886-49448908 GGCTGGGAGAGAAGGGAGAAGGG + Intronic
1148840783 17:50495481-50495503 CCCTGAGAAAGCAGGGAGAATGG - Intergenic
1148863770 17:50618201-50618223 CTCTGGGGGAGGAGGGAAAGGGG - Exonic
1149422220 17:56521780-56521802 CCCAGGGTGAGAAGAGAAAAGGG - Intergenic
1150208160 17:63425171-63425193 ACATGGGGGAGGAGCGAGAAGGG - Exonic
1150215625 17:63467370-63467392 GTCAGGGAGAGGAGGGAGAAGGG - Intergenic
1151313438 17:73308355-73308377 GCCTGTGGGCGGAGGGAGAAGGG - Intronic
1151393138 17:73801382-73801404 CTCTGCCGGAGGAGGGAGAAGGG + Intergenic
1151497375 17:74466910-74466932 CCCTGGGAGAGGAAGGAGCCAGG + Intronic
1151523567 17:74648257-74648279 CCATGGGGAAGGAGGGAGAGGGG + Intergenic
1151552936 17:74832318-74832340 CCCTGGGAGTGGAGAGTGAAGGG - Intronic
1151591803 17:75049527-75049549 TCCTGGGTGAGAAGGAAGATAGG + Intronic
1151861091 17:76762549-76762571 CCCAGGCTGAGGCAGGAGAATGG + Intronic
1152040348 17:77898877-77898899 TGCTGGGCGAGGAGGGAGACAGG - Intergenic
1152044986 17:77929789-77929811 CCCTGGGAGAGGAAGAAGGATGG - Intergenic
1152079368 17:78176901-78176923 CCCTGGGTGGGAATGGAGAGGGG + Intronic
1152367475 17:79864909-79864931 CCCTGGGTGAGCCAGGAGAGAGG - Intergenic
1152604566 17:81282644-81282666 CCCTGGGCGAGGGGTGGGAAAGG + Intronic
1152617664 17:81345414-81345436 CCCAAGGTGAGGGTGGAGAAGGG + Intergenic
1152684856 17:81688928-81688950 CCCTGTGTTGGGAGGGAGGAGGG + Intronic
1153568879 18:6448187-6448209 CCCTGAGAGGGGCGGGAGAAGGG - Intergenic
1153618443 18:6954596-6954618 GGCTGGCTGAGGAGGGAGCAGGG + Intronic
1154133582 18:11757389-11757411 CTCTGGCTGTGGATGGAGAACGG + Intronic
1155206927 18:23566840-23566862 CCATGGGTTAGGAGAGAGGAAGG - Intronic
1155649375 18:28121994-28122016 CCATGTGTCAAGAGGGAGAAGGG - Intronic
1155741315 18:29291403-29291425 CCGTGGCTGAGGCAGGAGAATGG + Intergenic
1156848538 18:41698672-41698694 CCCAGGGAGTGGAGGGAGATAGG + Intergenic
1157342831 18:46794592-46794614 CCCAGTGTGAGGGGGGAAAAAGG + Intergenic
1157490535 18:48120703-48120725 CACTGGGGGAGGAGGGAAAGTGG + Intronic
1157590715 18:48834996-48835018 CCCTCTGTGAGAAGGGAAAAAGG + Intronic
1157664071 18:49470365-49470387 CCCTGAGTGGCGAGGGAAAATGG + Intergenic
1160748523 19:722830-722852 GCCTCCCTGAGGAGGGAGAAGGG + Intronic
1160802463 19:976741-976763 CCCTGAGTAGGGAGGGAGAGAGG - Intergenic
1160803273 19:980041-980063 CCCTGGCTGGGGAGGGAGGTGGG - Intergenic
1161071989 19:2267088-2267110 CCCTGAGTGGGGAAGGAGAGAGG + Intronic
1161072096 19:2267641-2267663 CCCTGAGTGGGGAAGGAGAGAGG - Intronic
1161126879 19:2562815-2562837 CTCTGAGTGGGGAGGGAGAGAGG + Intronic
1161134812 19:2613514-2613536 CCCTGAGTGGGGAGGGAGAGAGG - Intronic
1161138386 19:2634069-2634091 CCCTGAGTGAGGAGGGAGAGAGG + Intronic
1161139224 19:2637947-2637969 CCCTGAGTTGGGAGGGAGAGAGG + Intronic
1161144756 19:2670944-2670966 CCCTGAGTGGGGAGGGAGAGAGG + Intronic
1161145833 19:2677608-2677630 CCCTGAGTGGGGAGGGAGAGAGG - Intronic
1161148561 19:2694647-2694669 CCCTGAGTGGGGAGGGAGAGAGG - Intronic
1161212596 19:3075363-3075385 CCCTCAGTGGGGAGGGAGAGAGG - Intergenic
1161212866 19:3076630-3076652 CCCTGAGTGGGGAGGGAGAGAGG + Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161247186 19:3259579-3259601 CCCTGAGTGGGGAGGGAGACAGG - Intronic
1161280587 19:3443536-3443558 CCTTGAGTGGGGAGGGAGAGAGG - Intronic
1161281097 19:3446196-3446218 CACGGAGTGAGGAGGGAGAGAGG - Intronic
1161387955 19:4007079-4007101 CCATGGGTGGGGAGGCAGGATGG + Intergenic
1161440756 19:4290426-4290448 TCCTGGGCGATGAGGGAGAAAGG - Exonic
1161520466 19:4720923-4720945 CCCTGAGTGGGGAGGGAGAAAGG - Intronic
1161558614 19:4958192-4958214 CCCTGAGTGAGGTGGCAGAAGGG + Intronic
1161628485 19:5339936-5339958 CCCTGGGTGGGGAGGCTGGAAGG + Intronic
1161716822 19:5880842-5880864 CCCTGGGCCAGGAGGGAGGCTGG + Intronic
1161803619 19:6429830-6429852 CACTGGGAGAGGAGAGAGGAGGG + Exonic
1162100693 19:8336837-8336859 CCCTGGGGTAGGAGGGAGGAGGG + Intronic
1162300980 19:9844821-9844843 CCATGGGGAAGGAGGGAGACAGG - Intronic
1163034373 19:14562731-14562753 CCCTGGGTGTGGCGGGGAAATGG + Intronic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163640798 19:18460964-18460986 CCATGGGTGAGGGGGGTGGAAGG + Intronic
1163865768 19:19772102-19772124 CCCAGGCTGAGGCAGGAGAATGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164898151 19:31895599-31895621 GGCTGGGTGAGGATGGAGATTGG - Intergenic
1164909020 19:31990517-31990539 CCCTGTGTTAGAGGGGAGAATGG - Intergenic
1165785669 19:38460354-38460376 CCCTGGGTAAGGAAGGACAATGG - Exonic
1165843526 19:38803697-38803719 CCCCGGGTGAGGAGTGGGAATGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166218307 19:41350786-41350808 GGCTGGGTGGGGAGGGAGACTGG - Intronic
1166516264 19:43449295-43449317 CCAAGGCTGAGGAGGGAGGATGG + Intergenic
1166647691 19:44544254-44544276 CCCTGGGTGGGTAGGTAGATGGG - Intergenic
1166715107 19:44961925-44961947 GCCAGGGTAAGGAGGGAGAATGG - Intronic
1167378466 19:49125215-49125237 CCCTGGGAGAGGAGGCAGCTGGG - Intronic
1167639091 19:50670535-50670557 CCCTGAGTGAGGTGAGTGAATGG - Intronic
1168144991 19:54415726-54415748 TCCTGGGTCCCGAGGGAGAAGGG + Intronic
1168371605 19:55839123-55839145 CCGTGGGTGAGGGGTGGGAAAGG - Intronic
1168540275 19:57204109-57204131 CCCGGGCTGAGGCAGGAGAATGG + Intronic
925149188 2:1602904-1602926 CCCTGGGGGAGGAGCGGGGAAGG - Intergenic
925745997 2:7044298-7044320 AACTGGGGGTGGAGGGAGAAAGG + Intronic
925910705 2:8571911-8571933 CCCTGAGCGGGGAGGGGGAATGG - Intergenic
926992065 2:18690583-18690605 CTCTGGCTGAGGATGCAGAATGG - Intergenic
927256528 2:21044578-21044600 TGCTGGGGGAGGAGAGAGAAGGG + Intergenic
927494925 2:23545881-23545903 CCTTGGATGAGGCGGGAGGAAGG - Intronic
927651059 2:24914049-24914071 GGCTGGGTGAGGAGGAAGGAGGG - Intronic
927675853 2:25105573-25105595 CCCAGGGAGAGGAAAGAGAAGGG - Intronic
927836151 2:26400980-26401002 CACTGGATGAGCAGTGAGAAAGG - Intergenic
928002739 2:27539023-27539045 CCCTTGCAAAGGAGGGAGAAGGG + Intronic
928518197 2:32063650-32063672 TCCTGGCCGAGGAAGGAGAAAGG + Exonic
928939902 2:36717281-36717303 CCCAGGCTGAGGCAGGAGAATGG - Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929014972 2:37484967-37484989 CCCAGAGTGGGGAGGGAGACAGG + Intergenic
929546546 2:42858532-42858554 ACTTGGGTGTGGAGGGAGCAGGG + Intergenic
929997413 2:46837397-46837419 GCCTGGCGGAGGAGAGAGAAGGG - Intronic
930695038 2:54402599-54402621 CCCATGGGGAGAAGGGAGAAAGG + Intergenic
931714677 2:65019761-65019783 GGCTGGGTGAGGAAGGAGAGGGG - Intronic
931802485 2:65772184-65772206 CCCAGGGTAAGGAGACAGAAAGG - Intergenic
932106192 2:68944787-68944809 CCTGGAGTGAGAAGGGAGAAAGG - Intergenic
932577041 2:72968394-72968416 CCATGGGGGAGGAGGGGGAGAGG - Intronic
932581455 2:72995002-72995024 CCCAGGGTGTGGTGGGAGCAGGG - Intronic
932603349 2:73145535-73145557 GCCTGTGAAAGGAGGGAGAAGGG - Intronic
932845395 2:75129909-75129931 CCCTGAGTGAGGAGGAGGCAGGG - Intronic
932852699 2:75201654-75201676 CCCTGAGTGAGGAGAGAAGAGGG + Intergenic
934551900 2:95267872-95267894 CCAAGGGTAAGGAGGCAGAATGG - Intergenic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935132888 2:100274645-100274667 CCCTGGGTGATCAGGGTGAGGGG - Exonic
935812049 2:106808180-106808202 CACTGGGAGAGAAGAGAGAAAGG + Intronic
936018836 2:108979636-108979658 CCCTGGGTAGGGAGGCAGGAGGG - Intronic
936232111 2:110712161-110712183 AGCAGGGTGAGGAGGGAAAATGG - Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936662784 2:114560565-114560587 TCCTGGGTGAGGAGAGAGTGGGG + Intronic
937309273 2:120892131-120892153 CCCTGGCTGACGGGGGAGAGAGG - Intronic
937318995 2:120949523-120949545 CCCTTGGGGAGCAGAGAGAAGGG + Intronic
937363078 2:121242535-121242557 CCCTGGGTGAGGTGGGAAGCAGG - Intronic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937639573 2:124196218-124196240 CCCTAGGTGAGAAGGGCTAAGGG + Intronic
937956034 2:127422310-127422332 CCATGGGTGAGGTGGGAGCACGG - Intronic
938306750 2:130261848-130261870 TGCCTGGTGAGGAGGGAGAAGGG - Intergenic
938320589 2:130359677-130359699 CCTTGTGGGAGGAGGGAGGAGGG + Intronic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
938796204 2:134719497-134719519 CCCTGGATGAGCAGTGAGAATGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941333276 2:164207427-164207449 GCATTAGTGAGGAGGGAGAAAGG + Intergenic
941995257 2:171596040-171596062 GCCTGGAAGAGGAGAGAGAAGGG - Intergenic
942198987 2:173552108-173552130 AGCTGGGGGAGAAGGGAGAATGG + Intergenic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
943065883 2:183085611-183085633 CCATAGGTGAGGAGGGGGAGGGG + Intronic
943779211 2:191803147-191803169 ACCTAGGTGAGGAAGGAGGAGGG - Intergenic
944135439 2:196394145-196394167 CCGGGGGTGAGGGGGGAGAGGGG + Intronic
944712479 2:202347300-202347322 CCCAGGCTGAGGCAGGAGAATGG + Intergenic
945426146 2:209705632-209705654 ACCTCGCCGAGGAGGGAGAATGG - Exonic
946143906 2:217714296-217714318 GCCAGGGAGAGGATGGAGAAGGG - Intronic
946317607 2:218928094-218928116 CCCTGGGGTGGGAGGGAGCATGG + Intergenic
946391569 2:219419507-219419529 CCCTGGGGGAGGTGGGGGGAGGG + Intronic
947523904 2:230867013-230867035 TGCTGGGTGAGGGGGAAGAAAGG - Intronic
947535779 2:230939842-230939864 CCCTGGGTGGGGAGGGATGGTGG - Intronic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
947831700 2:233146141-233146163 ACCTGGGAGAGGAGGGAAAGAGG - Exonic
947912810 2:233812395-233812417 CCATTGGTGGGGAGGGGGAAAGG + Intronic
948298702 2:236885616-236885638 CCATGGGTGAAGAGGGTGGATGG - Intergenic
948301392 2:236909777-236909799 CCAGGGATGAGGAGGGGGAAGGG - Intergenic
948621501 2:239237965-239237987 CCCTGGGTCAGGAGAAAGACCGG + Intronic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948921933 2:241069899-241069921 CCCTGGATGAGGCAGGAGCAGGG - Exonic
949056311 2:241929693-241929715 CCCTGAGCGTGGAGGGAGAATGG + Intergenic
1168852592 20:986807-986829 CCAAGTGTGTGGAGGGAGAATGG + Intronic
1169258080 20:4113884-4113906 CCCTTCCTGAGAAGGGAGAAGGG + Intergenic
1169276638 20:4237561-4237583 CCCTGGGGCAGGTGTGAGAATGG + Intronic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG + Intergenic
1170135434 20:13068971-13068993 CCCTGAGTCAGGAGGCAGAGAGG + Intronic
1170429983 20:16267057-16267079 CTCTGGGGGAGGAGAGATAAGGG - Intergenic
1170736471 20:19017594-19017616 CTCTAGGAGAGGAGGGGGAAGGG - Intergenic
1170982565 20:21228475-21228497 CCATGGGGAAGGAGCGAGAACGG - Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171233843 20:23508923-23508945 CCCTGGCTCAGGAGGGACAATGG - Intergenic
1171810260 20:29741346-29741368 ACCTGCGGGGGGAGGGAGAAGGG + Intergenic
1171908714 20:30921825-30921847 GCCTGCGGGGGGAGGGAGAAGGG - Intergenic
1172030001 20:31975109-31975131 CCTGGGGAGAGGAGGGAGGATGG + Intronic
1173143175 20:40502616-40502638 TGCTGGGTGAGGAAGGAGGAGGG - Intergenic
1173149060 20:40550403-40550425 TCGTGGGTGAGGAGAGGGAAGGG - Intergenic
1173614521 20:44394154-44394176 CCCTGGGAGGAGGGGGAGAACGG + Intronic
1173672755 20:44809906-44809928 GCGCGGGTGAGGAGGGAGATGGG + Intronic
1173686010 20:44924014-44924036 ACCTGGGTGCTGAGGGAGACGGG + Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1173847414 20:46196936-46196958 TCCTGGGTGAGGAGTGGGCAGGG + Intronic
1173951569 20:46997570-46997592 CCCTGGGGGAGGATGAAGAAGGG + Intronic
1174115898 20:48226158-48226180 CCCTGGGTGACCATGGACAAGGG - Intergenic
1174286932 20:49480580-49480602 CCCTGAGAGTGGATGGAGAAGGG - Intronic
1174406879 20:50308694-50308716 CCCAGGGAGAGGAGGAAGTAGGG + Intergenic
1174637441 20:52013812-52013834 CCCAGGCTGAGGCAGGAGAATGG + Intergenic
1175278404 20:57787414-57787436 CCCTGGGGGAGGAGGAAGGCTGG - Intergenic
1175332526 20:58175232-58175254 CCCAGGGTGTGGGAGGAGAAAGG + Intergenic
1175339353 20:58218404-58218426 CCCTTGGTGAGCAGGGAGGCAGG - Intergenic
1175552619 20:59827118-59827140 ACCTGGAAGAGGAGGTAGAAGGG + Intronic
1175746962 20:61463802-61463824 CACTGGGTGAGCTGGCAGAAAGG + Intronic
1175895368 20:62333573-62333595 CCCTGCGTGTGGAGGCCGAAGGG - Exonic
1175923008 20:62458799-62458821 GCCTGGGGGAGGAGGAAGACGGG - Intergenic
1175967291 20:62665983-62666005 CCCTGGGGGAGGAGGGGGTGTGG + Intronic
1176158883 20:63638483-63638505 CCCTGGGAGAGGAGGAAGCTGGG + Intergenic
1177539471 21:22472476-22472498 CCAAGGGTGGGGAGGGAGAAAGG + Intergenic
1177677182 21:24316063-24316085 CCATAGGAGAGGAGGGGGAAAGG - Intergenic
1179568021 21:42261210-42261232 GCCTGGGTGGGGCGGGAGAGGGG - Intronic
1179878559 21:44283955-44283977 CCATGGATGAGCAAGGAGAATGG + Intergenic
1180223924 21:46377888-46377910 GCATGGGGGAGAAGGGAGAATGG - Intronic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180249147 21:46568159-46568181 CCCTCTGTGAGCAGGGAGGATGG - Exonic
1180607360 22:17068800-17068822 CAGTGGGTGAAGGGGGAGAAGGG - Intergenic
1180951250 22:19721618-19721640 CCTGGGGGAAGGAGGGAGAAAGG - Exonic
1181456971 22:23065261-23065283 CCCAGGGTGATGGGGTAGAAAGG + Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181914339 22:26267527-26267549 CTCTGGGTAAAGAGGGAGTAGGG + Intronic
1181930261 22:26395159-26395181 ACCTGGGCCAGGAGAGAGAAAGG + Intergenic
1182336271 22:29585545-29585567 CCCTAGCTGAGGTGGGAGTAGGG - Intergenic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182427086 22:30279586-30279608 CCCTGGGTCAGGAAGGAGCCAGG + Intergenic
1182444029 22:30379952-30379974 CCCTGGGGGCTGAAGGAGAAGGG + Intronic
1182502427 22:30757134-30757156 CCCTGGGAGATGGGAGAGAAAGG - Intronic
1183078404 22:35441181-35441203 CTCTGGGAGAGGCTGGAGAAGGG + Intergenic
1183094410 22:35543496-35543518 GCCTGGCTGAGGATGGAGAAGGG + Intronic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1183344421 22:37299205-37299227 CCCTGGGGGAGGAGGCGGAAGGG - Exonic
1183366863 22:37411448-37411470 CCCTGGGTGAGGAGGGGAAGCGG + Intronic
1183538195 22:38415314-38415336 CCCAGGGGCAGGAGGGAGACAGG - Intergenic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1184879333 22:47295112-47295134 TCCTGGGTGAGGTGGTTGAATGG + Intergenic
1185173192 22:49305236-49305258 CCCTGGCTGAGGGGGCAGAGGGG - Intergenic
1185195301 22:49465556-49465578 CCCTCGGTGAGGGGTGTGAAGGG - Intronic
1185212033 22:49575806-49575828 CCCCGTGACAGGAGGGAGAAGGG - Intronic
1185379633 22:50502527-50502549 CCCTGGGTTGGGACGGAGGAGGG - Intergenic
949261185 3:2104730-2104752 GCCTGGGGGAGAAGGGTGAAAGG + Intronic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
949952162 3:9238307-9238329 CCCTGACTGAGGAGGGACCAAGG - Intronic
950090471 3:10290989-10291011 CCCTGGTGGAGGAGGGAGGGAGG + Exonic
950155994 3:10722131-10722153 CCCTGGGAGAGCAGGAACAATGG - Intergenic
950542407 3:13620330-13620352 GCCTGGGTGGAGAGGGGGAAGGG + Intronic
950823294 3:15786459-15786481 ACCAGGGAGAGGAGGGAGGAAGG + Intronic
950916821 3:16654482-16654504 CCCTGGGAGAGGAGGGAGAGAGG + Intronic
950933493 3:16814568-16814590 CCAGGGGTTAGTAGGGAGAAAGG - Intronic
953331150 3:42053752-42053774 CCCTTGGTGAGGGAGGGGAAAGG - Intronic
953392406 3:42541114-42541136 CCCTGGGTGAGTGGTGAGAATGG - Intergenic
953411522 3:42692980-42693002 CCAGGGGTGATGAGGGAGATAGG + Intronic
953474044 3:43191097-43191119 CACTGGGTGAGGAGCTACAATGG + Intergenic
953545295 3:43859912-43859934 CCCAGGGCAGGGAGGGAGAAGGG + Intergenic
953931284 3:47007117-47007139 CCCTGGGTGATGAAGGAGTGGGG - Exonic
954160159 3:48715592-48715614 GCCTGGGTAGGGAGGGAGCAAGG - Intronic
954453031 3:50581924-50581946 ACCTGGGTGGGGAGGGCGAAGGG + Exonic
954737307 3:52717047-52717069 CCCTGGGCTAGGTGGAAGAAGGG - Intronic
954745968 3:52787765-52787787 CCCTGGGGGAGGAGACAGAGAGG + Intronic
955817481 3:62860854-62860876 CACTTGGGGAGGAGTGAGAAAGG + Intronic
956173618 3:66453056-66453078 CCCTGAGTGAGGATGGGAAATGG - Intronic
956178079 3:66493077-66493099 CCTTGAGGGAGGAGGGAGGAGGG - Intronic
956196777 3:66661112-66661134 GACTGGGTGAGGAGGGTCAAAGG + Intergenic
957062041 3:75490021-75490043 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
957526034 3:81379958-81379980 CACTGGGCCAGGATGGAGAAGGG + Intergenic
959707019 3:109347809-109347831 CGCAGGCTGAGGCGGGAGAATGG - Intergenic
960045328 3:113192000-113192022 CACTGGGAGAGGAATGAGAAGGG - Intergenic
960460054 3:117922522-117922544 CACTGGGTGAGGAGTGTGATTGG - Intergenic
961291360 3:125849380-125849402 CCCTGGGGCTGGAGGGAGCAGGG - Intergenic
961445476 3:126979011-126979033 TACTGGGTGAGGAAGGAGATGGG - Intergenic
961625292 3:128258145-128258167 CCCTGAGAGAGGAGGAGGAAGGG + Intronic
961854362 3:129854619-129854641 CCCTGTGGTAGAAGGGAGAATGG - Intronic
961895812 3:130166968-130166990 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
962274570 3:134002290-134002312 CCCTGGGCCAGGAGGCAGGAGGG - Intronic
962411496 3:135144867-135144889 CCCAGGGTAAGGAGGAAGATAGG + Intronic
962436759 3:135374031-135374053 AGCTTGGTGAGGAAGGAGAAGGG - Intergenic
962743183 3:138378136-138378158 CCCTGGGTGAGGAGTAAGAAGGG - Intronic
962837565 3:139202711-139202733 CCCTGGGTGAGGACAGGGACTGG - Intronic
962925438 3:139988980-139989002 CCCTTGCTGAGGAGGGAGTATGG - Intronic
962931515 3:140041875-140041897 ACCTGTGTGAGGAGGGAAGAGGG + Intronic
963387237 3:144612865-144612887 CCTTTTGTGAGGAGGGAGCAAGG - Intergenic
963829101 3:149988048-149988070 ACCTAGGGGAGCAGGGAGAAGGG - Intronic
964936761 3:162098624-162098646 CCGAGTCTGAGGAGGGAGAAAGG + Intergenic
965167194 3:165210161-165210183 CCCTGTGAGAGGAGGTAGTATGG + Intergenic
965826386 3:172735184-172735206 CCCGGGGTTAGGAGAGAGGAAGG - Intergenic
966828140 3:183982762-183982784 CCCTGGGTGAGGTGAGTGAGGGG - Exonic
967300680 3:188009187-188009209 CCCAGGAGAAGGAGGGAGAAGGG + Intergenic
967619926 3:191620607-191620629 TTCTGGGTGAGGAAAGAGAATGG + Intergenic
968486805 4:866823-866845 TCCTGGGGGAGGTGGGGGAAGGG + Intronic
968518112 4:1023353-1023375 CCCCGGGGGAGGAGGGAGCCGGG - Intronic
968756276 4:2417966-2417988 ACCGGGATGAGGAGGGAGAGGGG + Intronic
969005936 4:4020112-4020134 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
969307637 4:6334960-6334982 ACCTTGGACAGGAGGGAGAATGG - Intronic
969459526 4:7321683-7321705 GGCTGGGTGAGGAGGGTGATGGG + Intronic
969554363 4:7896529-7896551 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969554381 4:7896587-7896609 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969554399 4:7896645-7896667 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969554444 4:7896790-7896812 CCCTGGGTGTGGGGGGAGTGAGG - Intronic
969807013 4:9617178-9617200 CCCTGGGGCTGGAGGGAGCAGGG - Intergenic
970292506 4:14589764-14589786 TCCCGGTTGAGGAAGGAGAATGG - Intergenic
970724910 4:19032292-19032314 CCCTGGCTGAGAATGGAGAGTGG + Intergenic
972211887 4:36848466-36848488 CCTTGGGAGAGGAGTTAGAAAGG + Intergenic
972696491 4:41451551-41451573 CCATGGGGGAGAAGGGAGAGAGG - Intronic
973650965 4:52996797-52996819 CCTTGTGTGAGGAAGGAGCAAGG + Intronic
973652326 4:53008339-53008361 GCCAGGGTGGGGAGGGAGAGGGG - Intronic
976715333 4:88117213-88117235 GCTTGGGTGAGGTGGGAGGATGG + Intronic
976813990 4:89125343-89125365 CTCTGTGTTGGGAGGGAGAAAGG + Intergenic
976843574 4:89460650-89460672 CCCTGGGAGAGGTGAGAGACAGG + Intergenic
977569280 4:98612814-98612836 CCCTGTGGGGGGAGGGAGGAAGG - Intronic
978027626 4:103896916-103896938 CACTGGGTCAGGAGTGTGAATGG + Intergenic
979871243 4:125825113-125825135 GCCTAGGTGATGAGGGAGGATGG - Intergenic
980270896 4:130582394-130582416 CACTGGGGGAGCAGGGAGTATGG + Intergenic
981033765 4:140151279-140151301 ACCTGGGAGGGGAGGGAGGAGGG + Intronic
981550708 4:145938060-145938082 CCCAGAGTGAGGAGGGGGAAGGG + Intronic
981822507 4:148902042-148902064 CCTGGGCTGAGGAGGGAAAAAGG + Intergenic
982126975 4:152192518-152192540 CCCAGGGGTAGGAAGGAGAAAGG + Intergenic
982438063 4:155400369-155400391 ACTTGGTTGAGGAGGGAGGACGG - Intergenic
983803593 4:171966014-171966036 GCCTTGGTGATCAGGGAGAAGGG + Intronic
984853672 4:184175102-184175124 CACTGGGCAAGGAGGGAGAGCGG - Intronic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985805735 5:2041745-2041767 CCCTTGGTGAGGAGGTTTAATGG + Intergenic
985941608 5:3140768-3140790 CCCTGGGTGAGGTGGGGAAGCGG - Intergenic
986054024 5:4118280-4118302 CCCAAGGATAGGAGGGAGAAGGG - Intergenic
988029517 5:25745121-25745143 CCTTTGGTTAGGAGGGAAAAAGG + Intergenic
988440385 5:31226644-31226666 CCCTGGGAGAGGAGGCAAAAAGG - Intronic
988599149 5:32623418-32623440 CTCTTGGTGAGGCAGGAGAATGG + Intergenic
989439294 5:41451364-41451386 CTCTGCTTGAGGAGGGAGATGGG + Intronic
992392986 5:76346509-76346531 CCCAGGGAGAGAAGGGAGAAGGG + Intronic
992950429 5:81852345-81852367 CCCCGGGTGGGGAGTGAGGAAGG + Intergenic
994639561 5:102389977-102389999 GGCTGAGTGAGGAGGGAGGATGG - Intronic
995704489 5:114972923-114972945 GCCAGGGAGGGGAGGGAGAAGGG + Intergenic
995792580 5:115906643-115906665 CCCTGGGGGTGGAGGTAGAGGGG + Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998130994 5:139650956-139650978 TCCTTGGGGAGGAGGGAGAGGGG + Intronic
998453135 5:142250005-142250027 CCTGGGGTGAGGTGGGAGGAAGG + Intergenic
998862389 5:146457438-146457460 CCCTGGGTGAGCAGGGAATGGGG + Intronic
998906281 5:146908806-146908828 CCCTGGGTGGGAAGGAAGGAAGG - Intronic
999305174 5:150514930-150514952 CACTGGGGGAGGAGGAAGAAAGG + Intronic
999641086 5:153673920-153673942 CACAGGGTGAGGATGGAGACTGG + Intronic
1000168342 5:158677301-158677323 CCTTGGGGCAGGAGGGAGGAAGG - Intergenic
1000290662 5:159867504-159867526 ACCTGAGTGAAGAGGAAGAAAGG - Intergenic
1000453225 5:161416590-161416612 CCTTGGCTGAGGCAGGAGAATGG + Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001489072 5:172142881-172142903 CCCTGGGTGGGTGGGGGGAAAGG + Intronic
1001862223 5:175067380-175067402 CCTTTGGTGAGGAGGAAGAAAGG + Intergenic
1002100832 5:176856773-176856795 CCCTGCGTGAGGAGTGGGAGGGG - Intronic
1002297032 5:178237531-178237553 TGCTGGGTGGGGAGGGAAAAGGG - Intergenic
1002761133 6:203355-203377 CCCGGAGTGATGAGGGGGAAGGG - Intergenic
1002874960 6:1202555-1202577 GCTGGGGTGAGGAGGGAGAGCGG - Intergenic
1002878705 6:1233745-1233767 CCTAGGGTGAGGTTGGAGAAGGG + Intergenic
1003129659 6:3385074-3385096 GCTGGGGAGAGGAGGGAGAATGG + Intronic
1003165297 6:3672049-3672071 CCCTGGGTGAGGGTGGAGGGTGG + Intergenic
1003571187 6:7257785-7257807 GCCTGGGTGTGGAGGCAGAGAGG - Intergenic
1004276849 6:14244220-14244242 GCCTGGGAGAGAGGGGAGAAAGG + Intergenic
1004518066 6:16337371-16337393 GCCTGGATGAGGAAGGAGGAGGG + Intronic
1004767583 6:18748043-18748065 CCCTTGAGGAGGAGGGACAAGGG + Intergenic
1004886812 6:20059092-20059114 CCATGGGTGGGGAAGTAGAATGG + Intergenic
1004921341 6:20378999-20379021 CCCTGGGAGTGGAGGAAGACAGG - Intergenic
1005165337 6:22913398-22913420 GCCTGTTTGAGGTGGGAGAAGGG - Intergenic
1005736526 6:28752919-28752941 TCTTGGGTGGGGTGGGAGAAGGG + Intergenic
1006073853 6:31516533-31516555 CCATGGGTTGGGAGGGAGAATGG + Intergenic
1006257439 6:32843048-32843070 CCCTGGGTGGGGACGGAGAAAGG - Exonic
1006297021 6:33174216-33174238 CCCCTGGTGAGAACGGAGAAGGG + Exonic
1006297963 6:33178435-33178457 CCCCTGGTGAGGATGGAGAGAGG - Exonic
1006474973 6:34247700-34247722 ACCAGGGTGATGAGGAAGAAGGG + Exonic
1006725484 6:36196771-36196793 TCCCGGGGGAGGAGGGGGAATGG - Exonic
1006743000 6:36322640-36322662 CCCAGACTGAGGAGGCAGAAAGG - Intronic
1006908086 6:37546285-37546307 CCATGGGTGGTGAGGGGGAAGGG - Intergenic
1007309545 6:40934631-40934653 CCCTGGAGGAGGAGAGGGAATGG + Intergenic
1007390932 6:41549061-41549083 CCCTGGGTGTGGAGGCTGAGAGG - Intronic
1007690086 6:43695297-43695319 TCCTGGGTGAGGTGGAAGGAAGG - Intergenic
1007695799 6:43733777-43733799 CACGGGGAGAGGAGGGAGCAAGG + Intergenic
1008232579 6:49001765-49001787 TAATGGGTGAGGAGGAAGAAGGG - Intergenic
1009710641 6:67314069-67314091 CGGTGGCTGAGGCGGGAGAATGG - Intergenic
1009999527 6:70934385-70934407 CCCTTTGTGAAGTGGGAGAAGGG - Intronic
1010140961 6:72614127-72614149 TCCTAGCTGAGGAAGGAGAATGG - Intergenic
1011304770 6:85914086-85914108 CCATGGGGAAGGAGGGTGAAGGG - Intergenic
1011587422 6:88941766-88941788 CCTTGGCTGAGGCAGGAGAATGG - Intronic
1012118900 6:95339448-95339470 CCCTGAGGGAGGGGAGAGAAAGG - Intergenic
1013272828 6:108559489-108559511 GCCCGGGAGAGGAGGGAGAAGGG - Intergenic
1013291136 6:108719681-108719703 GCCTGGGAGTGCAGGGAGAACGG + Intergenic
1013414433 6:109912362-109912384 GCCTGGGGGAAGGGGGAGAAAGG + Intergenic
1013628404 6:111960091-111960113 CCCTGGGTTGGGATGGAGCAGGG + Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1015004258 6:128259084-128259106 CCATGTTTGAGGAGGGAGACAGG + Intronic
1015412512 6:132910893-132910915 CACTGGGTGAGGAGACAGGAAGG + Intergenic
1017205538 6:151800877-151800899 TCCTGGGTGCTTAGGGAGAATGG + Intronic
1017787895 6:157771802-157771824 CAGTGGGTGAGGCAGGAGAATGG - Intronic
1018787444 6:167119121-167119143 GCCTGGGTGGGGAGGCAGAAAGG - Intergenic
1018893049 6:167996189-167996211 CCCTTGGTGAGGGGGGAGTGGGG - Intergenic
1018945820 6:168346099-168346121 CCTTGGGAGAGGAGGGAGTGTGG + Intergenic
1018952641 6:168389149-168389171 ACCAGGGTGCGGAGGGAGAGGGG + Intergenic
1019085884 6:169476302-169476324 CCCTGGGAGAGCAAGGAGCAAGG - Intronic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019280043 7:194999-195021 CCTTGGGTGGGGAGAGAGGAAGG - Intronic
1019367430 7:642012-642034 CACTTGGGGAGGAGGGAGGAGGG - Intronic
1019522176 7:1466010-1466032 CCCTGGGAGGGGAGGGAGCCAGG - Intergenic
1019547440 7:1585320-1585342 CCCTGGGTCAGGACGGAGGTCGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019587447 7:1813149-1813171 CCCTGGCTGTGGAGGGGGAAGGG + Intergenic
1019867202 7:3722858-3722880 TCCTGAGAGAGGAGGGGGAATGG - Intronic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1019935264 7:4250946-4250968 GCCAGGGTTTGGAGGGAGAAGGG - Intronic
1020628359 7:10610645-10610667 CCGAGGCTGAGGCGGGAGAATGG - Intergenic
1021253230 7:18357753-18357775 CCCTGAGTCAGGAAGGAGCATGG + Intronic
1021686405 7:23191292-23191314 TGCTGTGTGAGGGGGGAGAAAGG + Intronic
1021838790 7:24705932-24705954 CCCTGGGGGAGGAGGGAGAAGGG + Intronic
1022398097 7:30008858-30008880 CCCAGGCTGAGGCAGGAGAATGG + Intergenic
1022410867 7:30137229-30137251 CACACGGTCAGGAGGGAGAAAGG - Intronic
1022539585 7:31123493-31123515 CCCTGGATGAGAAAGGTGAAGGG - Intergenic
1022984216 7:35634735-35634757 CCCTTGGAGAGAAGGGAGCAGGG + Intronic
1023663181 7:42491515-42491537 CCCTGGGAGACCAGGGAGATGGG + Intergenic
1024257060 7:47547147-47547169 TCCAGGGTGAGGAGGGAGGGAGG + Intronic
1024944643 7:54796589-54796611 GCCTGAGAGAGAAGGGAGAAAGG - Intergenic
1026340113 7:69427670-69427692 TCCATGGTGAGGAGGGAGAGGGG - Intergenic
1026948926 7:74334379-74334401 CCCTGGGAGGGGAGGGAGTCGGG + Intronic
1026977341 7:74506706-74506728 CCCTGGGTCAAGAAGGAGAGGGG + Intronic
1027050030 7:75016122-75016144 CCCTGAGTGGGGAGGGGGCACGG - Intronic
1027226320 7:76246087-76246109 CCCAGGGAGAGCAGAGAGAAAGG + Intronic
1028184180 7:87761803-87761825 CCCTGGGGGAAAAGGGAGCATGG + Intronic
1029109236 7:98203887-98203909 CACTGCGTGATGAGGGAGAGGGG - Intronic
1029383008 7:100225546-100225568 CCCTGAGTGGGGAGGGGGCACGG + Intronic
1029701998 7:102253277-102253299 CCCTGGCCAAGGAGGGAGATGGG - Exonic
1030371818 7:108708841-108708863 TCCTGGGCGGGGAGGGAGAGGGG - Intergenic
1030495326 7:110291543-110291565 CCCTGGGTGAGGCAGAAGAATGG + Intergenic
1030629480 7:111879569-111879591 CCCTGGATGAGAGGGGAGCAGGG + Intronic
1031900158 7:127400040-127400062 AACTGGGTGGGGAGGGAGTATGG + Intronic
1032077893 7:128844709-128844731 CCCTTGGTGTCGATGGAGAATGG - Exonic
1032224365 7:130019156-130019178 TACTGGGTGAGGCAGGAGAATGG - Intronic
1032338160 7:131045448-131045470 GCTTGGGAGAGGAGGGAGAAAGG - Intergenic
1032342804 7:131091507-131091529 CTCTAGTTGAGAAGGGAGAAGGG - Intergenic
1032700283 7:134373139-134373161 CCCTAGGAGAGAAAGGAGAAAGG + Intergenic
1033490065 7:141834694-141834716 CCGAGGCTGAGGCGGGAGAATGG - Intergenic
1034281818 7:149859847-149859869 CACTGGAGAAGGAGGGAGAAGGG - Intronic
1034426261 7:151015847-151015869 TCCTGTGAGGGGAGGGAGAAAGG - Intronic
1034957458 7:155343941-155343963 CCATTGGTGAGGTGGGAGAAAGG - Intergenic
1035041299 7:155929651-155929673 CACTGGATGAGGAGGGAGGGAGG + Intergenic
1035473312 7:159125385-159125407 CCCTGGGTGAGGAGGACACAAGG + Intronic
1036442671 8:8795245-8795267 ACCTGGGTGAGGATGGATAAGGG - Intronic
1036622610 8:10434818-10434840 CCAGGGGTCAGGAGGGAGACAGG - Intergenic
1036787831 8:11699541-11699563 CCTTGGATGGGGAGGGAGAGAGG + Intronic
1037771377 8:21802108-21802130 TACAGGGTGAGGAGTGAGAAGGG - Intronic
1037991067 8:23321581-23321603 CCTTGGGTGAGGAGGTGGAGAGG - Intronic
1038210896 8:25518268-25518290 CCCCAGATGAGTAGGGAGAAGGG + Intergenic
1038843809 8:31210521-31210543 CCCTGTGAAAGGAAGGAGAAGGG - Intergenic
1038921438 8:32089112-32089134 CCCTGGTGGAGGGGAGAGAAAGG + Intronic
1040011019 8:42661301-42661323 AGGTGGGGGAGGAGGGAGAATGG - Intergenic
1040772748 8:50998807-50998829 GCTTGGATGAGTAGGGAGAAGGG + Intergenic
1041463885 8:58140089-58140111 CCCAGGGTGCAGAGGAAGAAGGG + Intronic
1041721975 8:60984094-60984116 CCATTGGTGAGGAAGGAGCAGGG - Intergenic
1042226570 8:66519468-66519490 CCCTTGGTCGGGAGGGAGCAGGG + Intergenic
1043341227 8:79242044-79242066 GGCTAGGGGAGGAGGGAGAATGG + Intergenic
1043358255 8:79439325-79439347 CCCAGGAGGAGGAGAGAGAAGGG - Intergenic
1043780546 8:84328753-84328775 CCCAGAGTGGGGAGGGAGAGAGG - Intronic
1044686430 8:94830318-94830340 GGCTGGGTGAGGAGAGAAAAAGG + Intronic
1044824388 8:96182573-96182595 CCCTGGGTTTGGAGGGAGGGTGG - Intergenic
1046791959 8:118332026-118332048 CCCTAGGTGGGGTGGGGGAAAGG + Intronic
1047175466 8:122536519-122536541 CTCTGGGTGGGGTGGGAGAATGG + Intergenic
1047402207 8:124556828-124556850 TCCTGGGAATGGAGGGAGAAGGG - Intronic
1047748685 8:127864236-127864258 TCCTGGGTGAGCAGGGATGAAGG + Intergenic
1047852057 8:128867720-128867742 ACCTGGGGGTGGAGGGAGTACGG - Intergenic
1048953262 8:139513590-139513612 ATCTGGGTGGGGAGGGAGATTGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049430020 8:142557813-142557835 CCCGGGGGGAGGATGGGGAAAGG - Intergenic
1049662092 8:143824107-143824129 GCCTGGGTGGGGAGGGTGCAGGG + Intronic
1049844510 8:144793355-144793377 CCGTGGGTGGGGAGGCAGCAAGG + Intergenic
1051686867 9:19667308-19667330 ACCTGGGTGGGAAGGTAGAAAGG - Intronic
1051773131 9:20601535-20601557 CTCTGGGGGAGGAGGGATAGTGG - Intronic
1051847734 9:21471148-21471170 CCTAGGGAGAGGAGGGAGAGTGG + Intergenic
1053055680 9:34991878-34991900 CCCTAGGTGGGCAGGGACAATGG - Intronic
1053461769 9:38277024-38277046 GCCAGGCTGAGGAGGGGGAACGG + Intergenic
1054870809 9:70045613-70045635 CCCTGGGGGAGGATGGAGCCCGG + Intronic
1054948602 9:70824184-70824206 CCCTAAGTGATGAGGGGGAATGG + Intronic
1054998674 9:71423775-71423797 TCCTGGTAGAGAAGGGAGAAGGG - Intronic
1055002406 9:71466932-71466954 CTCTGGGGGAGGATGGACAAAGG + Intergenic
1056268622 9:84924771-84924793 CCATAGGAGTGGAGGGAGAAAGG - Intronic
1056465318 9:86848160-86848182 ACCTGGGTGAGCTGGCAGAAGGG - Intergenic
1056852561 9:90096705-90096727 CCCTGGTTGAGCAGGGAAGAGGG + Intergenic
1056933767 9:90900015-90900037 CCCTGGGTCAGCTGGGAGATGGG + Intergenic
1057810214 9:98251747-98251769 CCCTGGGTGTGCAGGCAGGAGGG + Intronic
1058654507 9:107207603-107207625 TCCTGGGTGGGGTGGGGGAATGG + Intergenic
1058674317 9:107387724-107387746 ACCTGGGAGAAGAGGCAGAACGG + Intergenic
1058869287 9:109188679-109188701 CCCTGGGTTAGGTGTTAGAAGGG - Intronic
1059366216 9:113788367-113788389 CCCTGGGGAAGGAGGGAGTTGGG - Intergenic
1059405702 9:114097435-114097457 ACCTGGGAGGGGAGGGAGGAGGG + Exonic
1059438687 9:114290706-114290728 CCCTGGGTGAAGCTGGAGGAAGG - Intronic
1059745028 9:117191898-117191920 CTCTGAGGGAGTAGGGAGAAAGG + Intronic
1059946052 9:119409489-119409511 TCCTGGGTGAGCAGGGAGGAGGG - Intergenic
1060180470 9:121530101-121530123 GACTGGGGGAGAAGGGAGAATGG + Intergenic
1060202408 9:121659125-121659147 CCCTGGCTGATGAGGGAGAGAGG + Intronic
1060329611 9:122655125-122655147 GCCTGGGGGAGCAGGGTGAATGG - Intergenic
1060395284 9:123312369-123312391 CCTTGGGTGAGAAGGAAGGAAGG + Intergenic
1060531107 9:124347399-124347421 CCCGGGCTGAGGTGGGAGCAAGG + Intronic
1060663230 9:125416501-125416523 CCCTGGGAGTGGAGGAAGAAGGG - Intergenic
1060693528 9:125686205-125686227 CCCAGGCTGAGGCGGGAGAACGG + Intronic
1060769040 9:126317480-126317502 CCAAGGGTCAGGAGGGAGAGAGG + Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060917279 9:127398617-127398639 GCCTGGGTCAGGAGGGGGAAAGG - Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061256383 9:129456011-129456033 CCCTGGGGGAGGAGAAGGAAGGG - Intergenic
1062009178 9:134258148-134258170 TCCTGGGGGAGGAGGGACAATGG - Intergenic
1062447311 9:136600363-136600385 CCCTGTGTGAGCAGAGAGCAGGG - Intergenic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1062572372 9:137191572-137191594 CCTTGGCTGAGAAGGGAGCAGGG - Intergenic
1203360550 Un_KI270442v1:217086-217108 GCCTGTGGGGGGAGGGAGAAGGG + Intergenic
1186120994 X:6360762-6360784 CCCAGGCTGAGGCAGGAGAATGG - Intergenic
1186174475 X:6910631-6910653 CCCTGGAGGAGGAAGGAGACAGG + Intergenic
1186506593 X:10098312-10098334 CCCTGGCTGGGGAGGGGGGAGGG - Intronic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1186870244 X:13764480-13764502 CCCTGCGGGTGGAGGGAGACGGG + Intronic
1187768517 X:22669531-22669553 CCCTGTGTAAGGGAGGAGAAAGG - Intergenic
1189308709 X:40005823-40005845 CCCAGGGTCAGAAGGTAGAAGGG - Intergenic
1189648233 X:43157907-43157929 CCCTGTGGAAGGAGAGAGAAAGG + Intergenic
1192170739 X:68852978-68853000 CCCTGGGGGAGGTAGGAGCAAGG - Intergenic
1192890872 X:75389456-75389478 TTCTGCTTGAGGAGGGAGAAGGG + Intronic
1193326330 X:80182122-80182144 CTCTGGGTGAGCAGGCAGGATGG - Intergenic
1194639829 X:96390625-96390647 GCCTGGGAGAGGAGGGAAACCGG + Intergenic
1194694752 X:97032208-97032230 ACCTGGTTGGGGATGGAGAAGGG + Intronic
1194868894 X:99102479-99102501 CTCTGCTGGAGGAGGGAGAAAGG - Intergenic
1194878872 X:99225337-99225359 CCTTGAGGGTGGAGGGAGAAAGG - Intergenic
1194965012 X:100278547-100278569 CCCTGGGTGAAGAGGCAGTATGG - Intergenic
1195334004 X:103831967-103831989 GCCTGTGAGAAGAGGGAGAAAGG - Intronic
1195348824 X:103977839-103977861 CCCTTGGTCAAGAGGGAAAAGGG + Intergenic
1195358619 X:104061000-104061022 CCCTTGGTCAAGAGGGAAAAGGG - Intergenic
1196052609 X:111321548-111321570 CCCTGGGGGATGAGGAATAAGGG + Intronic
1196364756 X:114911883-114911905 CCCTGGCTGAGGATGGATACTGG - Intergenic
1196429974 X:115614073-115614095 ACCTGGCTGAGGCAGGAGAATGG - Intronic
1196563026 X:117173501-117173523 AGCTGGGAGGGGAGGGAGAAGGG - Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199592839 X:149483807-149483829 TGCTGGGTGAGGATGGAGAAAGG - Intronic
1199680670 X:150222211-150222233 CCCTGAGTGAGCAGAGTGAATGG - Intergenic
1200000610 X:153058041-153058063 TCCTGCGTGAGGAGGAGGAATGG + Exonic
1200116010 X:153770012-153770034 CCATGGGAGAGGAAGGAGGACGG - Intronic
1200125897 X:153814725-153814747 ACCTGGGCGAGGGGGGACAAGGG - Intronic
1200162880 X:154018364-154018386 CCCAGGGTGCGGTGGGGGAAGGG + Intronic
1200283022 X:154794630-154794652 CACTGTGTGGGGAAGGAGAAGGG + Intronic
1202381974 Y:24281196-24281218 CCTTGGCTGAGGAGGGGGCAAGG - Intergenic
1202488810 Y:25388929-25388951 CCTTGGCTGAGGAGGGGGCAAGG + Intergenic